FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2032131702> ?p ?o ?g. }

• W2032131702 endingPage "23471" @default.
• W2032131702 startingPage "23461" @default.
• W2032131702 abstract "The packaging of the eukaryotic genome into chromatin represses gene expression by blocking access of the general transcription machinery to the underlying DNA sequences. Accordingly, eukaryotes have developed a variety of mechanisms to disrupt, alter, or disassemble nucleosomes from promoter regions and open reading frames to allow transcription to occur. Although we know that chromatin disassembly from the yeast PHO5 promoter is triggered by the Pho4 activator, the mechanism is far from clear. Here we show that the Pho4 activator can occupy its nucleosome-bound DNA binding site within the PHO5 promoter. In contrast to the role of Saccharomyces cerevisiae FACT (facilitates chromatin transcription) complex in assembling chromatin within open reading frames, we find that FACT is involved in the disassembly of histones H2A/H2B from the PHO5 promoter during transcriptional induction. We have also discovered that the proteasome is required for efficient chromatin disassembly and transcriptional induction from the PHO5 promoter. Mutants of the degradation function of the proteasome have a defect in recruitment of the Pho4 activator, whereas mutants of the ATPase cap of the proteasome do recruit Pho4 but are still delayed for chromatin assembly. Finally, we rule out the possibility that the proteasome or ATPase cap is driving chromatin disassembly via a potential ATP-dependent chromatin remodeling activity. The packaging of the eukaryotic genome into chromatin represses gene expression by blocking access of the general transcription machinery to the underlying DNA sequences. Accordingly, eukaryotes have developed a variety of mechanisms to disrupt, alter, or disassemble nucleosomes from promoter regions and open reading frames to allow transcription to occur. Although we know that chromatin disassembly from the yeast PHO5 promoter is triggered by the Pho4 activator, the mechanism is far from clear. Here we show that the Pho4 activator can occupy its nucleosome-bound DNA binding site within the PHO5 promoter. In contrast to the role of Saccharomyces cerevisiae FACT (facilitates chromatin transcription) complex in assembling chromatin within open reading frames, we find that FACT is involved in the disassembly of histones H2A/H2B from the PHO5 promoter during transcriptional induction. We have also discovered that the proteasome is required for efficient chromatin disassembly and transcriptional induction from the PHO5 promoter. Mutants of the degradation function of the proteasome have a defect in recruitment of the Pho4 activator, whereas mutants of the ATPase cap of the proteasome do recruit Pho4 but are still delayed for chromatin assembly. Finally, we rule out the possibility that the proteasome or ATPase cap is driving chromatin disassembly via a potential ATP-dependent chromatin remodeling activity. Eukaryotic chromatin is made up of a fundamental repeating unit, termed the nucleosome, which consists of 147 bp of DNA wrapped around the outside of an octamer of histone proteins (1.Luger K. Mäder A.W. Richmond R.K. Sargent D.F. Richmond T.J. Nature. 1997; 389: 251-260Crossref PubMed Scopus (6842) Google Scholar). The histone octamer in turn comprises a heterotetramer of histone proteins H3/H4 and two heterodimers of histones H2A/H2B. In order to allow the transcription machinery to gain access to the DNA, the chromatin structure is altered by the concerted action of three processes (2.Li B. Carey M. Workman J.L. Cell. 2007; 128: 707-719Abstract Full Text Full Text PDF PubMed Scopus (2663) Google Scholar): (i) post-translational modifications on the histones, (ii) the breakage of histone-DNA contacts by ATP-dependent chromatin remodeling machines, and (iii) the ultimate removal of histones from the DNA by histone chaperones. The sequence-specific transcriptional activators trigger these chromatin alterations occurring at promoters during transcriptional induction, but it is unclear whether transcriptional activators can first bind to their nucleosome-buried DNA recognition sequences to start this cascade of chromatin dynamics. Similarly, once transcription is complete, transcriptional activators leave the DNA, and promoters are repackaged with histones via the process of chromatin assembly. The assembly and disassembly of nucleosomes appear to occur in a stepwise manner (3.Smith S. Stillman B. EMBO. J. 1991; 10: 971-980Crossref PubMed Scopus (233) Google Scholar). This is due to the peripheral positions of the H2A/H2B dimers within the nucleosome (1.Luger K. Mäder A.W. Richmond R.K. Sargent D.F. Richmond T.J. Nature. 