FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2033679307> ?p ?o ?g. }

• W2033679307 endingPage "5842" @default.
• W2033679307 startingPage "5836" @default.
• W2033679307 abstract "Activation of the epidermal growth factor (EGF) receptor can stimulate actin polymerization via the Arp2/3 complex using a number of signaling pathways, and specific stimulation conditions may control which pathways are activated. We have previously shown that localized stimulation of EGF receptor with EGF bound to beads results in localized actin polymerization and protrusion. Here we show that the actin polymerization is dependent upon activation of the Arp2/3 complex by neural Wiskott-Aldrich Syndrome protein (N-WASP) via Grb2 and Nck2. Suppression of Grb2 or Nck2 results in loss of localization of N-WASP at the activation site and reduced actin polymerization. Although cortactin has been found to synergize with N-WASP for Arp2/3-dependent actin polymerization in vitro, we find that cortactin can restrict N-WASP localization around EGF-bead-induced protrusions. In addition, cortactin-deficient cells have increased lamellipod dynamics but show reduced net translocation, suggesting that cortactin can contribute to cell polarity by controlling the extent of Arp2/3 activation by WASP family members and the stability of the F-actin network. Activation of the epidermal growth factor (EGF) receptor can stimulate actin polymerization via the Arp2/3 complex using a number of signaling pathways, and specific stimulation conditions may control which pathways are activated. We have previously shown that localized stimulation of EGF receptor with EGF bound to beads results in localized actin polymerization and protrusion. Here we show that the actin polymerization is dependent upon activation of the Arp2/3 complex by neural Wiskott-Aldrich Syndrome protein (N-WASP) via Grb2 and Nck2. Suppression of Grb2 or Nck2 results in loss of localization of N-WASP at the activation site and reduced actin polymerization. Although cortactin has been found to synergize with N-WASP for Arp2/3-dependent actin polymerization in vitro, we find that cortactin can restrict N-WASP localization around EGF-bead-induced protrusions. In addition, cortactin-deficient cells have increased lamellipod dynamics but show reduced net translocation, suggesting that cortactin can contribute to cell polarity by controlling the extent of Arp2/3 activation by WASP family members and the stability of the F-actin network. Binding of chemoattractants such as EGF 1The abbreviations used are: EGF, epidermal growth factor; Arp2/3, actin-related proteins 2 and 3; WASP, Wiskott-Aldrich Syndrome protein; WAVE, WASP family Verprolin homologous protein; N-WASP, neural WASP; siRNA, small interfering RNA; GFP, green fluorescent protein; F-actin, filamentous actin; VCA, verprolin, cofilin, and acidic. to cell surface receptors induces actin polymerization and membrane protrusion (1Borisy G.G. Svitkina T.M. Curr. Opin. Cell Biol. 2000; 12: 104-112Crossref PubMed Scopus (404) Google Scholar, 2Condeelis J.S. Wyckoff J.B. Bailly M. Pestell R. Lawrence D. Backer J. Segall J.E. Semin. Cancer Biol. 2001; 11: 119-128Crossref PubMed Scopus (117) Google Scholar, 3Small J.V. Stradal T. Vignal E. Rottner K. Trends Cell Biol. 2002; 12: 112-120Abstract Full Text Full Text PDF PubMed Scopus (744) Google Scholar). In cancer, the ability of cells to sense spatial gradients of chemoattractants can contribute to invasion and metastasis (4Condeelis J. Segall J.E. Nat. Rev. Cancer. 2003; 3: 921-930Crossref PubMed Scopus (756) Google Scholar, 5Feldner J.C. Brandt B.H. Exp. Cell Res. 2002; 272: 93-108Crossref PubMed Scopus (87) Google Scholar, 6Wells A. Adv. Cancer Res. 2000; 78: 31-101Crossref PubMed Google Scholar). EGF-induced actin polymerization depends on the severing activity of cofilin to generate barbed ends and the de novo branching of actin filaments by the Arp2/3 complex (7Bailly M. Macaluso F. Cammer M. Chan A. Segall J.E. Condeelis J.S. J. Cell Biol. 1999; 145: 331-345Crossref PubMed Scopus (175) Google Scholar, 8Chan A.Y. Bailly M. Zebda N. Segall J.E. Condeelis J.S. J. Cell Biol. 2000; 148: 531-542Crossref PubMed Scopus (210) Google Scholar, 9Pollard T.D. Borisy G.G. Cell. 2003; 112: 453-465Abstract Full Text Full Text PDF PubMed Scopus (3303) Google Scholar). Cofilin severing activity is controlled by phosphorylation, pH, and phosphatidylinositol 4,5-biphosphate binding (10Bailly M. Jones G.E. Curr. Biol. 2003; 13: R128-R130Abstract Full Text Full Text PDF PubMed Scopus (29) Google Scholar, 11Sarmiere P.D. Bamburg J.R. J. Neurobiol. 2004; 58: 103-117Crossref PubMed Scopus (176) Google Scholar). The Arp2/3 complex is activated by a conformational change induced by protein binding (12Zalevsky J. Lempert L. Kranitz H. Mullins R.D. Curr. Biol. 2001; 11: 1903-1913Abstract Full Text Full Text PDF PubMed Scopus (118) Google Scholar). Biochemical studies have shown that WASP and WAVE family proteins as well as cortactin can induce Arp2/3-dependent actin polymerization (13Higgs H.N. Pollard T.D. Annu. Rev. Biochem. 