FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2033229710> ?p ?o ?g. }

• W2033229710 endingPage "16427" @default.
• W2033229710 startingPage "16420" @default.
• W2033229710 abstract "Recent genetic evidence indicates that null mutants of the 5′-flap endonuclease (FEN1) result in an expansion of repetitive sequences. The substrate for FEN1 is a flap formed by natural 5′-end displacement of the short intermediates of lagging strand replication. FEN1 binds the 5′-end of the flap, tracks to the point of annealing at the base of the flap, and then cleaves. Here we examine mechanisms by which foldback structures within the flap could contribute to repeat expansions. Cleavage by FEN1 was reduced with increased length of the foldback. However, even the longest foldbacks were cleaved at a low rate. Substrates containing the repetitive sequence CTG also were cleaved at a reduced rate. Bubble substrates, likely intermediates in repeat expansions, were inhibitory. Neither replication protein A nor proliferating cell nuclear antigen were able to assist in the removal of secondary structure within a flap. We propose that FEN1 cleaves natural foldbacks at a reduced rate. However, although the cleavage delay is not likely to influence the overall process of chromosomal replication, specific foldbacks could inhibit cleavage sufficiently to result in duplication of the foldback sequence. Recent genetic evidence indicates that null mutants of the 5′-flap endonuclease (FEN1) result in an expansion of repetitive sequences. The substrate for FEN1 is a flap formed by natural 5′-end displacement of the short intermediates of lagging strand replication. FEN1 binds the 5′-end of the flap, tracks to the point of annealing at the base of the flap, and then cleaves. Here we examine mechanisms by which foldback structures within the flap could contribute to repeat expansions. Cleavage by FEN1 was reduced with increased length of the foldback. However, even the longest foldbacks were cleaved at a low rate. Substrates containing the repetitive sequence CTG also were cleaved at a reduced rate. Bubble substrates, likely intermediates in repeat expansions, were inhibitory. Neither replication protein A nor proliferating cell nuclear antigen were able to assist in the removal of secondary structure within a flap. We propose that FEN1 cleaves natural foldbacks at a reduced rate. However, although the cleavage delay is not likely to influence the overall process of chromosomal replication, specific foldbacks could inhibit cleavage sufficiently to result in duplication of the foldback sequence. flap endonuclease 1 proliferating cell nuclear antigen replication protein A Recent biochemical and genetic data have served to illustrate the dual roles of many proteins in DNA metabolism. Enzymes first identified as central components of DNA replication forks, such as the flap endonuclease 1 (FEN1),1 are now understood to play critical roles in DNA repair pathways (1.Harrington J.J. Lieber M.R. EMBO J. 1994; 13: 1235-1246Crossref PubMed Scopus (372) Google Scholar, 2.Harrington J.J. Lieber M.R. Genes Dev. 1994; 8: 1344-1355Crossref PubMed Scopus (255) Google Scholar, 3.Bambara R.A. Murante R.S. Henricksen L.A. J. Biol. Chem. 1997; 272: 4647-4650Abstract Full Text Full Text PDF PubMed Scopus (298) Google Scholar, 4.Lieber M.R. BioEssays. 1997; 19: 233-240Crossref PubMed Scopus (395) Google Scholar, 5.Henricksen L.A. Bambara R.A. Leukocyte Res. 1998; 22: 1-5Crossref PubMed Scopus (13) Google Scholar). Our increasing understanding of the mechanisms of these enzymes is revealing the nature of their multiple functions in the cell. FEN1, a member of the RAD2 superfamily, is a structure-specific nuclease known to be involved in both lagging strand synthesis during DNA replication (6.Ishimi Y. Claude A. Bullock P. Hurwitz J. J. Biol. Chem. 1988; 263: 19723-19733Abstract Full Text PDF PubMed Google Scholar, 7.Goulian M. Richards S.H. Heard C.J. Bigsby B.M. J. Biol. Chem. 1990; 265: 18461-18471Abstract Full Text PDF PubMed Google Scholar, 8.Robins P. Pappin D.J. Wood R.D. Lindahl T. J. Biol. Chem. 1994; 269: 28535-28538Abstract Full Text PDF PubMed Google Scholar, 9.Turchi J.J. Huang L. Murante R.S. Kim Y. Bambara R.A. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 9803-9807Crossref PubMed Scopus (169) Google Scholar, 10.Waga S. Bauer G. Stillman B. J. Biol. Chem. 1994; 269: 10923-10934Abstract Full Text PDF PubMed Google Scholar) and long patch base excision repair (11.Kim K. Biade S. Matsumoto Y. J. Biol. Chem. 1998; 273: 8842-8848Abstract Full Text Full Text PDF PubMed Scopus (188) Google Scholar). Genetic studies highlight the central role of FEN1 in these cellular processes (12.Reagan M.S. Pittenger C. Siede W. Friedberg E.C. J. Bacteriol. 1995; 177: 364-371Crossref PubMed Google Scholar, 13.Sommers C.H. Miller E.J. Dujon B. Prakash S. Prakash L. J. Biol. Chem. 1995; 270: 4193-4196Abstract Full Text Full Text PDF PubMed Scopus (162) Google Scholar, 14.Vallen E.A. Cross F.R. Mol. Cell. Biol. 1995; 15: 4291-4302Crossref PubMed Scopus (95) Google Scholar). In Saccharomyces cerevisiae, a null mutant of the FEN1 homologue (RAD27/RTH1) is conditionally lethal at high temperatures producing a cellular morphology indicative of an S phase arrest. At the permissive temperature, FEN1 mutants exhibit slow growth and hyper-recombination phenotypes consistent with defects in DNA replication and recombination. Null mutants also have an increased sensitivity to the alkylating agent methyl methanesulfonate but are only moderately affected by UV or ionizing radiation. These characteristics are consistent with participation of FEN1 in base excision repair. Biochemical analyses have clarified the nature of the FEN1 catalyzed reactions during DNA replication and repair. Reconstitution of lagging strand DNA synthesis in vitro showed that FEN1 is needed to remove the initiator RNA primers of Okazaki fragments (3.Bambara R.A. Murante R.S. Henricksen L.A. J. Biol. Chem. 1997; 272: 4647-4650Abstract Full Text Full Text PDF PubMed Scopus (298) Google Scholar). FEN1 assists in primer removal through two proposed pathways. First, the nuclease RNase HI cleaves within the RNA primer leaving a single ribonucleotide remaining at the 5′-end of the Okazaki fragment. The FEN1 nuclease removes this ribonucleotide prior to ligation with an upstream Okazaki fragment (9.Turchi J.J. Huang L. Murante R.S. Kim Y. Bambara R.A. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 9803-9807Crossref PubMed Scopus (169) Google Scholar). Alternately, synthesis from an upstream Okazaki fragment may cause the displacement of the RNA primer generating an unannealed 5′-tail or flap structure (15.Budd M.E. Choe W.C. Campbell J.L. J. Biol. Chem. 1995; 270: 26766-26769Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar, 16.Budd M.E. Campbell J.L. Mol. Cell. Biol. 1997; 17: 2136-2142Crossref PubMed Scopus (193) Google Scholar). FEN1 cleaves endonucleolytically at the base of the flap, thereby removing the entire segment of RNA (17.Murante R.S. Huang L. Turchi J.J. Bambara R.A. J. Biol. Chem. 1994; 269: 1191-1196Abstract Full Text PDF PubMed Google Scholar, 18.Murante R.S. Rust L. Bambara R.A. J. Biol. Chem. 1995; 270: 30377-30383Abstract Full Text Full Text PDF PubMed Scopus (186) Google Scholar, 19.Murante R.S. Rumbaugh J.A. Barnes C.J. Norton J.R. Bambara R.A. J. Biol. Chem. 1996; 271: 25888-25897Abstract Full Text Full Text PDF PubMed Scopus (54) Google Scholar). The endonucleolytic activity of FEN1 is thought to be important for the removal of damaged nucleotides in long patch base excision repair (11.Kim K. Biade S. Matsumoto Y. J. Biol. Chem. 1998; 273: 8842-8848Abstract Full Text Full Text PDF PubMed Scopus (188) Google Scholar,20.Klungland A. Lindahl T. EMBO J. 1997; 16: 3341-3348Crossref PubMed Scopus (660) Google Scholar). During repair of an abasic site, an apurinic/apyrimidinic endonuclease cleaves on the 5′-side of the abasic sugar generating a nick within the DNA (21.Doetsch P.W. Cunningham R.P. Mutat. Res. 1990; 236: 173-201Crossref PubMed Scopus (324) Google Scholar). We have previously demonstrated that FEN1 cannot remove the abasic sugar (22.DeMott M.S. Shen B. Park M.S. Bambara R.A. Zigman S. J. Biol. Chem. 1996; 271: 30068-30076Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar). Instead, when the damaged sugar and an additional downstream nucleotide are displaced to generate a flap, FEN1 endonucleolytically removes the site of damage as part of an oligomer. The resulting short gap is filled and ligated to complete the repair process. FEN1 employs a unique cleavage mechanism for substrates containing unannealed 