1997; 389: 251-260Crossref PubMed Scopus (6842) Google Scholar), necessitating the removal of H2A/H2B prior to removal of the central H3/H4 tetramer. Conversely, H3/H4 must be deposited onto the DNA prior to H2A/H2B in order to assemble a nucleosome. Accordingly, histone chaperones exist that bind to either H2A/H2B or H3/H4 to mediate chromatin assembly and disassembly. We have previously shown that the histone chaperone Asf1 (anti-silencing function 1) promotes the disassembly of histones H3/H4 from multiple yeast promoter regions during transcriptional induction (4.Adkins M.W. Howar S.R. Tyler J.K. Mol. Cell. 2004; 14: 657-666Abstract Full Text Full Text PDF PubMed Scopus (256) Google Scholar, 5.Adkins M.W. Williams S.K. Linger J. Tyler J.K. Mol. Cell. Biol. 2007; 27: 6372-6382Crossref PubMed Scopus (71) Google Scholar), whereas the histone chaperone Spt6 promotes the deposition of H3/H4 onto promoters during transcriptional repression (6.Adkins M.W. Tyler J.K. Mol. Cell. 2006; 21: 405-416Abstract Full Text Full Text PDF PubMed Scopus (138) Google Scholar). However, we still do not know the identity of the histone chaperones that remove histones H2A/H2B from promoter regions during transcriptional induction or that replace H2A/H2B onto the promoter during transcriptional repression. Dynamic chromatin assembly and disassembly processes also occur within the open reading frame during transcription. The histone chaperone Spt6 is required for the deposition of H3/H4 onto chromatin behind the RNA polymerase (7.Kaplan C.D. Laprade L. Winston F. Science. 2003; 301: 1096-1099Crossref PubMed Scopus (442) Google Scholar), whereas the histone chaperone FACT (facilitates chromatin transcription) assembles H2A/H2B onto the DNA behind the elongating RNA polymerase (7.Kaplan C.D. Laprade L. Winston F. Science. 2003; 301: 1096-1099Crossref PubMed Scopus (442) Google Scholar, 8.Mason P.B. Struhl K. Mol. Cell. Biol. 2003; 23: 8323-8333Crossref PubMed Scopus (263) Google Scholar). Yeast FACT is a heterodimeric protein complex of Spt16 and Pob3, although the HMG1-like protein Nhp6 also interacts and functionally cooperates with yFACT (9.Formosa T. Eriksson P. Wittmeyer J. Ginn J. Yu Y. Stillman D.J. EMBO J. 2001; 20: 3506-3517Crossref PubMed Scopus (203) Google Scholar). Spt16 was originally identified to be a suppressor of Ty insertions into HIS4 and LYS2 (10.Malone E.A. Clark C.D. Chiang A. Winston F. Mol. Cell. Biol. 1991; 11: 5710-5717Crossref PubMed Google Scholar). Although this implies that FACT has a role in the initiation of transcription, the molecular role of FACT at promoters has not yet been defined. The chromatin reassembly function of FACT within open reading frames requires ubiquitination of histone H2B on lysine 123 (11.Pavri R. Zhu B. Li G. Trojer P. Mandal S. Shilatifard A. Reinberg D. Cell. 2006; 125: 703-717Abstract Full Text Full Text PDF PubMed Scopus (536) Google Scholar, 12.Fleming A.B. Kao C.F. Hillyer C. Pikaart M. Osley M.A. Mol. Cell. 2008; 31: 57-66Abstract Full Text Full Text PDF PubMed Scopus (246) Google Scholar). In turn, monoubiquitination of H2B Lys-123 is a result of the action of the ubiquitin ligase (E3) 3The abbreviations used are: E3ubiquitin-protein isopeptide ligaseE2ubiquitin carrier proteinMES4-morpholineethanesulfonic acidtstemperature-sensitiveChIPchromatin immunoprecipitation.3The abbreviations used are: E3ubiquitin-protein isopeptide ligaseE2ubiquitin carrier proteinMES4-morpholineethanesulfonic acidtstemperature-sensitiveChIPchromatin immunoprecipitation. Bre1 and the ubiquitin-conjugating enzyme (E2) Rad6 (13.Kao C.F. Hillyer C. Tsukuda T. Henry K. Berger S. Osley M.A. Genes Dev. 2004; 18: 184-195Crossref PubMed Scopus (179) Google Scholar) that travel with the elongating RNA polymerase (14.Xiao T. Kao C.F. Krogan N.J. Sun Z.W. Greenblatt J.F. Osley M.A. Strahl B.D. Mol. Cell. Biol. 2005; 25: 637-651Crossref