2001; 70: 649-676Crossref PubMed Scopus (546) Google Scholar). N-WASP and WAVE family proteins use their C-terminal verprolin, cofilin, acidic (VCA) homology sequence domains to bind and activate the Arp2/3 complex (13Higgs H.N. Pollard T.D. Annu. Rev. Biochem. 2001; 70: 649-676Crossref PubMed Scopus (546) Google Scholar). N-WASP was initially shown to be activated by GTP-Cdc42 binding (14Rohatgi R. Ma L. Miki H. Lopez M. Kirchhausen T. Takenawa T. Kirschner M.W. Cell. 1999; 97: 221-231Abstract Full Text Full Text PDF PubMed Scopus (1082) Google Scholar). Sub-sequently, Grb2 (15Carlier M.F. Nioche P. Broutin-L'Hermite I. Boujemaa R. Le Clainche C. Egile C. Garbay C. Ducruix A. Sansonetti P. Pantaloni D. J. Biol. Chem. 2000; 275: 21946-21952Abstract Full Text Full Text PDF PubMed Scopus (180) Google Scholar) and Nck (16Rohatgi R. Nollau P. Ho H.Y. Kirschner M.W. Mayer B.J. J. Biol. Chem. 2001; 276: 26448-26452Abstract Full Text Full Text PDF PubMed Scopus (328) Google Scholar) were demonstrated to activate N-WASP-induced actin polymerization by binding to the proline-rich region. Rac1 or Nck are thought to activate WAVE family members by disruption of a five-protein complex (17Eden S. Rohatgi R. Podtelejnikov A.V. Mann M. Kirschner M.W. Nature. 2002; 418: 790-793Crossref PubMed Scopus (652) Google Scholar). Cortactin induces actin polymerization by binding to the Arp2/3 complex via its N-terminal acidic region (18Uruno T. Liu J. Zhang P. Fan Y. Egile C. Li R. Mueller S.C. Zhan X. Nat. Cell Biol. 2001; 3: 259-266Crossref PubMed Scopus (464) Google Scholar, 19Weaver A.M. Karginov A.V. Kinley A.W. Weed S.A. Li Y. Parsons J.T. Cooper J.A. Curr. Biol. 2001; 11: 370-374Abstract Full Text Full Text PDF PubMed Scopus (473) Google Scholar). Unlike N-WASP and WAVE proteins, cortactin requires binding to F-actin filaments to induce Arp2/3-dependent actin polymerization (18Uruno T. Liu J. Zhang P. Fan Y. Egile C. Li R. Mueller S.C. Zhan X. Nat. Cell Biol. 2001; 3: 259-266Crossref PubMed Scopus (464) Google Scholar, 19Weaver A.M. Karginov A.V. Kinley A.W. Weed S.A. Li Y. Parsons J.T. Cooper J.A. Curr. Biol. 2001; 11: 370-374Abstract Full Text Full Text PDF PubMed Scopus (473) Google Scholar). Binding assays have shown that cortactin co-operatively binds the Arp2/3 complex with N-WASP (19Weaver A.M. Karginov A.V. Kinley A.W. Weed S.A. Li Y. Parsons J.T. Cooper J.A. Curr. Biol. 2001; 11: 370-374Abstract Full Text Full Text PDF PubMed Scopus (473) Google Scholar). Recent findings have suggested that cortactin can also displace N-WASP from the Arp2/3 complex, stabilizing filament branches and maintaining actin polymerization (20Uruno T. Liu J. Li Y. Smith N. Zhan X. J. Biol. Chem. 2003; 278: 26086-26093Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar). Therefore, the role of cortactin in actin polymerization may vary depending on cell type and stimulation condition. To define the spatial patterns of pathways that can link the EGF receptor to Arp2/3 complex activation, we have developed a method of stimulating cells with EGF-coated beads to allow us to evaluate local stimulation of actin polymerization (21Kempiak S.J. Yip S.C. Backer J.M. Segall J.E. J. Cell Biol. 2003; 162: 781-787Crossref PubMed Scopus (37) Google Scholar). Stimulation with EGF-coated beads induced localized actin polymerization within a 2 μm radius, and in 25% of the cases the actin polymerization was accompanied by a protrusion extending the bead several microns off the surface of the cell. The response was inhibited by blocking EGF receptor activity or actin polymerization. This type of stimulation did not induce focal adhesion clustering (21Kempiak S.J. Yip S.C. Backer J.M. Segall J.E. J. Cell Biol. 2003; 162: 781-787Crossref PubMed Scopus (37) Google Scholar), which may integrate other signals influencing actin dynamics. We found that both cofilin and the Arp2/3 complex were required to stimulate protrusions and localized actin polymerization by EGF immobilized on beads but that these responses were independent of phosphatidylinositol 3-kinase (21Kempiak S.J. Yip S.C. Backer J.M. Segall J.E. J. Cell Biol. 2003; 162: 781-787Crossref PubMed Scopus (37) Google Scholar), whereas responses to soluble EGF are sensitive to this kinase (22Mouneimne G. Soon L. DesMarais V. Sidani M. Song X. Yip S.C. Ghosh M. Eddy R. Backer J.M. Condeelis J.S. J. Cell Biol. 2004; 166: 697-708Crossref PubMed Scopus (201) Google Scholar). EGF beads may mimic ligands bound to extracellular matrix in vivo, which could elicit a different response compared with the addition of soluble growth factor. In this report, we analyze the signaling