5′-tails or flap structures (Fig.1). FEN1 removes the flap by recognizing the 5′-end, tracking the length of the tail, and cleaving at the point of annealing (1.Harrington J.J. Lieber M.R. EMBO J. 1994; 13: 1235-1246Crossref PubMed Scopus (372) Google Scholar, 18.Murante R.S. Rust L. Bambara R.A. J. Biol. Chem. 1995; 270: 30377-30383Abstract Full Text Full Text PDF PubMed Scopus (186) Google Scholar). Flap substrates composed of either RNA or DNA are readily cleaved by FEN1 (19.Murante R.S. Rumbaugh J.A. Barnes C.J. Norton J.R. Bambara R.A. J. Biol. Chem. 1996; 271: 25888-25897Abstract Full Text Full Text PDF PubMed Scopus (54) Google Scholar). However, the unannealed 5′-tail must be single-stranded as the presence of large adducts (18.Murante R.S. Rust L. Bambara R.A. J. Biol. Chem. 1995; 270: 30377-30383Abstract Full Text Full Text PDF PubMed Scopus (186) Google Scholar) or annealed primers prevent FEN1 cleavage (18.Murante R.S. Rust L. Bambara R.A. J. Biol. Chem. 1995; 270: 30377-30383Abstract Full Text Full Text PDF PubMed Scopus (186) Google Scholar, 23.Wu X. Li J. Li X. Hsieh C.L. Burgers P.M. Lieber M.R. Nucleic Acids Res. 1996; 24: 2036-2043Crossref PubMed Scopus (198) Google Scholar). The FEN1 family of nucleases is conserved throughout evolution with homologues identified from archaebacteria, yeast, Xenopus, and mammals (1.Harrington J.J. Lieber M.R. EMBO J. 1994; 13: 1235-1246Crossref PubMed Scopus (372) Google Scholar, 24.Siegal G. Turchi J.J. Myers T.W. Bambara R.A. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 9377-9381Crossref PubMed Scopus (61) Google Scholar, 25.Hiraoka L.R. Harrington J.J. Gerhard D.S. Lieber M.R. Hsieh C.L. Genomics. 1995; 25: 220-225Crossref PubMed Scopus (63) Google Scholar, 26.Alleva J.L. Doetsch P.W. Nucleic Acids Res. 1998; 26: 3645-3650Crossref PubMed Scopus (26) Google Scholar, 27.Bibikova M. Wu B. Chi E. Kim K.H. Trautman J.K. Carroll D. J. Biol. Chem. 1998; 273: 34222-34229Abstract Full Text Full Text PDF PubMed Scopus (12) Google Scholar, 28.Hosfield D.J. Frank G. Weng Y. Tainer J.A. Shen B. J. Biol. Chem. 1998; 273: 27154-27161Abstract Full Text Full Text PDF PubMed Scopus (68) Google Scholar). Biophysical analysis of homologues has begun to provide a structural context for understanding the molecular mechanism of FEN1. Crystal structures of FEN1 homologues from T5 exonuclease (29.Ceska T.A. Sayers J.R. Stier G. Suck D. Nature. 1996; 382: 90-93Crossref PubMed Scopus (164) Google Scholar), T4 RNase H (30.Mueser T.C. Nossal N.G. Hyde C.C. Cell. 1996; 85: 1101-1112Abstract Full Text Full Text PDF PubMed Scopus (162) Google Scholar), Methanococcus jannaschiiFEN1 (31.Hwang K.Y. Baek K. Kim H.Y. Cho Y. Nat. Struct. Biol. 1998; 5: 707-713Crossref PubMed Scopus (147) Google Scholar), and Pyrococcus furiosus FEN1 (32.Hosfield D.J. Mol C.D. Shen B. Tainer J.A. Cell. 1998; 95: 135-146Abstract Full Text Full Text PDF PubMed Scopus (225) Google Scholar) reveal a helical arch or loop above a globular domain containing the active site. This arch may be utilized by the nuclease to track onto the 5′-end of a flap structure (29.Ceska T.A. Sayers J.R. Stier G. Suck D. Nature. 1996; 382: 90-93Crossref PubMed Scopus (164) Google Scholar). Mutational analyses of the loop region in the M. jannaschii FEN1 indicate that this physical structure is critical for both the binding and cleaving of flap substrates (31.Hwang K.Y. Baek K. Kim H.Y. Cho Y. Nat. Struct. Biol. 1998; 5: 707-713Crossref PubMed Scopus (147) Google Scholar). Previous results show that the ability of the FEN1 endonuclease to cleave flap structures is affected by a range of modifications of the unannealed 5′-tail. These modifications include the addition of large adducts such as biotin-streptavidin complexes (18.Murante R.S. Rust L. Bambara R.A. J. Biol. Chem. 1995; 270: 30377-30383Abstract Full Text Full Text PDF PubMed Scopus (186) Google Scholar), small adducts (cis-platinum) (33.Barnes C.J. Wahl A.F. Shen B. Park M.S. Bambara R.A. J. Biol. Chem. 1996; 271: 29624-29631Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar, 34.Bornarth C.J. Ranalli T.A. Henricksen L.A. Wahl A.F. Bambara R.A. Biochemistry. 