FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2031911979> ?p ?o ?g. }

• W2031911979 endingPage "4988" @default.
• W2031911979 startingPage "4978" @default.
• W2031911979 abstract "GATA transcription factors are important regulators of tissue-specific gene expression during development. GATA2 and GATA3 have been implicated in the regulation of trophoblast-specific genes. However, the regulatory mechanisms of GATA2 expression in trophoblast cells are poorly understood. In this study, we demonstrate that Gata2 is transcriptionally induced during trophoblast giant cell-specific differentiation. Transcriptional induction is associated with displacement of GATA3-dependent nucleoprotein complexes by GATA2-dependent nucleoprotein complexes at two regulatory regions, the –3.9- and +9.5-kb regions, of the mouse Gata2 locus. Analyses with reporter genes showed that, in trophoblast cells, –3.9- and +9.5-kb regions function as transcriptional enhancers in GATA motif independent and dependent fashions, respectively. We also found that knockdown of GATA3 by RNA interference induces GATA2 in undifferentiated trophoblast cells. Interestingly, three other known GATA motif-dependent Gata2 regulatory elements, the –1.8-, –2.8-, and –77-kb regions, which are important to regulate Gata2 in hematopoietic cells are not occupied by GATA factors in trophoblast cells. These elements do not show any enhancer activity and also possess inaccessible chromatin structure in trophoblast cells indicating a context-dependent function. Our results indicate that GATA3 directly represses Gata2 in undifferentiated trophoblast cells, and a switch in chromatin occupancy between GATA3 and GATA2 (GATA3/GATA2 switch) induces transcription during trophoblast differentiation. We predict that this GATA3/GATA2 switch is an important mechanism for the transcriptional regulation of other trophoblast-specific genes. GATA transcription factors are important regulators of tissue-specific gene expression during development. GATA2 and GATA3 have been implicated in the regulation of trophoblast-specific genes. However, the regulatory mechanisms of GATA2 expression in trophoblast cells are poorly understood. In this study, we demonstrate that Gata2 is transcriptionally induced during trophoblast giant cell-specific differentiation. Transcriptional induction is associated with displacement of GATA3-dependent nucleoprotein complexes by GATA2-dependent nucleoprotein complexes at two regulatory regions, the –3.9- and +9.5-kb regions, of the mouse Gata2 locus. Analyses with reporter genes showed that, in trophoblast cells, –3.9- and +9.5-kb regions function as transcriptional enhancers in GATA motif independent and dependent fashions, respectively. We also found that knockdown of GATA3 by RNA interference induces GATA2 in undifferentiated trophoblast cells. Interestingly, three other known GATA motif-dependent Gata2 regulatory elements, the –1.8-, –2.8-, and –77-kb regions, which are important to regulate Gata2 in hematopoietic cells are not occupied by GATA factors in trophoblast cells. These elements do not show any enhancer activity and also possess inaccessible chromatin structure in trophoblast cells indicating a context-dependent function. Our results indicate that GATA3 directly represses Gata2 in undifferentiated trophoblast cells, and a switch in chromatin occupancy between GATA3 and GATA2 (GATA3/GATA2 switch) induces transcription during trophoblast differentiation. We predict that this GATA3/GATA2 switch is an important mechanism for the transcriptional regulation of other trophoblast-specific genes. In the early mouse embryo, trophoectoderm overlaying the inner cell mass contains trophoblast stem (TS) 2The abbreviations used are: TS, trophoblast stem; PL-I, placental lactogen I; DHS, DNase I hypersensitive sites; FGF4, fibroblast growth factor 4; CREB, cAMP-response element-binding protein; MEF, mouse embryonic fibroblast; RT, reverse transcriptase; shRNA, short hairpin RNA; Pol II, polymerase II; ChIP, chromatin immunoprecipitation.2The abbreviations used are: TS, trophoblast stem; PL-I, placental lactogen I; DHS, DNase I hypersensitive sites; FGF4, fibroblast growth factor 4; CREB, cAMP-response element-binding protein; MEF, mouse embryonic fibroblast; RT, reverse transcriptase; shRNA, short hairpin RNA; Pol II, polymerase II; ChIP, chromatin immunoprecipitation. cells (1Rossant J. Stem Cells. 