pathways contributing to regulation of the Arp2/3 complex in the EGF-bead response. We find N-WASP to be the critical factor in Arp2/3 activation by EGF beads. Furthermore, both Grb2 and Nck2 are required for activation of N-WASP. Removal of cortactin enhanced the EGF-bead protrusion response together with an increase in N-WASP around the bead. We conclude that under our stimulation conditions, cortactin restricts N-WASP activation of actin polymerization and stabilizes the actin cytoskeleton. Cell Culture and Stimulation—MTLn3 cells were maintained in α minimal essential media with 5% fetal calf serum and antibiotics (23Segall J.E. Tyerech S. Boselli L. Masseling S. Helft J. Chan A. Jones J. Condeelis J. Clin. Exp. Metastasis. 1996; 14: 61-72Crossref PubMed Scopus (117) Google Scholar). For experiments, cells were plated on MatTek dishes in complete media overnight. Typically, cells were then starved for 3 h in L15 media (Invitrogen) supplemented with 0.35% bovine serum albumin before stimulation with EGF-bound beads for 3 min or with 10 nm soluble EGF (Invitrogen) for 1 min. Biotin EGF (Molecular Probes, Eugene, OR) was bound to streptavidin-bound magnetic beads (Pierce, or Dynal, Brown Deer, WI) brought down onto cells within 20 s using a magnet; this was followed by fixation and staining as described (21Kempiak S.J. Yip S.C. Backer J.M. Segall J.E. J. Cell Biol. 2003; 162: 781-787Crossref PubMed Scopus (37) Google Scholar, 24Kempiak S.J. Segall J.E. Science's STKE. 2004; 218: 11Google Scholar). Observation in the F-actin (rhodamine) channel was used to characterize the response as either: 1) a protrusion (a three-dimensional structure where the bead has been “pushed” away from the cell and is not in the same plane of focus as neighboring cell components), 2) local positive responses (increased F-actin staining near the bead but in the same plane of focus as neighboring cell components with no three-dimensional structure clearly visible), or 3) no responses (no protrusion or increased F-actin staining near the bead). Data were then plotted as fraction of cells showing protrusions only or total responses (the sum of protrusions and local positive responses). For analysis of net path length and net flow, 60-min-long time lapse movies were analyzed with DIAS at 5-min intervals (Solltech, Oakdale, IA). Net path length was provided by DIAS as the straight line distance from the path starting point to the ending point during the entire 60-min interval. Net flow represents the total fraction of cell area that changes position between successive time points and is the sum of the positive and negative flow parameters calculated by DIAS. Net path length represents the net movement of the cell centroid, whereas net flow is a measure of all changes in cell shape and protrusion independent of their contribution to cell translocation. Small Interfering RNAs and Rescue—All siRNAs were purchased from Qiagen. Control, cofilin, and p34 siRNAs have been described (21Kempiak S.J. Yip S.C. Backer J.M. Segall J.E. J. Cell Biol. 2003; 162: 781-787Crossref PubMed Scopus (37) Google Scholar). N-WASP (AAGACGAGATGCTCCAAATGG), WAVE1 (AATGCCTCCGTCCCCACCTTC), WAVE2 (AAACCTATAACAGCTGTGACG), cortactin (CAAGCTTCGAGAGAATGTCTT), Grb2 (AACATCCGTGTCCAGGAACCA), Nck1 (GATGATAGCTTTGTTGATCCA), and Nck2 (CAAGCACTGATGCGGAATACC) siRNA sequences were designed for the rat sequence. Cells were transfected with 100 nm siRNA using Oligofectamine (Invitrogen) 36 or 48 h before use. Rescue cDNA constructs were: Bos taurus GFP-N-WASP (Dr. Tadaomi Takenawa, University of Tokyo), human GFP-Grb2 and GFP-Nck2 (25Scaplehorn N. Holmstrom A. Moreau V. Frischknecht F. Reckmann I. Way M. Curr. Biol. 2002; 12: 740-745Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar), human cortactin (Dr. Roger Daly, Garvan Institute, Sydney, Australia), Myctagged N-terminal deleted and full-length mouse cortactin (Dr. Xi Zhan, American Red Cross, Rockville, Maryland). In siRNA rescue, cells were first treated with siRNA and allowed to rest until 80–90% confluent. Cells were then transfected with cDNA constructs using Lipofectamine 2000 (Invitrogen). Rescued cells were identified by GFP or antibody staining using anti-N-WASP (Santa Cruz Biotechnology) and anti-cortactin (Upstate Biotechnology) antibodies. Triton Permeabilization Assay—Cells were either fixed in 4% formaldehyde for 10 min and then permeabilized with 0.1% Triton X-100 for an additional 10 min (total filaments) or fixed with 4% formaldehyde and 0.1% Triton X-100 for 20 min (stable filaments). Both groups were then washed in 1× Tris-buffered saline five times, stained with rhodamine-phalloidin in 1× Tris-buffered saline containing 1% bovine serum albumin and 1% fetal calf serum, and then washed with 1× Tris-buffered saline five times. Staining Intensity Measurements—The F-actin or N-WASP staining ratio