PubMed Scopus (263) Google Scholar). Notably, H2B Lys-123 ubiquitination is also required for the recruitment of the proteasome to the chromatin (15.Ezhkova E. Tansey W.P. Mol. Cell. 2004; 13: 435-442Abstract Full Text Full Text PDF PubMed Scopus (173) Google Scholar). ubiquitin-protein isopeptide ligase ubiquitin carrier protein 4-morpholineethanesulfonic acid temperature-sensitive chromatin immunoprecipitation. ubiquitin-protein isopeptide ligase ubiquitin carrier protein 4-morpholineethanesulfonic acid temperature-sensitive chromatin immunoprecipitation. The proteasome is a multisubunit complex responsible for the selective degradation of almost all cytosolic proteins (16.Wolf D.H. Hilt W. Biochim. Biophys. Acta. 2004; 1695: 19-31Crossref PubMed Scopus (217) Google Scholar). Ubiquitinated proteins are recognized by the 26 S proteasome, which is a large proteolytic complex consisting of the 19 S cap complex and the 20 S catalytic core. The 19 S cap complex includes six ATPases, one of which is Sug1/Rpt6, and uses the energy provided by ATP hydrolysis to unwind proteins into unstructured chains. The 20 S core is composed of four stacked rings, which form a “tunnel” within which the unstructured protein chains undergo proteolytic cleavage into small peptides. To better understand the molecular mechanisms of chromatin disassembly and reassembly at promoter regions, we have examined the role of FACT, the proteasome, and H2A Lys-123 ubiquitination on these processes at the well studied yeast PHO5 model promoter. Our studies reveal novel roles for FACT in promoter chromatin disassembly but not reassembly and a novel role for the 19 and 20 S proteasomes in transcriptional induction. All media used were either with high (13.4 mm) phosphate or low (0.15 mm) phosphate. Media were prepared as follows. For 1 liter of medium, 0.7 g of yeast nitrogen base (without ammonium sulfate, phosphate, or amino acids), 2 g of glutamine, 100 ml of 20% glucose, and 3.9 g of MES were dissolved. Amino acids were added, and 1 m KH2PO4 and 1 m KCl were added to make the final ion concentration 13.4 mm. The pH of the medium was adjusted to 5.5, and the entire liter was filter-sterilized. The genotypes of all strains used are given in Table 1. The set of four strains used in Figs. 2E and 5E was generated by first making diploids that were heterozygous for the two temperature-sensitive (ts) mutations. Following meiosis and tetrad dissections, tetrads were identified that included one spore with both ts mutations, two spores with each individual ts mutation, and one spore with no ts mutation.TABLE 1Yeast strains used in this studyNameGenotypeSource/ReferenceBY4741Mat a; his3D1; leu2D0; met15D0; ura3D0ResGenBY4741asf1ΔMat a; his3D1; leu2D0; met15D0; ura3D0; asf1::KanMX4ResGenBY4741bre1ΔMat a; his3D1; leu2D0; met15D0; ura3D0; bre1::KanMX4ResGenBY4741rad6ΔMat a; his3D1; leu2D0; met15D0; ura3D0; rad6::KanMX4ResGenFY56Mat α; his4-912d; lys2-128d; ura3-52Ref. 10.Malone E.A. Clark C.D. Chiang A. Winston F. Mol. Cell. Biol. 1991; 11: 5710-5717Crossref PubMed Google ScholarL577Mat α; his4-912d; lys2-128d; ura3-52; spt16-197Ref. 10.Malone E.A. Clark C.D. Chiang A. Winston F. Mol. Cell. Biol. 1991; 11: 5710-5717Crossref PubMed Google ScholarJLY096Mat α; his4-912d; lys2-128d; ura3-52; HTB1:6-HIS:HA:URARef. 17.Williams S.K. Truong D. Tyler J.K. Proc. Natl. Acad. Sci. U.S.A. 2008; 105: 9000-9005Crossref PubMed Scopus (174) Google ScholarJLY097Mat α; his4-912d; lys2-128d; ura3-52; spt16-197; HTB1:6-HIS:HA:URAThis studyY865Mat α; ura3-52; trp1-289; his3Δ1; leu2-3,112; gal2; gal10Ref. 47.Costigan C. Kolodrubetz D. Snyder M. Mol. Cell. Biol. 1994; 14: 2391-2403Crossref PubMed Scopus (107) Google ScholarY869Mat α; ura3-52; trp1-289; his3Δ1; leu2-3,112; gal2; gal10; nhp6A::URA3; nhp6B::HIS3Ref. 47.Costigan C. Kolodrubetz D. Snyder M. Mol. Cell. Biol. 1994; 14: 2391-2403Crossref PubMed Scopus (107) Google ScholarJR5-2A HTB1MATa ura-3-1 leu2-3,-112 his3-11,-15 trp1-1 ade2-1 htb1-1 htb2-1 pRS314 [HTB1-CEN-TRP1]Ref. 48.Robzyk K. Recht J. Osley M.A. Science. 2000; 287: 501-504Crossref PubMed Scopus (523) Google ScholarJR5-2A htb1-KRMATa ura3-1 leu2-3,-112 his3-11,-15 trp1-1 ade2-1 htb1-1 htb2-1 pRS314 [htb1-K123R-CEN-TRP1]Ref. 48.Robzyk K. Recht J. Osley M.A. Science. 