1999; 38: 13347-13354Crossref PubMed Scopus (67) Google Scholar), and oligonucleotide primers annealed to the tail (18.Murante R.S. Rust L. Bambara R.A. J. Biol. Chem. 1995; 270: 30377-30383Abstract Full Text Full Text PDF PubMed Scopus (186) Google Scholar, 23.Wu X. Li J. Li X. Hsieh C.L. Burgers P.M. Lieber M.R. Nucleic Acids Res. 1996; 24: 2036-2043Crossref PubMed Scopus (198) Google Scholar). These results strongly suggest that FEN1 tracks down the length of the tail before reaching the cleavage point. However, it still remains unknown whether FEN1 “tracks” by threading the length of the flap through an arch structure (35.Sayers J.R. Artymiuk P.J. Nat. Struct. Biol. 1998; 5: 668-670Crossref PubMed Scopus (17) Google Scholar) or whether the nuclease grips the flap in the manner of enzymes with thumb domains (36.Patel P.H. Jacobo-Molina A. Ding J. Tantillo C. Clark Jr., A.D. Raag R. Nanni R.G. Hughes S.H. Arnold E. Biochemistry. 1995; 34: 5351-5363Crossref PubMed Scopus (176) Google Scholar). Recent studies utilizing flap substrates containing a branch structure permit cleavage by FEN1 (34.Bornarth C.J. Ranalli T.A. Henricksen L.A. Wahl A.F. Bambara R.A. Biochemistry. 1999; 38: 13347-13354Crossref PubMed Scopus (67) Google Scholar). These results suggest a tracking process in which the flap is not completely encircled. In addition to DNA replication and repair, genetic and biochemical data also connect FEN1 with repeat sequence expansion. Many human genetic diseases are characterized by a substantial alteration of the genome. One class of changes observed involve a unique group of sequences referred to as repetitive sequences. These stretches of the genome contain either single, dinucleotide, or trinucleotide sequences repeated in an array of several to about 60 nucleotides (microsatellites) or longer 4–100-nucleotide sequences repeated to greater lengths (minisatellites) (37.Gordenin D.A. Kunkel T.A. Resnick M.A. Nat. Genet. 1997; 16: 116-118Crossref PubMed Scopus (189) Google Scholar). Repeat expansions have attracted attention particularly because of their link with a host of genetic conditions called human triplet repeat disorders (38.McMurray C.T. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 1823-1825Crossref PubMed Scopus (190) Google Scholar). These disorders include several neurodegenerative diseases such as Huntington's disease, Friedreich's ataxia, and some colon cancers. A notable characteristic of these sequences is their ability to adopt higher ordered structures such as hairpin loops both in vitro (39.Gacy A.M. Goellner G. Juranic N. Macura S. McMurray C.T. Cell. 1995; 81: 533-540Abstract Full Text PDF PubMed Scopus (515) Google Scholar,40.Gacy A.M. McMurray C.T. Biochemistry. 1998; 37: 9426-9434Crossref PubMed Scopus (71) Google Scholar) and in vivo (41.Moore H. Greenwell P.W. Liu C.P. Arnheim N. Petes T.D. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 1504-1509Crossref PubMed Scopus (175) Google Scholar). Although the expansion of repetitive sequences is well described with regard to the alterations seen in patients, information on the mechanism of expansion only recently has become available. First, the nature of the sequence itself influences expansion. Examination of families with Huntington's disease indicates that the rate of expansion is strongly linked to DNA sequence (38.McMurray C.T. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 1823-1825Crossref PubMed Scopus (190) Google Scholar). As a result of the repeating nature of the sequences, regions that expand are able to adopt secondary structure. In addition, an increase in expansion rate is seen if the sequences are located on the lagging strand during DNA replication in yeast (42.Freudenreich C.H. Stavenhagen J.B. Zakian V.A. Mol. Cell. Biol. 1997; 17: 2090-2098Crossref PubMed Scopus (199) Google Scholar, 43.Maurer D.J. O'Callaghan B.L. Livingston D.M. Mol. Cell. Biol. 1998; 18: 4597-4604Crossref PubMed Scopus (26) Google Scholar). It has been observed in yeast that mutations in the proteins FEN1 and replication factor C lead to an increase in the length of repetitive sequences (37.Gordenin D.A. Kunkel T.A. Resnick M.A. Nat. Genet. 1997; 16: 116-118Crossref PubMed Scopus (189) Google Scholar, 44.Johnson R.E. Kovvali G.K. Prakash L. Prakash S. Science. 1995; 269: 238-240Crossref PubMed Scopus (194) Google Scholar, 45.Kunkel T.A. Resnick M.A. Gordenin D.A. Cell. 1997; 88: 155-158Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar, 46.Tishkoff D.X. Filosi N. Gaida G.M. Kolodner R.D. Cell. 1997; 88: 253-263Abstract Full Text Full Text PDF PubMed Scopus (394) Google Scholar, 47.Freudenreich C.H. Kantrow S.M. Zakian V.A. Science. 