2001; 19: 477-482Crossref PubMed Scopus (196) Google Scholar). During development, TS cells give rise to distinct highly differentiated trophoblast subtypes, which build the functional units of the organ, the placenta (2Simmons D.G. Cross J.C. Dev. Biol. 2005; 284: 12-24Crossref PubMed Scopus (265) Google Scholar). Trophoblast cells are important for the anchorage of the embryo to the mother, for establishing a vascular connection for nutrient and gas transport to the embryo, and expression of hormones that are required for the successful progression of pregnancy (3Rossant J. Cross J.C. Nat. Rev. 2001; 2: 538-548Crossref Scopus (990) Google Scholar). In rodents, multiple differentiated cell types can be derived from TS cells: trophoblast giant cells, spongiotrophoblast, syncytiotrophoblast, glycogen trophoblast cells, and invasive trophoblasts (2Simmons D.G. Cross J.C. Dev. Biol. 2005; 284: 12-24Crossref PubMed Scopus (265) Google Scholar, 4Ain R. Canham L.N. Soares M.J. Dev. Biol. 2003; 260: 176-190Crossref PubMed Scopus (194) Google Scholar). Trophoblast giant cells are characterized by endoreduplication and expression of members of the prolactin gene family. During pregnancy, these cells invade into the uterus and promote local and systemic adaptations in the mother that are necessary for embryonic growth and survival (2Simmons D.G. Cross J.C. Dev. Biol. 2005; 284: 12-24Crossref PubMed Scopus (265) Google Scholar, 3Rossant J. Cross J.C. Nat. Rev. 2001; 2: 538-548Crossref Scopus (990) Google Scholar). Differentiation of trophoblast giant cells occurs in a spatially and temporally highly organized manner and multiple transcription factors, including GATA2 and GATA3, have been implicated in the transcriptional regulation of trophoblast giant cell-specific gene expression (5Cross J.C. Baczyk D. Dobric N. Hemberger M. Hughes M. Simmons D.G. Yamamoto H. Kingdom J.C. Placenta. 2003; 24: 123-130Crossref PubMed Scopus (281) Google Scholar, 6Cross J.C. Placenta. 2005; 26: S3-S9Crossref PubMed Scopus (181) Google Scholar, 7Ng Y.K. George K.M. Engel J.D. Linzer D.I. Development. 1994; 120: 3257-3266Crossref PubMed Google Scholar, 8Ma G.T. Roth M.E. Groskopf J.C. Tsai F.Y. Orkin S.H. Grosveld F. Engel J.D. Linzer D.I. Development. 1997; 124: 907-914Crossref PubMed Google Scholar). The GATA family of transcription factors, GATA1–GATA6, controls multiple developmental processes by regulating tissue-specific gene expression by binding to W(A/T)GAT-AR(A/G) motifs (GATA motifs) of regulatory elements (9Bresnick E.H. Martowicz M.L. Pal S. Johnson K.D. J. Cell. Physiol. 2005; 205: 1-9Crossref PubMed Scopus (90) Google Scholar, 10Molkentin J.D. J. Biol. Chem. 2000; 275: 38949-38952Abstract Full Text Full Text PDF PubMed Scopus (727) Google Scholar). GATA family members have been subdivided into two subfamilies based on their expression and functional analysis. GATA1, GATA2, and GATA3 regulate the development of different hematopoietic lineages: erythroid, hematopoietic progenitor, and T-lymphoid, respectively (11Pevny L. Simon M.C. Robertson E. Klein W.H. Tsai S.F. D'Agati V. Orkin S.H. Costantini F. Nature. 1991; 349: 257-260Crossref PubMed Scopus (1040) Google Scholar, 12Tsai F.Y. Keller G. Kuo F.C. Weiss M. Chen J. Rosenblatt M. Alt F.W. Orkin S.H. Nature. 1994; 371: 221-226Crossref PubMed Scopus (1186) Google Scholar, 13Pandolfi P.P. Roth M.E. Karis A. Leonard M.W. Dzierzak E. Grosveld F.G. Engel J.D. Lindenbaum M.H. Nat. Genet. 1995; 11: 40-44Crossref PubMed Scopus (504) Google Scholar). Similarly, GATA4, GATA5, and GATA6 have been shown to be involved in cardiac, genitourinary, and multiple endodermal developmental events (14Molkentin J.D. Lin Q. Duncan S.A. Olson E.N. Genes Dev. 1997; 11: 1061-1072Crossref PubMed Scopus (955) Google Scholar, 15Molkentin J.D. Tymitz K.M. Richardson J.A. Olson E.N. Mol. Cell. Biol. 2000; 20: 5256-5260Crossref PubMed Scopus (109) Google Scholar, 16Morrisey E.E. Tang Z. Sigrist K. Lu M.M. Jiang F. Ip H.S. Parmacek M.S. Genes Dev. 1998; 12: 3579-3590Crossref PubMed Scopus (541) Google Scholar). GATA2 was initially cloned from chicken reticulocyte as a GATA motif-binding factor and was shown to be present in all developmental stages of erythroid cells (17Yamamoto M. Ko L.J. Leonard M.W. Beug H. Orkin S.H. Engel J.D. Genes Dev. 1990; 4: 1650-1662Crossref PubMed Scopus (451) Google Scholar). Targeted deletion of Gata2 resulted in embryonic lethality at embryonic day 10.5–11.5 due to ablation of blood cell development (12Tsai F.Y. Keller G. Kuo F.C. Weiss M. Chen J. Rosenblatt M. Alt F.W. Orkin S.H. Nature. 