2000; 287: 501-504Crossref PubMed Scopus (523) Google ScholarMSY535Mat α; hht1-2 Δ(hht2hhf2) lys2-Δ201, leu2,3,112, ura3-52Ref. 49.Glowczewski L. Yang P. Kalashnikova T. Santisteban M.S. Smith M.M. Mol. Cell. Biol. 2000; 20: 5700-5711Crossref PubMed Scopus (50) Google ScholarMYS536Mat α; hhf1-10 Δ(hht2hhf2) lys2-Δ201, leu2,3,112, ura3-52Ref. 49.Glowczewski L. Yang P. Kalashnikova T. Santisteban M.S. Smith M.M. Mol. Cell. Biol. 2000; 20: 5700-5711Crossref PubMed Scopus (50) Google ScholarMSY559Mat α; HHF1 HHF2 Δ(hht2hhf2) lys2-Δ201, leu2,3,112, ura3-52Ref. 49.Glowczewski L. Yang P. Kalashnikova T. Santisteban M.S. Smith M.M. Mol. Cell. Biol. 2000; 20: 5700-5711Crossref PubMed Scopus (50) Google ScholarSKW200Mat α; HHF1 HHF2 Δ(hht2hhf2) lys2-Δ201, leu2,3,112, ura3-52 asf1::KanMXThis studySC733MAT a sug1-20 GAL4::HIS3 ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1 ura3-1Ref. 50.Russell S.J. Johnston S.A. J. Biol. Chem. 2001; 276: 9825-9831Abstract Full Text Full Text PDF PubMed Scopus (35) Google ScholarSC727MAT a GAL4::HIS3 ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1 ura3-1Ref. 50.Russell S.J. Johnston S.A. J. Biol. Chem. 2001; 276: 9825-9831Abstract Full Text Full Text PDF PubMed Scopus (35) Google ScholarJKT0018MAT a asf1::his+ ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1 ura3-1Ref. 4.Adkins M.W. Howar S.R. Tyler J.K. Mol. Cell. 2004; 14: 657-666Abstract Full Text Full Text PDF PubMed Scopus (256) Google ScholarSC782MAT a GAL4::HIS3 ura3 leu2-3,112, his3-11,15 canR gal+Ref. 50.Russell S.J. Johnston S.A. J. Biol. Chem. 2001; 276: 9825-9831Abstract Full Text Full Text PDF PubMed Scopus (35) Google ScholarSC779MAT a pre1-1 pre4-1 GAL4::HIS3 ura3 leu2-3,112, his3-11,15 canR gal+Ref. 50.Russell S.J. Johnston S.A. J. Biol. Chem. 2001; 276: 9825-9831Abstract Full Text Full Text PDF PubMed Scopus (35) Google Scholar Open table in a new tab Approximately 5 ml of cells were collected by centrifugation and washed with cold 0.1 m sodium acetate, pH 3.6, and then resuspended in 500 μl of the same buffer. To determine the number of cells used for each reaction, 100 μl of the cells were diluted 1:10 in double-distilled H20 and read at A600 nm. For each sample reaction, another 100 μl of washed cells were diluted 1:5 for a total volume of 500 μl in the same sodium acetate buffer and prewarmed for 10 min at 30 °C. A 500-μl sample of buffer alone was also included as a control as well as an appropriate volume (500 μl/reaction) of freshly made substrate, NPP (nitrophenyl phosphate (0.0742 g/10 ml), 0.1 m sodium acetate, pH 3.6). After warming, 500 μl of substrate was added to each reaction sample and incubated at 30 °C for 10 min, at which time 250 μl of stop solution, 1 m Na2CO3, was added. Samples were centrifuged for 1 min and then read at A410 nm. Phosphatase activity was equated as (A420 × 1000)/(A600 × volume of cell lysate used (μl) × incubation time (min). Single time courses are shown in each case, but comparable results were obtained for all of the phosphatase assays in independent time courses. ChIP analyses were performed as described previously (17.Williams S.K. Truong D. Tyler J.K. Proc. Natl. Acad. Sci. U.S.A. 2008; 105: 9000-9005Crossref PubMed Scopus (174) Google Scholar), using either 2.5 μl of the C-terminal anti-histone H3 (catalog number ab1791; Abcam), 2 μl of anti-HA (catalog number mms-101r; Covance), or 2 μl of anti-Pho4 (courtesy of E. O'Shea) overnight at 4 °C. The sequential ChIP analyses utilized micrococcal nuclease-digested mononucleosomes as the template, whereas all other analyses utilized sonicated chromatin fragments. All ChIP quantitation was performed by real time PCR using a Roche Applied Sciences Light Cycler 480. The linear range of PCR templates was determined by performing a 10-fold serial dilution standard curve, which usually proved that a 1:10 dilution was sufficient. Each sample was analyzed in triplicate using 10-μl reactions in a 384-well plate format. The thermal profile was as follows: 1) denaturation at 95 °C for 10 min; 2) run cycle of 95 °C for 15 s and then 60 °C for 1 min for 50–60 cycles; 3) cooling at 40 °C for 30 s. Each immunoprecipitation sample was normalized to its respective input samples (to account for the number of cells taken) as well as a control region called GAL1/10, whose histone occupancy is regulated by glucose, not phosphate, levels. Primers