1998; 279: 853-856Crossref PubMed Scopus (362) Google Scholar, 48.Kokoska R.J. Stefanovic L. Tran H.T. Resnick M.A. Gordenin D.A. Petes T.D. Mol. Cell. Biol. 1998; 18: 2779-2788Crossref PubMed Scopus (167) Google Scholar, 49.Xie Y. Counter C. Alani E. Genetics. 1999; 151: 499-509Crossref PubMed Google Scholar). These observations suggest that repeat sequences expand during the RNA removal and joining steps of Okazaki fragment processing. Most likely foldbacks formed from the repeat sequences interfere with the required cleavage reaction of FEN1. Because primers annealed to a flap inhibit cleavage, a foldback in the flap is anticipated to inhibit by a similar mechanism. The resulting delay in the removal of flaps with foldbacks leads to an expansion of the repeat. These phenotypes of yeast are relevant to human FEN1 not only because the two nucleases exhibit a high degree of sequence homology but also because human FEN1 will rescue the defects of the null mutant in yeast (50.Greene A.L. Snipe J.R. Gordenin D.A. Resnick M.A. Hum. Mol. Genet. 1999; 8: 2263-2273Crossref PubMed Scopus (37) Google Scholar). The link between the structure of repetitive sequences and the mechanism of FEN1 has led to the proposal of a model to explain repeat expansion (37.Gordenin D.A. Kunkel T.A. Resnick M.A. Nat. Genet. 1997; 16: 116-118Crossref PubMed Scopus (189) Google Scholar). During DNA synthesis, displacement by a polymerase or helicase allows repetitive sequences to self-anneal forming secondary structure such as a hairpin loop or foldback within the DNA. Equilibration of this intermediate with the template would form a “bubble” intermediate. Synthesis from the upstream primer and ligation would prevent any further degradation of the extra repeats. Resolution of this structure during replication would lead to expansion (Fig. 1). The model explains expansion of both trinucleotide repeats and the longer minisatellite repeats. Using a series of substrates designed to adopt secondary structure, we have examined the ability of FEN1 to resolve the foldback and bubble structures formed in the model. In addition, we examined the ability of PCNA and RPA, which stimulate FEN1 activity, to assist in the removal of these intermediates. Results suggest that the model correctly describes a mechanism for repeat expansion. Oligonucleotides were synthesized either by Integrated DNA Technologies (Coralville, IA) or by Genosys Biotechnologies (The Woodlands, TX). Radionucleotides [γ-32P]ATP (6000 or 3000 Ci/mmol) and [α-32P]dCTP (3000 Ci/mmol) were obtained from NEN Life Science Products. T4 polynucleotide kinase and Klenow fragment of DNA polymerase I (labeling grade) were from Roche Diagnostics. All other reagents were the best available commercial grade. Recombinant human FEN1 was expressed and purified fromEscherichia coli utilizing the T7 expression plasmid pET-FCH (34.Bornarth C.J. Ranalli T.A. Henricksen L.A. Wahl A.F. Bambara R.A. Biochemistry. 1999; 38: 13347-13354Crossref PubMed Scopus (67) Google Scholar). Recombinant PCNA was expressed in E. coli using the expression vector pT7/PCNA (51.Fien K. Stillman B. Mol. Cell. Biol. 1992; 12: 155-163Crossref PubMed Scopus (190) Google Scholar) or RG84A (52.Gary R. Ludwig D.L. Cornelius H.L. MacInnes M.A. Park M.S. J. Biol. Chem. 1997; 272: 24522-24529Abstract Full Text Full Text PDF PubMed Scopus (201) Google Scholar) and purified. Purified FEN1 and PCNA were dialyzed into storage buffer (30 mmHEPES, pH 7.6 (diluted from a 1 m stock), 30 mmKCl, 20% glycerol, 0.01% Nonidet P-40, 1 mmdithiothreitol, and 1 mm EDTA) and stored at −80 °C. Recombinant human RPA was expressed and purified from E. coli using expression vector p11d-tRPA (53.Henricksen L.A. Umbricht C.B. Wold M.S. J. Biol. Chem. 1994; 269: 11121-11132Abstract Full Text PDF PubMed Google Scholar). Oligonucleotide primers were designed to form a series of flap or bubble substrates. For flap substrates, the 3′-end of each downstream primer is complementary to the 5′-end of its appropriate template. The 5′-end of the downstream primer forms the unannealed 5′-tail or flap. Within the 5′-end of downstream primers containing