of the bead site compared with the edge of cell was then determined as described (21Kempiak S.J. Yip S.C. Backer J.M. Segall J.E. J. Cell Biol. 2003; 162: 781-787Crossref PubMed Scopus (37) Google Scholar, 24Kempiak S.J. Segall J.E. Science's STKE. 2004; 218: 11Google Scholar). In brief, using an image processing program such as NIH Image or ImageJ, the area of increased fluorescence intensity in the cell membrane next to the bead is outlined and the average intensity determined. The average intensity of the membrane staining in an equivalent area far from the bead is also determined. The ratio of the two is then calculated for each cell followed by averaging of the ratios from all the cells for each condition. Western Blot—Western blots were performed as described (21Kempiak S.J. Yip S.C. Backer J.M. Segall J.E. J. Cell Biol. 2003; 162: 781-787Crossref PubMed Scopus (37) Google Scholar). Antibodies used were for p34 and cortactin (Upstate Biotechnology), N-WASP, WAVE1 and WAVE2 (Dr. Tadaomi Takenawa, University of Tokyo, Japan) and Nck (Dr. Tony Pawson, University of Toronto, Canada). The EGF-Bead Response Requires N-WASP—To determine the pathway upstream of Arp2/3 required for the response to EGF beads, siRNAs were designed to suppress expression of the major activators of the Arp 2/3 complex: N-WASP, WAVE1, WAVE2, and cortactin (26Takenawa T. Miki H. J. Cell Sci. 2001; 114: 1801-1809Crossref PubMed Google Scholar). WAVE3 and WASP were not tested because they are not expressed in MTLn3 cells (data not shown). Measurements were scored by identifying beads in contact with cells and then using rhodamine-phalloidin staining to determine whether the bead induced no response or localized actin polymerization or a protrusion (Fig. 1A). WAVE1 and WAVE2 suppression resulted in little or no reduction of responses (Fig. 1B). N-WASP suppression resulted in a decrease in protrusions and total responses observed by 50% (Fig. 1B). A second siRNA to a different region of N-WASP yielded a similar level of inhibition (data not shown). Expression of Bos taurus N-WASP (which contains two base pair mismatches in sequence compared with the siRNA used) restored the EGF-bead response in N-WASP siRNA-treated cells (Fig. 1C). Thus, N-WASP is important for activation of the EGF-bead induced response, whereas neither WAVE1 nor WAVE2 play a substantial role. Simultaneous suppression of both Arp2/3 complex and cofilin function is required for near complete inhibition of the EGF-bead-induced response, suggesting two parallel pathways to actin polymerization (21Kempiak S.J. Yip S.C. Backer J.M. Segall J.E. J. Cell Biol. 2003; 162: 781-787Crossref PubMed Scopus (37) Google Scholar). Simultaneous suppression of N-WASP and cofilin also dramatically decreased the EGF-bead-induced response (Fig. 1D). The combination of N-WASP and p34 (a component of the Arp2/3 complex) siRNA did not reduce responses to EGF-coated beads more than N-WASP siRNA alone (Fig. 1D), indicating that N-WASP is the major upstream activator of the Arp2/3 complex in actin polymerization induced by localized EGF. Grb2 and Nck2 Are Required in the EGF-Bead Response to Recruit and Activate N-WASP—We have shown previously that phosphatidylinositol 3-kinase and cdc42 are not required for the responses induced by EGF beads (21Kempiak S.J. Yip S.C. Backer J.M. Segall J.E. J. Cell Biol. 2003; 162: 781-787Crossref PubMed Scopus (37) Google Scholar). We therefore tested Grb2, Nck1, and Nck2, which can also activate N-WASP (15Carlier M.F. Nioche P. Broutin-L'Hermite I. Boujemaa R. Le Clainche C. Egile C. Garbay C. Ducruix A. Sansonetti P. Pantaloni D. J. Biol. Chem. 2000; 275: 21946-21952Abstract Full Text Full Text PDF PubMed Scopus (180) Google Scholar, 16Rohatgi R. Nollau P. Ho H.Y. Kirschner M.W. Mayer B.J. J. Biol. Chem. 2001; 276: 26448-26452Abstract Full Text Full Text PDF PubMed Scopus (328) Google Scholar). Suppression of Grb2 decreased responses by 40% (Fig. 2A, diagonal lines bars) and was confirmed using a second siRNA (data not shown). A GFP-tagged human Grb2 sequence, which deviates from the rat Grb2 siRNA by three base pairs, restored responses in cells treated with rat Grb2 siRNA (Fig. 2B, gray bars). To monitor Nck protein expression, we used an antibody that recognizes both Nck1 and Nck2 SH3 domains (27Bladt F. Aippersbach E. Gelkop S. Strasser G.A. Nash P. Tafuri A. Gertler F.B. Pawson T. Mol. Cell. Biol. 2003; 23: 4586-4597Crossref PubMed Scopus (145) Google Scholar). Either Nck1 or Nck2 suppression alone resulted in a partial decrease in protein expression; however, when both siRNAs were added simultaneously little or no protein remained (Fig. 2E). This result is consistent with Nck knock-out experiments utilizing mouse embryonic fibroblast lysates in which much of the antibody staining was caused by Nck1 (27Bladt F. Aippersbach E. Gelkop S. Strasser