1994; 371: 221-226Crossref PubMed Scopus (1186) Google Scholar). However, GATA2 is also expressed in other hematopoietic cells, neurons, and cells of developing heart, liver, pituitary, and in trophoblasts (7Ng Y.K. George K.M. Engel J.D. Linzer D.I. Development. 1994; 120: 3257-3266Crossref PubMed Google Scholar, 18Craven S.E. Lim K.C. Ye W. Engel J.D. de Sauvage F. Rosenthal A. Development. 2004; 131: 1165-1173Crossref PubMed Scopus (122) Google Scholar, 19Minegishi N. Ohta J. Yamagiwa H. Suzuki N. Kawauchi S. Zhou Y. Takahashi S. Hayashi N. Engel J.D. Yamamoto M. Blood. 1999; 93: 4196-4207Crossref PubMed Google Scholar, 20Nardelli J. Thiesson D. Fujiwara Y. Tsai F.Y. Orkin S.H. Dev. Biol. 1999; 210: 305-321Crossref PubMed Scopus (176) Google Scholar, 21Orlic D. Anderson S. Biesecker L.G. Sorrentino B.P. Bodine D.M. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 4601-4605Crossref PubMed Scopus (135) Google Scholar, 22Steger D.J. Hecht J.H. Mellon P.L. Mol. Cell. Biol. 1994; 14: 5592-5602Crossref PubMed Google Scholar). GATA3 was first cloned as a T cell-specific transcript (23Zheng W. Flavell R.A. Cell. 1997; 89: 587-596Abstract Full Text Full Text PDF PubMed Scopus (1891) Google Scholar, 24Flavell R.A. Li B. Dong C. Lu H.T. Yang D.D. Enslen H. Tournier C. Whitmarsh A. Wysk M. Conze D. Rincon M. Davis R.J. Cold Spring Harbor Symp. Quant. Biol. 1999; 64: 563-571Crossref PubMed Scopus (25) Google Scholar). Germ line deletion of Gata3 results in embryonic lethality due to a multitude of phenotypic abnormalities, including growth retardation, severe deformities of the brain and spinal cord, and gross aberrations in fetal liver hematopoiesis (13Pandolfi P.P. Roth M.E. Karis A. Leonard M.W. Dzierzak E. Grosveld F.G. Engel J.D. Lindenbaum M.H. Nat. Genet. 1995; 11: 40-44Crossref PubMed Scopus (504) Google Scholar). Interestingly, expression analysis during early mouse development showed that GATA3 is most abundantly expressed in trophoblast cells prior to embryonic day 10.5 (25George K.M. Leonard M.W. Roth M.E. Lieuw K.H. Kioussis D. Grosveld F. Engel J.D. Development. 1994; 120: 2673-2686Crossref PubMed Google Scholar). Although GATA2 and GATA3 are expressed in trophoblast cells, very little is known about GATA factor function and their regulation in this context. Studies in a choriocarcinoma-derived rat trophoblast stem cell line (Rcho-1 trophoblast cells) showed that both GATA2 and GATA3 regulate trophoblast-specific expression of placental lactogen I (PL-I; also known as Prl3d1) gene (7Ng Y.K. George K.M. Engel J.D. Linzer D.I. Development. 1994; 120: 3257-3266Crossref PubMed Google Scholar). Studies with knock-out mice showed that placentas develop in Gata2 and Gata3-null embryos (8Ma G.T. Roth M.E. Groskopf J.C. Tsai F.Y. Orkin S.H. Grosveld F. Engel J.D. Linzer D.I. Development. 1997; 124: 907-914Crossref PubMed Google Scholar). However, placentas lacking Gata2 or Gata3 exhibited reduced PL-I and proliferin (also known as Prl2c2) gene expression, with Gata2-null placentas having greater reductions in proliferin (8Ma G.T. Roth M.E. Groskopf J.C. Tsai F.Y. Orkin S.H. Grosveld F. Engel J.D. Linzer D.I. Development. 1997; 124: 907-914Crossref PubMed Google Scholar). Besides, placentation sites lacking GATA2 have significantly less neovascularization compared with wild-type placentas in the same uterus (8Ma G.T. Roth M.E. Groskopf J.C. Tsai F.Y. Orkin S.H. Grosveld F. Engel J.D. Linzer D.I. Development. 1997; 124: 907-914Crossref PubMed Google Scholar). Important mechanistic information regarding Gata2 transcriptional regulation has come from analysis of the native nucleoprotein structure of the endogenous Gata2 locus in hematopoietic precursor cells (26Grass J.A. Boyer M.E. Pal S. Wu J. Weiss M.J. Bresnick E.H. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 8811-8816Crossref PubMed Scopus (296) Google Scholar, 27Pal S. Cantor A.B. Johnson K.D. Moran T.B. Boyer M.E. Orkin S.H. Bresnick E.H. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 980-985Crossref PubMed Scopus (128) Google Scholar, 28Martowicz M.L. Grass J.A. Boyer M.E. Guend H. Bresnick E.H. J. Biol. Chem. 2005; 280: 1724-1732Abstract Full Text Full Text PDF PubMed Scopus (70) Google Scholar, 29Grass J.A. Jing H. Kim S.I. Martowicz M.L. Pal S. Blobel G.A. Bresnick E.H. Mol. Cell. Biol. 2006; 26: 7056-7067Crossref PubMed Scopus (117) Google Scholar). These studies indicated that during erythroid differentiation GATA1 and GATA2 directly regulate Gata2 transcription in a reciprocal fashion (26Grass J.A. Boyer M.E. Pal S. Wu J. Weiss M.J. Bresnick E.H. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 8811-8816Crossref PubMed Scopus (296) Google Scholar). Analysis of the mouse Gata2 locus in erythroid progenitors showed that in the transcriptionally active state, GATA2 occupies four conserved upstream elements (–77, –3.9, –2.8, and –1.8 kb) along with an intronic (+9.5 kb) conserved element (26Grass J.A. Boyer M.E. Pal S. Wu J. Weiss M.J. Bresnick E.H. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 8811-8816Crossref PubMed Scopus (296) Google Scholar, 28Martowicz M.L. Grass J.A. Boyer M.E. Guend H. Bresnick E.H. J. Biol. Chem. 2005; 280: 1724-1732Abstract Full Text Full Text PDF PubMed Scopus (70) Google Scholar, 29Grass J.A. Jing H. Kim S.I. Martowicz M.L. Pal S. Blobel G.A. Bresnick E.H. Mol. Cell. Biol. 2006; 26: 7056-7067Crossref PubMed Scopus (117) Google Scholar). GATA1-mediated repression of Gata2 transcription was tightly coupled with displacement of GATA2 by GATA1 (GATA2/GATA1 switch) from those regulatory elements. Studies with GATA factor cofactor friend of GATA1 (FOG1)-null cells showed that FOG1 plays an unique role in this regulatory mechanism, in which it facilitates the chromatin occupancy of GATA1 displacing GATA2 from the Gata2 locus (27Pal S. Cantor A.B. Johnson K.D. Moran T.B. Boyer M.E. Orkin S.H. Bresnick E.H. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 980-985Crossref PubMed Scopus (128) Google Scholar). These findings support a model in which GATA2 positively autoregulates transcription by binding to its own locus. In erythroid progenitors, this autoregulation is abrogated by a FOG1-dependent GATA2/GATA1 switch that triggers formation of regulatory complexes leading to repression of transcription. To begin to understand the role of GATA factors in trophoblast function, we studied Gata2 transcriptonal regulation in Rcho-1 trophoblast stem cells (30Faria T.N. Soares M.J. Endocrinology. 1991; 129: 2895-2906Crossref PubMed Scopus (180) Google Scholar, 31Sahgal N. Canham L.N. Canham B. Soares M.J. Methods Mol. Med. 2006; 121: 159-178PubMed Google Scholar) and mouse TS cells (32Tanaka S. Kunath T. Hadjantonakis A.K. Nagy A. Rossant J. Science. 1998; 282: 2072-2075Crossref PubMed Scopus (1078) Google Scholar), and during their differentiation to the trophoblast giant cell lineage. Herein, we demonstrate that in trophoblast stem cells GATA3 directly represses Gata2 by occupying the –3.9- and +9.5-kb regulatory elements at the Gata2 locus. During trophoblast differentiation, GATA2 displaces GATA3 thereby forming a transcriptionally favorable nucleoprotein complex at the Gata2 locus. This GATA2-mediated displacement of GATA3 (GATA3/GATA2 switch) is associated with displacement of cofactor FOG1 and recruitment of cofactor Mediator1/TRAP220 (MED1/TRAP220) at the Gata2 locus. These studies define an important mechanism of Gata2 regulation in trophoblast cells and implicate a GATA3/GATA2 switch as an important molecular determinant for gene regulation during trophoblast differentiation. Cell Culture and Reagents—Rcho-1 trophoblast cells were cultured as mentioned earlier (31Sahgal N. Canham L.N. Canham B. Soares M.J. Methods Mol. Med. 2006; 121: 159-178PubMed Google Scholar). Cells were maintained in a proliferative state by culturing under subconfluent conditions with RPMI 1640 medium (Invitrogen) supplemented with 20% fetal bovine serum (Atlas Biologicals, Fort Collins, CO), 50 μm 2-mercaptoethanol (2-ME) (Sigma), 1 mm sodium pyruvate, and 1% penicillin/streptomycin (Invitrogen). Differentiation was induced by replacing the culture medium with NCTC 135 culture medium (Sigma) supplemented with 1% horse serum, 50 μm 2-mercaptoethanol, 1 mm sodium pyruvate, 2.3 μg/ml HEPES, 2.2 