secondary structure is an inverted repeat that forms a hairpin loop or foldback. The length of the stem varies from 6–24 nucleotides. Upstream primers anneal to the 3′-end of the template forming a nick at the base of the flap. Bubble substrates contain 25 nucleotides of complementarity at both the 5′- and 3′-ends of the primers, generating an internal unannealed region. Upstream primers anneal to this internal region, forming a nick at the 3′-end of the bubble. Oligomer sequences are listed in TableI. Substrates were constructed as described in the figure legends.Table IOligonucleotide sequences (5′–3′)Downstream primers DControl(44-mer)TTTTTTTTTTTTTTTTTTTTTTCCAAGTAAAACGACGGCCAGTG aComplementary nucleotides involved in formation of secondary structure are underlined. The bold nucleotide represents the first position annealed to the template Tstem.D6 stem(42-mer)AGGTCTTATTATAGACCTTTCCAAGTAAAACGACGGCCAGTG D12 stem(54-mer)AGGTCTCGAGGCTATTATGCCTCGAGACCTTTCCAAGTAAAACGACGGCCAGTG D18 stem(66-mer)AGGTCTCGAGGCCTGCTCTATTATGAGCAGGCCTCGAGACCTTTCCAAGTAAAACGACGGCCAGTG D24 stem(78-mer)AGGTCTCGAGGCCTGCTCCTGCTCTATTATGAGCAGGAGCAGGCCTCGAGACCTTTCCAAGTAAAACGACGGCCAGTG D18 stem/0 gap(60-mer)TTGGAACGAGGCCTGCTCTATTATGAGCAGGCCTCGTTCCAA GTAAAACGACGGCCAGTG D18 stem/18 gap(78-mer)AGGTCTCGAGGCCTGCTCTATTATGAGCAGGCCTCGAGACCTTTTTTTTTTTTTTTCCAAGTAAAACGACGGCCAGTG Dbubble(80-mer)GACTCTCGACTCACGTAGAGCTGTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCAAGTAAAACGACGGCCAGTGCTACGAG D(CTG)5(54-mer)CTGCTGCTGCTGCTGTTCCAAGTAAAACGACGGCCAGTG D(CTG)10(54-mer)CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGTTCCAAGTAAAACGACGGCCAGTG D(CTG)20(54-mer)CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGTTCCAAGTAAAACGACGGCCAGTGTemplates Tcontrol(34-mer)GCACTGGCCGTCGTTTTACGGTCGTGACTGGGAA Tstem(44-mer)GCACTGGCCGTCGTTTTACGGTCGTGACTGGGAAAACCCTGGCG Tbubble,1(76-mer)GCTCGTAGCACTGGCCGTCGTTTTACGGTCGTGACTGGGAAAACCCTGGCGAACAGCTCTACGTGAGTCGAGAGTC Tbubble,2(56-mer)GCTCGTAGCACTGGCCGTCGTTTTACGGTCGAACAGCTCTACGTGAGTCGAGAGTC Tbubble2,extend(66-mer)GCTCGTAGCACTGGCCGTCGTTTTACGGTCGAACAGCTCTACGTGAGTCGAGAGTCGTCGAGAGTC LAH2.7(22-mer)ACTGCACTGGCCGTCGTTTTACUpstream primers U25(25-mer)CGCCAGGGTTTTCCCAGTCACGACC U15(15-mer)TTCCCAGTCACGACCa Complementary nucleotides involved in formation of secondary structure are underlined. The bold nucleotide represents the first position annealed to the template Tstem. Open table in a new tab Prior to annealing, downstream primers were radiolabeled at either the 5′- or 3′-end. Primers (10 pmol) were 5′-end radiolabeled with [γ-32P]ATP by T4 polynucleotide kinase asper the manufacturer's instructions. For 3′-end radiolabeled primers, downstream primers (10 pmol) were annealed to template LAH2.7 (25 pmol), which generates a 5′-overhang and extended with [α-32P]dCTP by Klenow polymerase at 37 °C for 3 h. After removal of unincorporated radionucleotides by a Micro Bio-Spin 30 chromatography column (Bio-Rad), all radiolabeled primers were purified by gel isolation from either a 10% or 12% polyacrylamide, 7 m urea denaturing gel. Substrates were generated by annealing a downstream primer, template, and upstream primer at a molar ratio of 1:2.5:5, respectively. A downstream primer and template were placed in 50 μl of TE (10 mm Tris-Cl, pH 8 and 1 mm EDTA) and heated to 100 °C for 5 min. The reaction was placed at 70 °C and allowed to slowly cool to 25 °C. After an upstream primer was added, the mixture was incubated at 37 °C for 30 min to 1 h. Assays contained the indicated amounts of substrate and FEN1 in reaction buffer (30 mm HEPES, pH 7.6 (diluted from a 1 m stock), 40 mm KCl, 8 mm MgCl2, 5% glycerol or 0.01% Nonidet P-40, and 0.1 mg/ml bovine serum albumin) in a final volume of 20 μl. Assays were incubated at 37 °C for 15 min and stopped by the addition of 10 μl of termination dye (95% formamide (v/v) with bromphenol blue and xylene cyanol). After heating to 95 °C for 5 min, samples were separated on a 12% polyacrylamide, 7 murea denaturing gel. Products were detected by PhosphorImager (Molecular Dynamics) and analyzed using ImageQuant v1.2 software from Molecular Dynamics. All assays were performed at least in triplicate. We propose that certain FEN1 substrates form secondary structures that influence the kinetics and specificity of cleavage. We examined FEN1 cleavage on substrates with foldbacks