G.A. Nash P. Tafuri A. Gertler F.B. Pawson T. Mol. Cell. Biol. 2003; 23: 4586-4597Crossref PubMed Scopus (145) Google Scholar). Interestingly, suppression of Nck1 had no effect on the EGF-bead response (Fig. 2A, dotted bars). Nck2 suppression (Fig. 2A, gray bars) inhibited the bead response to an extent similar to that seen in Grb2 suppression or simultaneous suppression of both Nck1 and Nck2 (Fig. 2A, horizontal striped bars). Thus Nck2, like Grb2, mediates EGF-bead-induced responses. This was confirmed by a second Nck2 siRNA (data not shown) and rescue of the siRNA treatment using GFP-tagged human Nck2, which had four mismatched base pairs to the rat Nck2 siRNA used (Fig. 2C). Simultaneous reduction of the levels of Grb2 and Nck2 did not inhibit the bead response more than reduction of either protein alone (Fig. 2A, black bars). Suppressing N-WASP in combination with either Grb2 or Nck2 (Fig. 2D) did not significantly differ from suppression of N-WASP, Grb2, or Nck2 alone. However, suppressing cofilin in combination with either Grb2 or Nck2 showed a decrease in responses similar to suppression of both N-WASP and cofilin (Fig. 1C) or both p34 and cofilin (21Kempiak S.J. Yip S.C. Backer J.M. Segall J.E. J. Cell Biol. 2003; 162: 781-787Crossref PubMed Scopus (37) Google Scholar). These data suggest that Grb2 and Nck2 might act in concert to activate N-WASP in response to EGF-beads. To test this hypothesis we evaluated N-WASP recruitment to the bead site in the presence or absence of Grb2 or Nck2. In a normal response, N-WASP staining is increased next to the bead (Fig. 3, A, open bars, and B, top panels). In the absence of either Grb2 or Nck2, N-WASP staining at the bead site decreased to levels seen at the edge of cells that were not touched by a bead (Fig. 3, A, striped and solid bars, and B, bottom panels). Furthermore, the beads that showed positive responses under these conditions had a decrease in F-actin staining at the bead site compared with control siRNA-treated cells (Fig. 3A), indicating that the loss of Grb2 and Nck2 along with a decrease in N-WASP recruitment impeded actin polymerization at the bead site. Grb2 and Nck2 siRNA had no effect on N-WASP, p34, or cofilin expression (data not shown). We conclude that Grb2 and Nck2 are necessary for recruitment of N-WASP to the EGF receptor to activate Arp2/3-induced actin polymerization. Cortactin Is Antagonistic to Actin Polymerization Induction but Is Required for Integration of Freshly Polymerized Actin into the Cell Cytoarchitecture—Suppression of cortactin expression unexpectedly resulted in the enhancement of protrusion responses by 50% (Fig. 4A, diagonal lines bars) and was confirmed by another siRNA against a different region of the cortactin gene (data not shown). Next we rescued the rat cortactin siRNA response by overexpressing a human cortactin sequence, which had three mismatches to the siRNA used. Overexpression of human cortactin in rat cortactin siRNA-treated cells decreased responses (Fig. 4A, gray bars), whereas expression of an N-terminal deletion of cortactin, which does not bind Arp2/3 but does have its F-actin binding region (18Uruno T. Liu J. Zhang P. Fan Y. Egile C. Li R. Mueller S.C. Zhan X. Nat. Cell Biol. 2001; 3: 259-266Crossref PubMed Scopus (464) Google Scholar), also enhanced protrusion responses (Fig. 4B, gray bars). This overexpression analysis suggested that the antagonistic function of cortactin was occurring at its Arp2/3 binding region and may be regulating N-WASP function. Because it has been shown that cortactin can displace N-WASP from the Arp2/3 complex in the presence of F-actin (20Uruno T. Liu J. Li Y. Smith N. Zhan X. J. Biol. Chem. 2003; 278: 26086-26093Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar), we compared the localization of N-WASP in control and cortactin siRNA-treated cells. In control siRNA-treated cells, N-WASP staining was tightly localized around the bead site, whereas cortactin localized with F-actin staining just outside the site of N-WASP localization (Fig. 4E) similar to actin comet tails formed by vaccinia virus (28Frischknecht F. Way M. Trends Cell Biol. 2001; 11: 30-38Abstract Full Text Full Text PDF PubMed Scopus (182) Google Scholar) and Shigella (20Uruno T. Liu J. Li Y. Smith N. Zhan X. J. Biol. Chem. 2003; 278: 26086-26093Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar). Cells treated with cortactin siRNA had increased N-WASP protein staining at EGF beads and more uniform colocalization of N-WASP with F-actin throughout protrusions (Fig. 4, C and E). Thus, suppression of cortactin increases N-WASP recruitment and the number of protrusions found at the EGF-bead site. Cells with reduced cortactin also displayed increased F-actin staining at the lamellipod edge compared with control siRNA cells (Fig. 5A) suggesting that increased actin polymerization was