and Taqman probes used were as follows: PHO5 UASp2 A, GAATAGGCAATCTCTAAATGAATCGA; PHO5 UASp2 B, GAAAACAGGGACCAGAATCATAAATT; PHO5 UASp2 probe, FAM-ACCTTGGCACTCACACGTGGGACTAGC-MGB; GAL1/10 A, GACGCACGGAGGAGAGTCTT; GAL1/10 B, CGCTTAACTGCTCATTGCTATATTG; GAL1/10 probe, FAM-CGCTCGGCGGCTTCTAATCCG-MGB. Samples were prepared by washing ∼50 μl of actively dividing cells twice with double-distilled H2O, resuspending in 100 μl of yeast sample buffer, and then boiling for 5 min. Samples were separated on a 10% acrylamide gel and transferred to a polyvinylidene fluoride membrane. The membrane was probed with 1:1000 anti-Pho2 antibody (courtesy of E. O'Shea) and then 1:50,000 IgG peroxidase conjugate antibody (catalog number A-1949; Sigma). Processing of the membrane was performed with the ECL Western blotting detection reagents (catalog number RPN2209; GE Healthcare). Homogenous nucleosomes were reconstituted by salt dilution using Xenopus laevis recombinant histone octamers and 601 nucleosome-positioning sequences. The DNA used for nucleosome reconstitution was synthesized by PCR, which comprises 601 positioning DNA sequence at the center flanked by 69 and 59 bp of extranucleosomal DNA. About one-tenth of the DNA was end-labeled with p32. For the nucleosome remodeling assay by gel shift, the indicated amounts of RSC (remodels the structure of chromatin), PA700, and 26 S were incubated with mononucleosomes (12 nm) for 30 min at 30 °C in the presence of 2 mm ATP. The purified yeast RSC remodeling complex was used as a control for remodeling reactions. The bound proteins were competed off, and reactions were terminated by adding excessive competitor DNA and 2 mm γ-thio-ATP. The samples were analyzed on 5% PAGE with 0.2× TBE with buffer recirculation. Buffer conditions used for PA700 were as follows: 20 mm Na-HEPES, pH 7.8, 60 mm NaCl, 3 mm MgCl2, 0.4 mm EDTA, 4 mm β-mercaptoethanol, 6% glycerol, 100 μg/ml bovine serum albumin, 0.2 mm phenylmethylsulfonyl fluoride, 0.08% Nonidet P-40, 2 mm ATP. Buffer conditions for 26 S were as follows: 20 mm Na-HEPES, pH 7.8, 60 mm NaCl, 5 mm MgCl2, 2.8 mm β-mercaptoethanol, 6% glycerol, 100 μg/ml bovine serum albumin, 0.2 mm phenylmethylsulfonyl fluoride, 0.08% Nonidet P-40, 2 mm ATP. Buffer conditions for RSC were as follows: 20 mm Na-HEPES, pH 7.8, 60 mm NaCl, 3 mm MgCl2, 2 mm β-mercaptoethanol, 7% glycerol, 100 μg/ml bovine serum albumin, 0.2 mm phenylmethylsulfonyl fluoride, 0.08% Nonidet P-40, 2 mm ATP. For the nucleosome remodeling assay by restriction accessibility assay, 6 nm concentrations of labeled mononucleosomes were incubated with RSC (3 nm), PA700 (3–81 nm), or 3–54 nm 26 S for 30 min at 30 °C with 3.75 units of RsaI. The reactions were stopped and deproteinized by adding an equal volume of stop solution (20 mm Tris-HCl, pH 8, 1.2% SDS, 80 mm EDTA, 5% glycerol, 0.2 mg/ml proteinase K) and incubating at 50 °C for 20 min. Our studies of chromatin disassembly during transcriptional induction use ChIP analysis of histone and factor occupancy at the well characterized budding yeast PHO5 gene promoter (4.Adkins M.W. Howar S.R. Tyler J.K. Mol. Cell. 2004; 14: 657-666Abstract Full Text Full Text PDF PubMed Scopus (256) Google Scholar, 5.Adkins M.W. Williams S.K. Linger J. Tyler J.K. Mol. Cell. Biol. 2007; 27: 6372-6382Crossref PubMed Scopus (71) Google Scholar, 6.Adkins M.W. Tyler J.K. Mol. Cell. 2006; 21: 405-416Abstract Full Text Full Text PDF PubMed Scopus (138) Google Scholar, 17.Williams S.K. Truong D. Tyler J.K. Proc. Natl. Acad. Sci. U.S.A. 2008; 105: 9000-9005Crossref PubMed Scopus (174) Google Scholar). PHO5 encodes the major acid phosphatase in Saccharomyces cerevisiae. PHO5 transcription is induced by phosphate depletion, which causes Pho81 to inhibit the Pho80-Pho85 cyclin-dependent kinase complex, leading to relocalization of the Pho4 activator to the nucleus (18.Komeili A. O'Shea E.K. Curr. Opin. Cell Biol. 2000; 12: 355-360Crossref PubMed Scopus (86) Google Scholar). The Pho4 binding site within the PHO5 upstream activating sequence, UASp2, is occluded by a nucleosome (nucleosome −2) in repressing conditions (Fig. 1A). The localization of Pho4 to the nucleus is required for the subsequent disassembly of four nucleosomes (nucleosomes −1 to −4) from the PHO5 promoter (19.Boeger H. Griesenbeck J. Strattan J.S. Kornberg