μg/ml sodium bicarbonate, and 1% penicillin/streptomycin. Differentiation was continued for a period of 8 days at which point most of the cells appeared to be giant cells. Mouse TS cells were initially cultured on a feeder layer of primary mouse embryonic fibroblasts (MEF) in the presence of 25 ng/ml fibroblast growth factor 4 (FGF4; Sigma) and heparin (1 μg/ml) in TS cell medium (RPMI 1640 supplemented with 20% fetal bovine serum, 2-mercaptoethanol (100 μm), sodium pyruvate (1 mm), l-glutamine (2 mm), and 1% penicillin/streptomycin). For experiments, mouse TS cells were expanded in a proliferative state without MEF feeders by culturing in the presence of 70% MEF-conditioned medium, 30% TS cell medium containing, 20% fetal bovine serum, 25 ng/ml FGF4 (Sigma), and 1 μg/ml heparin (Sigma). MEF-conditioned medium was produced by addition of 10.5 ml of TS cell medium to 100-mm culture plates containing 2 × 106 mitomycin-C (10 μg/ml; Sigma)-treated MEFs. Differentiation of TS cells was induced by culturing them in medium devoid of FGF4, heparin, and MEF-conditioned medium. Human embryonic kidney-293T cells were cultured in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% fetal bovine serum. Quantitative RT-PCR—RNA was extracted from different cell samples with TRIzol reagent (Invitrogen). cDNA was prepared by annealing RNA (1 μg) with 250 ng of a 5:1 mixture of random and oligo(dT) primers heated at 68 °C for 10 min. This was followed by incubation with Moloney murine leukemia virus reverse transcriptase (50 units) (Invitrogen) combined with 10 mm dithiothreitol, RNasin (Promega, Madison, WI), and 0.5 mm dNTPs at 42 °C for 1 h. Reactions were diluted to a final volume of 100 μl and heat inactivated at 97 °C for 5 min. A 20-μl PCR contained 2 μl of cDNA, 10 μl of SYBR Green Master Mix (Applied Biosystems, Foster City, CA), and corresponding primer sets. Control reactions lacking reverse transcriptase (RT) yielded very low signals. Relative expression levels were determined from a standard curve of serial dilutions of the proliferative Rcho-1 trophoblast cell and undifferentiated TS cell cDNA samples and were normalized to the expression of 18 S ribosomal RNA (18S rRNA) and glyceraldehyde-3-phosphate dehydrogenase, respectively. Forward and reverse primers for quantitative RT-PCR were (5′-3′): mouse Gata2, GCAGAGAAGCAAGGCTCGC and CAGTTGACACACTCCCGGC; mouse Gata3, CGGGTTCGGATGTAAGTCGA and GTAGAGGTTGCCCCGCAGT; rat Gata2, TAAGCAGCGAAGCAAGGCTC and AGCTTCAGATTCATTTTCAGAGCA; rat Gata3, CGGGTTCGGATGTAAGTCGA and CCCGCAGTTCACACACTCC; rat Gata1, TCTCATCCGGCCCAAGAAG and AGTTAGTGCATTGGGTGCCTG; rat Gata4, GCCAACCCTGCGAGACAC and CTCTGCCTTCTGAGAAGTCATCAA; rat Gata5, CCTCCCTGGCCGCAG and CAGGGAACTCCTCCAAGAAGT; rat Gata6, CTCCCGGTGCCACGAG and TCTCCGACAGGTCCTCCAAC; rat Fog1, ATAGAGGAGCCCCCAAGTCC and GTGCCGACACTGTAGGTAGGC; rat Fog2, GCCATGGCTTCTATTTTGCCT and AAATGCCACAGGACTTGCAAG; rat caudal type homeobox 2 (Cdx2), AGCTCAGCCGTCCCTAGGA and CCCGGTATTTGTCTTTCGTCC; rat transcription factor EB (Tfeb), GATGCCTAACACGCTACCCCTGT and TCTCAGCATCTGTTAGCTCTCGCT; rat trophoblast-specific protein α (Tpbpa), GCAAGAGCAGAAGGGTAAAGAAGG and TTTCTATGTCGAGCTCCTCCTCCT; rat connexin 31 (Cx 31), TGTGAACCAGTACTCCACCGCATT and GCTGCCTGGTGTTACAGTCAAAGT; rat PRL-like protein-N (PLP-N, also known as Prl7b1), AACAATGCCTCTGGCCACTGC and AGGCCATTGATGTGCTGAGACAGT; rat PL-I, TCGCGCCTCTGGTATGCAAC and TGGACACAATGGCAGTTGGTTTGG; rat placental lactogen II (PL-II; also known as Prl3b1), ACCATGCTTCTCTGGGACACT and AGGCTTCCAGTGGACATTCGGTAA; and 18S rRNA, GCAATTATTCCCCATGAACG, and GGCCTCACTAAACCATCCAA. Northern Blot Analysis—For Northern blot analysis total RNA was extracted from undifferentiated and day 8 differentiated Rcho-1 trophoblast cells using TRIzol reagent. Total RNA (20 μg/lane) was resolved in 1% formaldehyde-agarose gels, transferred to nitrocellulose membranes (Schleicher & Schuell Bioscience, Keene, NH), and cross-linked. Blots were probed with 32P-labeled cDNAs (PerkinElmer Life Sciences) for Gata2, NM_033442 (GenBank); and PL-II, NM_012535 (GenBank). Glyceraldehyde 3-phosphate dehydrogenase (Gapdh) cDNA was used to evaluate the integrity and equal loading of RNA samples. Probes were generated using Prime-it II random primer labeling kits (Stratagene). Probes were incubated with the blots at 42 °C overnight and washed