in the flap and bubble structure intermediates. This permits us to assess their importance in the context of the model for repeat expansions. To determine whether FEN1 cleaves flaps containing secondary structure, we designed substrates with an inverted repeat within the 5′-end of the flap that forms a stem-loop structure. The length of the annealed region of the stem varied from 6 to 24 nucleotides, and the loop contained 6 nucleotides. To control for the effect of sequence, each of the stem loops had similar nucleotide composition and GC content. The control substrate contained a 26-nucleotide flap consisting mostly of thymidine residues producing an unannealed 5′-tail devoid of secondary structure. All other sequences were identical for each substrate. The downstream primers of the substrates were radiolabeled at the 5′-end. The substrates were exposed to increasing amounts of FEN1 (Fig.2). Addition of FEN1 to the control substrate releases a 25-nucleotide product (lanes 1–5) representing cleavage at the base of the flap. If the presence of secondary structure had no effect on FEN1 activity, the expected products would be 24, 36, and 60 nucleotides in length for the 6, 12, and 24 nucleotide stem substrates, respectively. FEN1 is only able to readily cleave the 6-nucleotide stem (lanes 6–10) with similar specificity as the flap with no foldback. Cleavage of the 12-nucleotide stem (lanes 11–15) yields both a full-length product from release of the 5′-tail and more significant levels of mono- and dinucleotide products. Cleavage of the 24-nucleotide stem resulted in only the smaller mono- and dinucleotide products (lanes 16–20). As the foldback stem became more stable with increasing length, FEN1 was blocked from cleaving directly at the base of the flap. Instead, FEN1 cleaved the 5′-end of the self-annealed tail, generating mono- or dinucleotide products. These products are expected because the foldback is a substrate for the 5′-exonuclease activity of FEN1 (1.Harrington J.J. Lieber M.R. EMBO J. 1994; 13: 1235-1246Crossref PubMed Scopus (372) Google Scholar, 17.Murante R.S. Huang L. Turchi J.J. Bambara R.A. J. Biol. Chem. 1994; 269: 1191-1196Abstract Full Text PDF PubMed Google Scholar). Appearance of the mono- and dinucleotide products also confirms the ability of each sequence to adopt the predicted secondary structure, because FEN1 is an obligate double-stranded exonuclease. As the length of the annealed region increases, so does the stability of the foldback, allowing the nuclease to more efficiently attack the 5′-end. However, cleavage of the 5′-radiolabeled nucleotide prevents further analysis regarding the fate of the stem loop present within the flap. It is possible that FEN1 continued to cleave as an exonuclease until the double-stranded region was sufficiently small that the stem melted, forming a more favorable flap structure for FEN1. For further examination of the effect of secondary structure, substrates were radiolabeled at the 3′-end of the downstream primer and incubated with increasing amounts of FEN1. To determine more precisely the length of secondary structure necessary to influence FEN1 activity, the annealed regions of the stems were made 6, 12, 18, and 24 nucleotides long. Because the length of the annealed downstream region of each substrate is identical, cleavage by FEN1 resulted in the generation of a 19-mer for all substrates (Fig.3 A). FEN1 cleavage was easily detectable on the control substrate and substrates containing 6 and 12 nucleotides (Fig. 3 A, lanes 1–15). The ability of FEN1 to cleave the 18- and 24-nucleotide stem substrates is significantly reduced (Fig. 3 A, lanes 16–25). At higher levels of FEN1, additional cleavage products smaller than the 19-mer are observed. These are the result of exonucleolytic cleavage within the annealed double-stranded region of the downstream primer. We also observed some exonucleolytic removal of the 5′-end as expected from the results of Fig. 2. Production of the 19-mer does not appear to derive from progressive exonucleolytic cleavag" @default.
• W2033229710 created "2016-06-24" @default.
• W2033229710 creator A5005315226 @default.
• W2033229710 creator A5041357374 @default.
• W2033229710 creator A5046214153 @default.
• W2033229710 creator A5064448783 @default.
• W2033229710 date "2000-06-01" @default.