R.D. Mol. Cell. 2003; 11: 1587-1598Abstract Full Text Full Text PDF PubMed Scopus (332) Google Scholar, 20.Reinke H. Hörz W. Mol. Cell. 2003; 11: 1599-1607Abstract Full Text Full Text PDF PubMed Scopus (333) Google Scholar), which is required in turn to allow the subsequent recruitment of the general transcription machinery (5.Adkins M.W. Williams S.K. Linger J. Tyler J.K. Mol. Cell. Biol. 2007; 27: 6372-6382Crossref PubMed Scopus (71) Google Scholar). Whether Pho4 gains access to its nucleosome-occluded UASp2 DNA binding site to trigger this cascade of events is not known. Our earlier analyses had provided circumstantial evidence that Pho4 activator can bind to its UASp2 site that is very close to the dyad axis of symmetry of nucleosome −2 of the PHO5 promoter (Fig. 1A) while histones H3 and H2A are still present (4.Adkins M.W. Howar S.R. Tyler J.K. Mol. Cell. 2004; 14: 657-666Abstract Full Text Full Text PDF PubMed Scopus (256) Google Scholar, 21.Williams S.K. Tyler J.K. Curr. Opin. Genet. Dev. 2007; 17: 88-93Crossref PubMed Scopus (69) Google Scholar). This potential intermediate state was achieved by slowing down the chromatin disassembly process by deleting the gene encoding the Asf1 histone chaperone in PHO5-inducing (low phosphate) conditions (4.Adkins M.W. Howar S.R. Tyler J.K. Mol. Cell. 2004; 14: 657-666Abstract Full Text Full Text PDF PubMed Scopus (256) Google Scholar, 21.Williams S.K. Tyler J.K. Curr. Opin. Genet. Dev. 2007; 17: 88-93Crossref PubMed Scopus (69) Google Scholar). Given that the helix-loop-helix DNA binding domain of Pho4 makes intimate contacts with opposite faces of the DNA duplex (22.Shimizu T. Toumoto A. Ihara K. Shimizu M. Kyogoku Y. Ogawa N. Oshima Y. Hakoshima T. EMBO J. 1997; 16: 4689-4697Crossref PubMed Scopus (150) Google Scholar), it was unexpected to find the histone octamer and Pho4 coexisting on the same piece of DNA in vivo. Because our previous ChIP analyses had used sonication to generate ∼500-bp chromatin fractions, we revisited these experiments using micrococcal nuclease- generated mononucleosomes (Fig. 1B). Disassembly of PHO5 nucleosome −2 is apparent 8 h after switching to low phosphate medium in wild type yeast, whereas nucleosome −2 is largely intact in the asf1 mutant strain (Fig. 1C, left). By contrast, the amount of Pho4 recruited to UASp2 8 h after switching to low phosphate medium is equivalent in both the wild type and asf1 mutant strain (Fig. 1C, middle). It is important to note that all analyses of factor occupancy at the PHO5 promoter are internally normalized to another region of the yeast genome (the GAL1 promoter), where there are no changes in histone occupancy or Pho4 occupancy in response to changes in phosphate concentrations (4.Adkins M.W. Howar S.R. Tyler J.K. Mol. Cell. 2004; 14: 657-666Abstract Full Text Full Text PDF PubMed Scopus (256) Google Scholar, 5.Adkins M.W. Williams S.K. Linger J. Tyler J.K. Mol. Cell. Biol. 2007; 27: 6372-6382Crossref PubMed Scopus (71) Google Scholar). In our previous ChIP analyses with the same antibodies used here, we have also shown that these factors are not detectably present at nonspecific DNA, such as the mitochondrial COX3 gene (4.Adkins M.W. Howar S.R. Tyler J.K. Mol. Cell. 2004; 14: 657-666Abstract Full Text Full Text PDF PubMed Scopus (256) Google Scholar, 5.Adkins M.W. Williams S.K. Linger J. Tyler J.K. Mol. Cell. Biol. 2007; 27: 6372-6382Crossref PubMed Scopus (71) Google Scholar). It is extremely unlikely that the Pho4 bound to nucleosome −2 in the asf1 mutant reflects binding to the adjacent UASp1 site, because the UASp2 within the nucleosome −2 site is 13 times stronger than the UASp1 site (23.Maerkl S.J. Quake S.R. Science. 