twice with 2× SSPE, 0.1× SDS at 42 °C for 25 min and 1× SSPE, 0.1× SDS at 50 °C for 35 min. Blots were then exposed to x-ray film at –80 °C. At least three different samples from three different experiments were analyzed with each probe. Protein Analysis—For Western blot analysis, protein lysates were prepared in radioimmunoprecipitation assay (RIPA) buffer (10 mm Tris-HCl, pH 7.6, 1% Triton X-100, 1% Nonidet P-40, 1% sodium deoxycholate, 0.1% SDS, 150 mm NaCl, 5 mm EDTA, 1 mm sodium orthovanadate, 1 mm phenylmethylsulfonyl fluoride, 10 μg/ml aprotinin). Protein concentrations were determined by the Bradford assay (Bio-Rad) and resolved by 8 or 10% PAGE. Monoclonal anti-GATA3 (Hg3–31) antibody was obtained from Santa Cruz Biotechnology, Santa Cruz, CA. Anti-β-actin was obtained from Calbiochem, San Diego, CA. Polyclonal rabbit anti-GATA2 and anti-FOG1 antibodies used for our study were described earlier (27Pal S. Cantor A.B. Johnson K.D. Moran T.B. Boyer M.E. Orkin S.H. Bresnick E.H. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 980-985Crossref PubMed Scopus (128) Google Scholar). Horseradish peroxidase-conjugated goat anti-rabbit and anti-mouse from Santa Cruz Biotechnology were used as secondary antibodies. To detect FOG1, Rcho-1 trophoblast cell lysates were prepared in RIPA buffer. Lysates were cleared by centrifugation at 13,000 × g for 30 min at 4 °C, and immunoprecipitated with preimmune rabbit serum or rabbit anti-FOG1 polyclonal antibody. Immune complexes were adsorbed to protein A-Sepharose, and resolved on 8% PAGE and analyzed by Western blotting using ECL Plus reagent (GE Healthcare). RNA Interference—Lentiviral vectors containing short hairpin RNAs (shRNAs) targeting rat Gata3 mRNA were cloned in pLKO1 (Open Biosystems, Huntsville, AL). Lentiviral supernatants were produced in human embryonic kidney-293T cells by transfection with calcium phosphate as described earlier (33Dutta D. Ray S. Vivian J.L. Paul S. J. Biol. Chem. 2008; 283: 25404-25413Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar). Lentiviral supernatants were collected after 24 and 48 h of incubation. Undifferentiated Rcho-1 trophoblast cells grown to 70% confluence were incubated with 8 μg/ml Polybrene (Sigma) containing medium for 30 min followed by infection with lentiviral supernatants. Infected Rcho-1 trophoblast cells were selected by addition of 3 μg/ml of puromycin (Sigma) after 48 h of infection. After 3 days samples were prepared for mRNA and protein analysis. The Gata3 target sequence 5′-GCCTGCGGACTCTACCATAAA-3′ successfully knocked down expression of the target gene. For control experiments cells were infected either with empty viral vector or vectors expressing shRNAs against the Gata3 target sequence 5′-CGGATGTAAGTCGAGGCCCAA-3′, which did not knock-down GATA3 expression. Quantitative ChIP Assay—Real-time PCR-based quantitative ChIP analysis was performed according to an earlier described protocol (34Im H. Grass J.A. Johnson K.D. Boyer M.E. Wu J. Bresnick E.H. Methods Mol. Biol. 2004; 284: 129-146PubMed Google Scholar). Undifferentiated and differentiated Rcho-1 trophoblast and mouse TS cells were trypsinized, washed, and resuspended in phosphate-buffered saline, and protein-DNA cross-linking was conducted by treating cells with formaldehyde at a final concentration of 1% for 10 min at room temperature with gentle agitation. Glycine (0.125 m) was added to quench the reaction. Antibodies against GATA2, GATA3, FOG1, MED1/TRAP220 (M-255; Santa Cruz), CBP/P300 (A-22; Santa Cruz), diacetylated histone 3 (acH3; Millipore, Billerica, MA), tetra-acetylated histone 4 (acH4; Millipore), and RNA polymerase II (Pol II; N20, Santa Cruz) were used to immunoprecipitate protein-DNA cross-linked fragments. Immunoprecipitated DNA was analyzed by real-time PCR (ABI 7500, Applied Biosystem, Foster City, CA). Primers were designed to amplify 60- to 100-bp amplicons and were based on sequences in the Ensembl data base for mouse and rat Gata2 loci. Samples from three or more immunoprecipitations were analyzed. Products were measured by SYBR Green fluorescence in 25-μl reactions. The amount of product was determined relative to a standard curve of input chromatin. Dissociation curves showed that PCRs yielded single products. Primer sequences are available on request. Transient Transfection