occurring there. Live cell imaging was performed to compare the cortactin to control siRNA-treated cells. There was an increase in multiple actively protruding cell edges in cortactin siRNA-treated cells compared with control siRNA-treated cells, which tended to have one dominant lamellipod (supplemental Movies 1 and 2 and net flow in Fig. 5B). Net flow (Fig. 5B), which is a measure of retraction and extension of cell protrusions, was significantly higher in the cortactin siRNA-treated cells, consistent with the presence of multiply protruding cell edges. However, cells with reduced cortactin showed decreased total translocation compared with control treated cells (net path length in Fig. 5B)in line with previous reports of cortactin contributing to effective cell movement (29Huang C. Liu J. Haudenschild C.C. Zhan X. J. Biol. Chem. 1998; 273: 25770-25776Abstract Full Text Full Text PDF PubMed Scopus (236) Google Scholar, 30Patel A.S. Schechter G.L. Wasilenko W.J. Somers K.D. Oncogene. 1998; 16: 3227-3232Crossref PubMed Scopus (126) Google Scholar). These data suggest that cortactin is required for cell movement but not for the induction of actin polymerization in spontaneous cell motility. If cortactin is involved in binding F-actin filaments in conjunction with the Arp2/3 complex (19Weaver A.M. Karginov A.V. Kinley A.W. Weed S.A. Li Y. Parsons J.T. Cooper J.A. Curr. Biol. 2001; 11: 370-374Abstract Full Text Full Text PDF PubMed Scopus (473) Google Scholar), then loss of cortactin might result in reduced stability. The stability of the actin filaments in control and cortactin siRNA-treated cells after EGF-bead stimulation was determined using a Triton permeabilization assay. Cells were fixed in the presence of Triton X-100, which can enhance the loss of labile structures within the cell. Although suppression of cortactin produced increased actin polymerization around the beads in the absence of Triton (Fig. 5C, total F-actin), the amount of F-actin was significantly decreased after Triton treatment in cortactin siRNA-treated cells compared with control siRNA-treated cells (Fig. 5C, stable F-actin). Therefore, cortactin contributes to the stability of actin filaments induced by EGF beads. Previously, we found that actin polymerization induced by EGF beads is dependent on cofilin and the Arp2/3 complex but independent of phosphatidylinositol 3-kinase and Cdc42/Rac (21Kempiak S.J. Yip S.C. Backer J.M. Segall J.E. J. Cell Biol. 2003; 162: 781-787Crossref PubMed Scopus (37) Google Scholar) suggesting that Arp2/3 activation in this response was independent of Rho family proteins. In the current manuscript we examined the mechanism of Arp2/3 activation. Of Arp2/3 complex activators, only N-WASP siRNA treatment significantly inhibited the response. Next we inhibited the expression of N-WASP activators, Grb2 and Nck1 and Nck2 (15Carlier M.F. Nioche P. Broutin-L'Hermite I. Boujemaa R. Le Clainche C. Egile C. Garbay C. Ducruix A. Sansonetti P. Pantaloni D. J. Biol. Chem. 2000; 275: 21946-21952Abstract Full Text Full Text PDF PubMed Scopus (180) Google Scholar, 16Rohatgi R. Nollau P. Ho H.Y. Kirschner M.W. Mayer B.J. J. Biol. Chem. 2001; 276: 26448-26452Abstract Full Text Full Text PDF PubMed Scopus (328) Google Scholar) and found that both Grb2 and Nck2 were required in the EGF-bead response. When used in combination with cofilin siRNA, the N-WASP, Grb2, or Nck2 siRNAs were able to inhibit the protrusion response almost completely, similar to suppression of cofilin and p34 (21Kempiak S.J. Yip S.C. Backer J.M. Segall J.E. J. Cell Biol. 2003; 162: 781-787Crossref PubMed Scopus (37) Google Scholar). However, the combination of p34 with N-WASP siRNA or N-WASP with Grb2 or Nck siRNA had no additional effect over any one siRNA treatment alone, indicating that Grb2, Nck2, N-WASP, and p34 are all on the same pathway leading to activation of the Arp2/3 complex. Remarkably, we found that suppression of cortactin, another Arp2/3 activator, increased the number of EGF bead-induced protrusions. This increase in responses was also seen with overexpression of a cortactin fragment that lacked the N-terminal acidic domain, which mediates binding to the Arp2/3 complex (18Uruno T. Liu J. Zhang P. Fan Y. Egile C. Li R. Mueller S.C. Zhan X. Nat. Cell Biol. 2001; 3: 259-266Crossref PubMed Scopus (464) Google Scholar, 19Weaver A.M. Karginov A.V. Kinley A.W. Weed S.A. Li Y. Parsons J.T. Cooper J.A. Curr. Biol. 2001; 11: 370-374Abstract Full Text Full Text PDF PubMed Scopus (473) Google Scholar). This suggested that the antagonistic function of cortactin was caused by its interaction with the Arp2/3 complex. Because cortactin can displace the VCA homology sequence domain of N-WASP from Arp2/3 complex in the presence of F-actin (20Uruno T. Liu J. Li Y. Smith N. Zhan X. J. Biol. Chem. 2003; 278: 26086-26093Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar), we