2007; 315: 233-237Crossref PubMed Scopus (427) Google Scholar). As such, the Pho4 occupancy in the asf1 mutant in the inducing condition (−Pi) would have been 8% of that seen in the wild type strain if it were due to binding to the UASp1 site alone, not the equivalent binding that we see with the asf1 mutant and wild type strain in Fig. 1C (middle). In addition, the UASp1 site is in a nucleosome-free region and therefore is likely to have been destroyed by digestion to mononucleosomes. To provide additional proof of co-occupancy of histones H3 and Pho4 at nucleosome −2, we performed sequential ChIP analysis of the mononucleosomes. First we immunoprecipitated for Pho4, followed by elution of the immunoprecipitates and their subsequent immunoprecipitation for H3. As shown in the right panel of Fig. 1C, we found that H3 and Pho4 co-occupy nucleosome −2 in the asf1 mutant in inducing conditions (−Pi). These results establish that the Pho4 activator does co-occupy the same stretch of DNA as a histone octamer in vivo, clearly demonstrating that histone removal occurs after activator binding. We sought to investigate the mechanism whereby activator binding triggers the subsequent removal of histones H2A and H2B from the PHO5 promoter during transcriptional induction. To ask whether the H2A/H2B chaperone FACT is implicated in chromatin disassembly from promoter regions, we examined transcriptional induction in a temperature-sensitive mutant of the Spt16 subunit of FACT following phosphate removal after FACT had been first inactivated by shifting to the restrictive temperature. Activation of the PHO5 gene was greatly delayed upon inactivation of Spt16 (Fig. 2A). In agreement, disassembly of histones H2A/H2B from the PHO5 promoter is greatly delayed when FACT is inactivated prior to the addition of the signal for PHO5 induction (−Pi) (Fig. 2B). As expected, the removal of H3/H4 from the PHO5 promoter was also delayed when FACT was inactivated, given that H3/H4 cannot be removed from the DNA until after H2A/H2B are removed (Fig. 2C). These data indicate that the histone chaperone FACT is important for the disassembly of H2A/H2B from the PHO5 promoter and its subsequent transcriptional induction. Induction of the PHO5 gene in response to phosphate removal requires that the cell first use up its endogenous phosphate and polyphosphate stores, which itself requires growth. Given that Spt16 is an essential protein, it was possible that the failure of spt16 mutant yeast to induce PHO5 transcription might be due to its growth defect at the non-permissive temperature. To rule out this possibility, we inactivated the Pho80 protein with a conditional allele, which results in Pho4 being constitutively nuclear under all phosphate conditions at the non-permissive temperature (24.O'Neill E.M. Kaffman A. Jolly E.R. O'Shea E.K. Science. 1996; 271: 209-212Crossref PubMed Scopus (184) Google Scholar). As such, phosphate depletion and growth are not required for induction of PHO5 transcription in the absence of Pho80. Following a shift to the non-permissive temperature in high phosphate medium, we found that the pho80 mutant was able to induce PHO5 transcription as expected, whereas the wild type strain could not (Fig. 2D). By contrast, the pho80 spt16 double mutant gave an intermediate result, being able to partially induce PHO5 (Fig. 2D). These data confirm that FACT promotes chromatin disassembly and the subsequent transcriptional induction from the PHO5 promoter. To provide additional confirmation of a role for FACT in promoter chromatin disassembly, we examined the HMG-1-like protein Nhp6, which functionally potentiates the ability of FACT to alter nucleosome structure (25.Ruone S. Rhoades A.R. Formosa T. J. Biol. Chem. 2003; 278: 45288-45295Abstract Full Text Full Text PDF PubMed Scopus (67) Google Scholar, 26.Rhoades A.R. Ruone S. Formosa T. Mol. Cell. Biol. 2004; 24: 3907-3917Crossref PubMed Scopus (61) Google Scholar). Accordingly, we found that induction of PHO5 transcription was greatly delayed in the absence of Nhp6, which was achieved by the deletion of the functionally redundant NHP6A and NHP6B genes (Fig. 2E). This delay in PHO5 transcriptional induction in the absence of Nhp6 was not a consequence of altered levels of the Pho2 activator that is required for PHO5 induction, since its levels were indistinguishable between wild type and Nhp6 mutants (Fig. 2F). Rather, the delay in transcriptional induction in the absence of Nhp6 was most likely due to the delay in chromatin disassembly that is apparent in the absence of Nhp6 (Fig. 2G). Taken together, these results demonstrate that FACT has a novel function in promoting histone H2A/H2B removal from" @default.
• W2032131702 created "2016-06-24" @default.
• W2032131702 creator A5001371883 @default.
• W2032131702 creator A5001505881 @default.
• W2032131702 creator A5021255846 @default.
• W2032131702 creator A5036646183 @default.
• W2032131702 creator A5042369850 @default.