Assay—Plasmid constructs (in pGL3 basic vector; Promega) containing a luciferase reporter gene fused to hematopoietic cell-specific (1S) promoter (35Minegishi N. Ohta J. Suwabe N. Nakauchi H. Ishihara H. Hayashi N. Yamamoto M. J. Biol. Chem. 1998; 273: 3625-3634Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar) of mouse Gata2 gene alone or in combination with Gata2 regulatory elements have been described earlier (28Martowicz M.L. Grass J.A. Boyer M.E. Guend H. Bresnick E.H. J. Biol. Chem. 2005; 280: 1724-1732Abstract Full Text Full Text PDF PubMed Scopus (70) Google Scholar, 29Grass J.A. Jing H. Kim S.I. Martowicz M.L. Pal S. Blobel G.A. Bresnick E.H. Mol. Cell. Biol. 2006; 26: 7056-7067Crossref PubMed Scopus (117) Google Scholar) and were kind gifts from Dr. Emery H. Bresnick (University of Wisconsin Madison, Madison, WI). For transient transfection analysis, undifferentiated or day 4 differentiated Rcho-1 trophoblast cells were transfected with an equal amount of each plasmid (3 μg). Plasmids were added to 150 μl of Opti-MEM (Invitrogen) reduced serum medium, incubated with Lipofectamine reagent (Invitrogen) for 20 min at room temperature, and then added to the cells. After 3 h of incubation the transfection mixture was replaced with culture medium. Cell lysates were harvested 48 h post-transfection and luciferase activity was measured in a Veritas Microplate Luminometer using the luciferase assay buffer (Promega). The luciferase activity for each sample was normalized to the protein concentration of the lysate. At least three independent preparations of each plasmid were analyzed. DNase I Hypersensitive Site Mapping—DNase I hypersensitive sites (DHSs) were mapped according to the procedure described by Follows et al. (36Follows G.A. Janes M.E. Vallier L. Green A.R. Gottgens B. Nucleic Acids Res. 2007; 35: e56Crossref PubMed Scopus (16) Google Scholar) with a few modifications. Briefly, to generate whole genome DHS libraries from undifferentiated and day 8 differentiated Rcho-1 trophoblast cells, nuclei were generated by lysing cells (3 × 106 cells for each condition) in cell lysis buffer (300 mm sucrose, 10 mm Tris, pH 7.4, 15 mm NaCl, 5 mm MgCl2, 0.1 mm EDTA, 60 mm KCl, 0.2% Nonidet P-40, 0.5 mm phenylmethylsulfonyl fluoride, 20 μg/ml leupeptin, 5 mm dithiothreitol). Nuclei were gently resuspended in reaction buffer containing different units of DNase I (New England Biolab, Beverly, MA) and left to incubate at 4 °C. After 1 h, 700 μl of nuclear lysis buffer (100 mm Tris-HCl, pH 8, 5 mm EDTA, 200 mm NaCl, 0.2% SDS) and 50 μg of proteinase K were added to each set and incubated at 55 °C for 1 h followed by a 30-min incubation at 37 °C with 10 μg of RNase A. Digested DNA fragments were extracted with phenol/chloroform, blunt ended with T4 polymerase (New England Biolab), and ligated with an asymmetric double-stranded linker (LP21; GAATTCAGATCTCCCGGGTCA-LP25; GCGGTGACCCGGGAGATCTGAATTC linker). The precipitated ligated DNA was amplified using Vent exo-polymerase (New England Biolab) and a biotinylated LP25 primer. Following amplification, products were extracted using DynaI-streptavidin beads (Dynabeads M-270, Dynal Biotech) and suspended in TE buffer. From the library, DHSs at the Gata2 locus were determined by measuring relative enrichment of DNase I-treated samples versus DNase I-untreated samples by real-time PCR using region-specific primers. We used the same primers that were used for ChIP analysis. Quantification of samples was done using SYBR Green (Applied Biosystems) where standard curves were generated with known amounts of genomic DNA. Induction of Gata2 Expression during Trophoblast Giant Cell-specific Differentiation—To determine whether GATA2 expression is dynamically regulated during trophoblast differentiation, we used Rcho-1 trophoblast cells as a model system. Rcho-1 trophoblast cells represent a faithful model for studying rat trophoblast cells in undifferentiated and differentiated states (31Sahgal N. Canham L.N. Canham B. Soares M.J. Methods Mol. Med. 2006; 121: 159-178PubMed Google Scholar, 37Sahgal N. Canham L.N. Konno T. Wolfe M.W. Soares M.J. D" @default.
• W2031911979 created "2016-06-24" @default.
• W2031911979 creator A5010696819 @default.
• W2031911979 creator A5014834868 @default.
• W2031911979 creator A5032746085 @default.