tested if cortactin was regulating N-WASP localization at the EGF-bead site. After cortactin loss, there was increased N-WASP found at the EGF-bead site as well as increased localization of N-WASP throughout protrusions. This increased binding of N-WASP was concurrent with an increase in F-actin staining at the bead site as well as other areas of actin polymerization, such as the leading edge, demonstrating that cortactin is regulating the function as well as location of N-WASP. Both Grb2 and Nck1 and -2 have been shown to bind the activated EGF receptor, either directly at phosphotyrosine residues in the case of Grb2, or via other proteins, such as Dok in the case of Nck (31McCarty J.H. BioEssays. 1998; 20: 913-921Crossref PubMed Scopus (80) Google Scholar). In addition, Grb2 and Nck have been shown to bind and stimulate N-WASP activation of the Arp2/3 complex (15Carlier M.F. Nioche P. Broutin-L'Hermite I. Boujemaa R. Le Clainche C. Egile C. Garbay C. Ducruix A. Sansonetti P. Pantaloni D. J. Biol. Chem. 2000; 275: 21946-21952Abstract Full Text Full Text PDF PubMed Scopus (180) Google Scholar, 16Rohatgi R. Nollau P. Ho H.Y. Kirschner M.W. Mayer B.J. J. Biol. Chem. 2001; 276: 26448-26452Abstract Full Text Full Text PDF PubMed Scopus (328) Google Scholar, 32Miki H. Miura K. Takenawa T. EMBO J. 1996; 15: 5326-5335Crossref PubMed Scopus (556) Google Scholar). Localized accumulation of the Nck SH3 domains induces actin polymerization dependent on N-WASP (33Rivera G.M. Briceno C.A. Takeshima F. Snapper S.B. Mayer B.J. Curr. Biol. 2004; 14: 11-22Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar). Furthermore, both Ncks and Grb2 were shown to contribute to the recruitment of N-WASP in vaccinia-induced and phosphatidylinositol 4,5-biphosphate-induced motility (25Scaplehorn N. Holmstrom A. Moreau V. Frischknecht F. Reckmann I. Way M. Curr. Biol. 2002; 12: 740-745Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar, 34Moreau V. Frischknecht F. Reckmann I. Vincentelli R. Rabut G. Stewart D. Way M. Nat. Cell Biol. 2000; 2: 441-448Crossref PubMed Scopus (275) Google Scholar, 35Benesch S. Lommel S. Steffen A. Stradal T.E. Scaplehorn N. Way M. Wehland J. Rottner K. J. Biol. Chem. 2002; 277: 37771-37776Abstract Full Text Full Text PDF PubMed Scopus (124) Google Scholar). We find that N-WASP recruitment to the bead site is decreased after removal of either Grb2 or Nck2, indicating that both Grb2 and Nck2 are required for the proper localization of N-WASP in the EGF-bead response. Both Grb2 and Nck2 bind the polyproline region of N-WASP (26Takenawa T. Miki H. J. Cell Sci. 2001; 114: 1801-1809Crossref PubMed Google Scholar), possibly at different sites; however, in vitro studies of Grb2 and Nck1 used in combination did not show synergistic activation of N-WASP-induced Arp2/3 dependent actin polymerization (14Rohatgi R. Ma L. Miki H. Lopez M. Kirchhausen T. Takenawa T. Kirschner M.W. Cell. 1999; 97: 221-231Abstract Full Text Full Text PDF PubMed Scopus (1082) Google Scholar). In our studies, Nck1 did not mediate activation of N-WASP, raising the possibility that the mechanism of Nck2 activation of N-WASP may differ from that of Nck1. Because Grb2 and Nck2 bind to the activated EGF receptor at different locations (31McCarty J.H. BioEssays. 1998; 20: 913-921Crossref PubMed Scopus (80) Google Scholar), the receptor may orient these molecules so they synergize to localize and activate N-WASP in vivo. Alternatively, Grb2 and/or Nck2 may interact with additional proteins, such as Toca-1 (transducer of Cdc42-dependent actin assembly) (36Ho H.Y. Rohatgi R. Lebensohn A.M. Le M. Li J. Gygi S.P. Kirschner M.W. Cell. 2004; 118: 203-216Abstract Full Text Full Text PDF PubMed Scopus (353) Google Scholar), or WIP (34Moreau V. Frischknecht F. Reckmann I. Vincentelli R. Rabut G. Stewart D. Way M. Nat. Cell Biol. 2000; 2: 441-448Crossref PubMed Scopus (275) Google Scholar, 36Ho H.Y. Rohatgi R. Lebensohn A.M. Le M. Li J. Gygi S.P. Kirschner M.W. Cell. 2004; 118: 203-216Abstract Full Text Full Text PDF PubMed Scopus (353) Google Scholar, 37Martinez-Quiles N. Rohatgi R. Anton I.M. Medina M. Saville S.P. Miki H. Yamaguchi H. Takenawa T. Hartwig J.H. Geha R.S. Ramesh N. Nat. Cell Biol. 2001; 3: 484-491Crossref PubMed Scopus (227) Google Scholar). As part of our study of Arp2/3 activators, we also examined the role of cortactin in the EGF-bead response. It was surprising to see an increase in the number of protrusion responses when cortactin was suppressed. However, cortactin can displace N-WASP from the Arp2/3 complex after N-WASP has initiated actin polymerization (20Uruno T. Liu J. Li Y. Smith N. Zhan X. J. Biol. Chem. 2003; 278: 26086-26093Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar). Our immunostaining demonstrated that N-WASP is at the site of EGF receptor activation and cortactin is