• W2032131702 creator A5054599391 @default.
• W2032131702 creator A5075576407 @default.
• W2032131702 creator A5079176198 @default.
• W2032131702 creator A5079910369 @default.
• W2032131702 date "2009-08-01" @default.
• W2032131702 modified "2023-10-16" @default.
• W2032131702 title "FACT and the Proteasome Promote Promoter Chromatin Disassembly and Transcriptional Initiation" @default.
• W2032131702 cites W1876643910 @default.
• W2032131702 cites W1973586369 @default.
• W2032131702 cites W1976650652 @default.
• W2032131702 cites W1977188840 @default.
• W2032131702 cites W197844582 @default.
• W2032131702 cites W1980378067 @default.
• W2032131702 cites W1987338737 @default.
• W2032131702 cites W1992243707 @default.
• W2032131702 cites W1992741271 @default.
• W2032131702 cites W1993366229 @default.
• W2032131702 cites W2005931483 @default.
• W2032131702 cites W2012887640 @default.
• W2032131702 cites W2014179038 @default.
• W2032131702 cites W2023178859 @default.
• W2032131702 cites W2026669507 @default.
• W2032131702 cites W2032493474 @default.
• W2032131702 cites W2034285022 @default.
• W2032131702 cites W2037168837 @default.
• W2032131702 cites W2037516018 @default.
• W2032131702 cites W2038282326 @default.
• W2032131702 cites W2046306550 @default.
• W2032131702 cites W2049647279 @default.
• W2032131702 cites W2050627047 @default.
• W2032131702 cites W2056431359 @default.
• W2032131702 cites W2059180250 @default.
• W2032131702 cites W2059504699 @default.
• W2032131702 cites W2067397907 @default.
• W2032131702 cites W2072351479 @default.
• W2032131702 cites W2073004429 @default.
• W2032131702 cites W2075213209 @default.
• W2032131702 cites W2085631727 @default.
• W2032131702 cites W2085759022 @default.
• W2032131702 cites W2093283405 @default.
• W2032131702 cites W2099083409 @default.
• W2032131702 cites W2102143993 @default.
• W2032131702 cites W2106199951 @default.
• W2032131702 cites W2107528836 @default.
• W2032131702 cites W2116724545 @default.
• W2032131702 cites W2131004988 @default.
• W2032131702 cites W2133063603 @default.
• W2032131702 cites W2133452708 @default.
• W2032131702 cites W2139548742 @default.
• W2032131702 cites W2139633538 @default.
• W2032131702 cites W2140795634 @default.
• W2032131702 cites W2143784503 @default.
• W2032131702 cites W2144792857 @default.
• W2032131702 cites W2172107732 @default.
• W2032131702 doi "https://doi.org/10.1074/jbc.m109.019562" @default.
• W2032131702 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/2749120" @default.
• W2032131702 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/19574230" @default.
• W2032131702 hasPublicationYear "2009" @default.
• W2032131702 type Work @default.
• W2032131702 sameAs 2032131702 @default.
• W2032131702 citedByCount "65" @default.
• W2032131702 countsByYear W20321317022012 @default.
• W2032131702 countsByYear W20321317022013 @default.
• W2032131702 countsByYear W20321317022014 @default.
• W2032131702 countsByYear W20321317022015 @default.
• W2032131702 countsByYear W20321317022016 @default.
• W2032131702 countsByYear W20321317022017 @default.
• W2032131702 countsByYear W20321317022018 @default.
• W2032131702 countsByYear W20321317022019 @default.
• W2032131702 countsByYear W20321317022020 @default.
• W2032131702 countsByYear W20321317022021 @default.
• W2032131702 countsByYear W20321317022022 @default.
• W2032131702 crossrefType "journal-article" @default.
• W2032131702 hasAuthorship W2032131702A5001371883 @default.
• W2032131702 hasAuthorship W2032131702A5001505881 @default.
• W2032131702 hasAuthorship W2032131702A5021255846 @default.
• W2032131702 hasAuthorship W2032131702A5036646183 @default.
• W2032131702 hasAuthorship W2032131702A5042369850 @default.
• W2032131702 hasAuthorship W2032131702A5054599391 @default.
• W2032131702 hasAuthorship W2032131702A5075576407 @default.
• W2032131702 hasAuthorship W2032131702A5079176198 @default.
• W2032131702 hasAuthorship W2032131702A5079910369 @default.
• W2032131702 hasBestOaLocation W20321317021 @default.
• W2032131702 hasConcept C185592680 @default.
• W2032131702 hasConcept C27740335 @default.
• W2032131702 hasConcept C552990157 @default.
• W2032131702 hasConcept C55493867 @default.
• W2032131702 hasConcept C83640560 @default.
• W2032131702 hasConcept C86803240 @default.
• W2032131702 hasConcept C95444343 @default.
• W2032131702 hasConceptScore W2032131702C185592680 @default.

• next