• W2031911979 creator A5054140222 @default.
• W2031911979 creator A5075519418 @default.
• W2031911979 creator A5082285133 @default.
• W2031911979 date "2009-02-01" @default.
• W2031911979 modified "2023-10-16" @default.
• W2031911979 title "Context-dependent Function of Regulatory Elements and a Switch in Chromatin Occupancy between GATA3 and GATA2 Regulate Gata2 Transcription during Trophoblast Differentiation" @default.
• W2031911979 cites W115221593 @default.
• W2031911979 cites W1652517067 @default.
• W2031911979 cites W1970508192 @default.
• W2031911979 cites W1975751233 @default.
• W2031911979 cites W1979267620 @default.
• W2031911979 cites W1979683490 @default.
• W2031911979 cites W1983571112 @default.
• W2031911979 cites W2008300544 @default.
• W2031911979 cites W2015795642 @default.
• W2031911979 cites W2018658982 @default.
• W2031911979 cites W2021516648 @default.
• W2031911979 cites W2024520070 @default.
• W2031911979 cites W2027699993 @default.
• W2031911979 cites W2029099543 @default.
• W2031911979 cites W2030613990 @default.
• W2031911979 cites W2041390597 @default.
• W2031911979 cites W2043980237 @default.
• W2031911979 cites W2049460839 @default.
• W2031911979 cites W2050602931 @default.
• W2031911979 cites W2052426861 @default.
• W2031911979 cites W2055568103 @default.
• W2031911979 cites W2058972167 @default.
• W2031911979 cites W2062874910 @default.
• W2031911979 cites W2063816440 @default.
• W2031911979 cites W2064586774 @default.
• W2031911979 cites W2065855627 @default.
• W2031911979 cites W2073255422 @default.
• W2031911979 cites W2077670119 @default.
• W2031911979 cites W2081755366 @default.
• W2031911979 cites W2086463181 @default.
• W2031911979 cites W2086745302 @default.
• W2031911979 cites W2096736856 @default.
• W2031911979 cites W2100203743 @default.
• W2031911979 cites W2100580483 @default.
• W2031911979 cites W2106115330 @default.
• W2031911979 cites W2107746036 @default.
• W2031911979 cites W2113732577 @default.
• W2031911979 cites W2114717235 @default.
• W2031911979 cites W2115279260 @default.
• W2031911979 cites W2122771974 @default.
• W2031911979 cites W2130279899 @default.
• W2031911979 cites W2131965270 @default.
• W2031911979 cites W2141357485 @default.
• W2031911979 cites W2141880379 @default.
• W2031911979 cites W2148177611 @default.
• W2031911979 cites W2151320161 @default.
• W2031911979 cites W2151396228 @default.
• W2031911979 cites W2152762661 @default.
• W2031911979 cites W2154183199 @default.
• W2031911979 cites W2156721942 @default.
• W2031911979 cites W2159459394 @default.
• W2031911979 cites W2159886513 @default.
• W2031911979 cites W2160563491 @default.
• W2031911979 cites W2160589976 @default.
• W2031911979 cites W2183358817 @default.
• W2031911979 doi "https://doi.org/10.1074/jbc.m807329200" @default.
• W2031911979 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/2643515" @default.
• W2031911979 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/19106099" @default.
• W2031911979 hasPublicationYear "2009" @default.
• W2031911979 type Work @default.
• W2031911979 sameAs 2031911979 @default.
• W2031911979 citedByCount "61" @default.
• W2031911979 countsByYear W20319119792012 @default.
• W2031911979 countsByYear W20319119792013 @default.
• W2031911979 countsByYear W20319119792014 @default.
• W2031911979 countsByYear W20319119792015 @default.
• W2031911979 countsByYear W20319119792016 @default.
• W2031911979 countsByYear W20319119792017 @default.
• W2031911979 countsByYear W20319119792018 @default.
• W2031911979 countsByYear W20319119792019 @default.
• W2031911979 countsByYear W20319119792020 @default.
• W2031911979 countsByYear W20319119792021 @default.
• W2031911979 countsByYear W20319119792023 @default.
• W2031911979 crossrefType "journal-article" @default.
• W2031911979 hasAuthorship W2031911979A5010696819 @default.
• W2031911979 hasAuthorship W2031911979A5014834868 @default.
• W2031911979 hasAuthorship W2031911979A5032746085 @default.
• W2031911979 hasAuthorship W2031911979A5054140222 @default.
• W2031911979 hasAuthorship W2031911979A5075519418 @default.
• W2031911979 hasAuthorship W2031911979A5082285133 @default.
• W2031911979 hasBestOaLocation W20319119791 @default.
• W2031911979 hasConcept C101762097 @default.
• W2031911979 hasConcept C104317684 @default.
• W2031911979 hasConcept C138885662 @default.
• W2031911979 hasConcept C14036430 @default.
• W2031911979 hasConcept C142455686 @default.
• W2031911979 hasConcept C150194340 @default.

• next