• W2033229710 modified "2023-09-28" @default.
• W2033229710 title "Inhibition of Flap Endonuclease 1 by Flap Secondary Structure and Relevance to Repeat Sequence Expansion" @default.
• W2033229710 cites W1490159978 @default.
• W2033229710 cites W1506492200 @default.
• W2033229710 cites W1516514485 @default.
• W2033229710 cites W1559981481 @default.
• W2033229710 cites W1566131689 @default.
• W2033229710 cites W1573865605 @default.
• W2033229710 cites W1605120960 @default.
• W2033229710 cites W1605838085 @default.
• W2033229710 cites W1729887059 @default.
• W2033229710 cites W1860417382 @default.
• W2033229710 cites W1967209251 @default.
• W2033229710 cites W1974364870 @default.
• W2033229710 cites W1974573561 @default.
• W2033229710 cites W1981277651 @default.
• W2033229710 cites W1988744134 @default.
• W2033229710 cites W1994232734 @default.
• W2033229710 cites W1994245744 @default.
• W2033229710 cites W2000858384 @default.
• W2033229710 cites W2003329456 @default.
• W2033229710 cites W2005610074 @default.
• W2033229710 cites W2006717413 @default.
• W2033229710 cites W2010302368 @default.
• W2033229710 cites W2014223000 @default.
• W2033229710 cites W2018078151 @default.
• W2033229710 cites W2021091954 @default.
• W2033229710 cites W2021241545 @default.
• W2033229710 cites W2024939635 @default.
• W2033229710 cites W2028513756 @default.
• W2033229710 cites W2033676950 @default.
• W2033229710 cites W2034535098 @default.
• W2033229710 cites W2036045863 @default.
• W2033229710 cites W2037740592 @default.
• W2033229710 cites W2038529419 @default.
• W2033229710 cites W2038599420 @default.
• W2033229710 cites W2040135708 @default.
• W2033229710 cites W2052893592 @default.
• W2033229710 cites W2053919212 @default.
• W2033229710 cites W2055566423 @default.
• W2033229710 cites W2064477710 @default.
• W2033229710 cites W2067437719 @default.
• W2033229710 cites W2068388955 @default.
• W2033229710 cites W2069157381 @default.
• W2033229710 cites W2082478355 @default.
• W2033229710 cites W2085617522 @default.
• W2033229710 cites W2088867782 @default.
• W2033229710 cites W2090110799 @default.
• W2033229710 cites W2090903262 @default.
• W2033229710 cites W2093369849 @default.
• W2033229710 cites W2094292611 @default.
• W2033229710 cites W2097766570 @default.
• W2033229710 cites W2105311265 @default.
• W2033229710 cites W2106837356 @default.
• W2033229710 cites W2107856790 @default.
• W2033229710 cites W2115237139 @default.
• W2033229710 cites W2142485616 @default.
• W2033229710 cites W2159410688 @default.
• W2033229710 cites W2161804304 @default.
• W2033229710 cites W2167124397 @default.
• W2033229710 cites W2167402095 @default.
• W2033229710 cites W2167998990 @default.
• W2033229710 doi "https://doi.org/10.1074/jbc.m909635199" @default.
• W2033229710 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10748145" @default.
• W2033229710 hasPublicationYear "2000" @default.
• W2033229710 type Work @default.
• W2033229710 sameAs 2033229710 @default.
• W2033229710 citedByCount "99" @default.
• W2033229710 countsByYear W20332297102012 @default.
• W2033229710 countsByYear W20332297102013 @default.
• W2033229710 countsByYear W20332297102014 @default.
• W2033229710 countsByYear W20332297102015 @default.
• W2033229710 countsByYear W20332297102016 @default.
• W2033229710 countsByYear W20332297102018 @default.
• W2033229710 countsByYear W20332297102019 @default.
• W2033229710 countsByYear W20332297102020 @default.
• W2033229710 countsByYear W20332297102021 @default.
• W2033229710 crossrefType "journal-article" @default.
• W2033229710 hasAuthorship W2033229710A5005315226 @default.
• W2033229710 hasAuthorship W2033229710A5041357374 @default.
• W2033229710 hasAuthorship W2033229710A5046214153 @default.
• W2033229710 hasAuthorship W2033229710A5064448783 @default.
• W2033229710 hasBestOaLocation W20332297101 @default.
• W2033229710 hasConcept C185592680 @default.
• W2033229710 hasConcept C2777028655 @default.
• W2033229710 hasConcept C2778112365 @default.
• W2033229710 hasConcept C54355233 @default.
• W2033229710 hasConcept C552990157 @default.
• W2033229710 hasConcept C86803240 @default.
• W2033229710 hasConceptScore W2033229710C185592680 @default.
• W2033229710 hasConceptScore W2033229710C2777028655 @default.

• next