juxtaposed to N-WASP, similar to what has been reported for vaccinia virus (28Frischknecht F. Way M. Trends Cell Biol. 2001; 11: 30-38Abstract Full Text Full Text PDF PubMed Scopus (182) Google Scholar) and Shigella-stimulated (20Uruno T. Liu J. Li Y. Smith N. Zhan X. J. Biol. Chem. 2003; 278: 26086-26093Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar) actin tails. Furthermore, the loss of cortactin resulted in enhanced actin polymerization as shown by increased F-actin staining at the EGF-bead site as well as at lamellipods. This information shows that cortactin can regulate actin polymerization by maintaining N-WASP at sites of actin polymerization and limiting its localization. Cortactin may have similar effects on WAVEs, which have a VCA homology sequence terminal sequence similar to N-WASP (26Takenawa T. Miki H. J. Cell Sci. 2001; 114: 1801-1809Crossref PubMed Google Scholar) and have been shown to be required for lamellipod protrusions (38Suetsugu S. Yamazaki D. Kurisu S. Takenawa T. Dev. Cell. 2003; 5: 595-609Abstract Full Text Full Text PDF PubMed Scopus (267) Google Scholar). Cortactin has also been implicated in stabilizing actin branches (19Weaver A.M. Karginov A.V. Kinley A.W. Weed S.A. Li Y. Parsons J.T. Cooper J.A. Curr. Biol. 2001; 11: 370-374Abstract Full Text Full Text PDF PubMed Scopus (473) Google Scholar). The Triton permeabilization assay showed reduced F-actin staining in cortactin siRNA-treated cells, demonstrating that cortactin can contribute to the stability of F-actin induced in the EGF-bead response. Our data are consistent with a model in which cortactin can displace N-WASP from the Arp2/3 complex (20Uruno T. Liu J. Li Y. Smith N. Zhan X. J. Biol. Chem. 2003; 278: 26086-26093Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar, 39Martinez-Quiles N. Ho H.Y. Kirschner M.W. Ramesh N. Geha R.S. Mol. Cell. Biol. 2004; 24: 5269-5280Crossref PubMed Scopus (239) Google Scholar) and stabilize newly formed actin branches (19Weaver A.M. Karginov A.V. Kinley A.W. Weed S.A. Li Y. Parsons J.T. Cooper J.A. Curr. Biol. 2001; 11: 370-374Abstract Full Text Full Text PDF PubMed Scopus (473) Google Scholar). Under other conditions, such as during contact-stimulated spreading and adhesion (40Kinley A.W. Weed S.A. Weaver A.M. Karginov A.V. Bissonette E. Cooper J.A. Parsons J.T. Curr. Biol. 2003; 13: 384-393Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar, 41Helwani F.M. Kovacs E.M. Paterson A.D. Verma S. Ali R.G. Fanning A.S. Weed S.A. Yap A.S. J. Cell Biol. 2004; 164: 899-910Crossref PubMed Scopus (148) Google Scholar), cortactin may also stimulate (or regulate) actin polymerization. In summary, we have mapped out an actin polymerization pathway from the receptor to output by observing the EGF-bead response. Grb2 and Nck2 can bind the activated receptor and then recruit/activate N-WASP to the EGF-bead site. This simple pathway differs from the main pathway of N-WASP activation triggered by soluble EGF and may reflect the effect of restraining EGF receptors by binding them to immobilized ligands. Such responses may occur in vivo in the presence of ligands bound to extracellular matrix elements. We thank Drs. Tadaomi Takenawa, Xi Zhan, Roger Daly, and Tony Pawson for antibodies and cDNA constructs, the Analytical Imaging Facility for microscopy, and the Condeelis, Segall, Cox, and Backer laboratories for resources and advice. We thank Dr. Scott Weed for discussions about cortactin. Download .zip (10.76 MB) Help with zip files" @default.
• W2033679307 created "2016-06-24" @default.
• W2033679307 creator A5003421949 @default.
• W2033679307 creator A5005071379 @default.
• W2033679307 creator A5014100567 @default.
• W2033679307 creator A5039399300 @default.
• W2033679307 creator A5043301950 @default.
• W2033679307 creator A5057743188 @default.
• W2033679307 creator A5074449595 @default.
• W2033679307 creator A5075971611 @default.
• W2033679307 creator A5090946299 @default.
• W2033679307 creator A5091538279 @default.
• W2033679307 date "2005-02-01" @default.
• W2033679307 modified "2023-09-29" @default.
• W2033679307 title "A Neural Wiskott-Aldrich Syndrome Protein-mediated Pathway for Localized Activation of Actin Polymerization That Is Regulated by Cortactin" @default.
• W2033679307 cites W1507572058 @default.
• W2033679307 cites W1509485250 @default.
• W2033679307 cites W1519901358 @default.
• W2033679307 cites W1524954611 @default.
• W2033679307 cites W1575892864 @default.
• W2033679307 cites W1960862471 @default.
• W2033679307 cites W1984473379 @default.
• W2033679307 cites W1989686043 @default.
• W2033679307 cites W1999816397 @default.
• W2033679307 cites W2003008393 @default.
• W2033679307 cites W2004979362 @default.
• W2033679307 cites W2009532293 @default.
• W2033679307 cites W2032050847 @default.
• W2033679307 cites W2033989449 @default.
• W2033679307 cites W2039325880 @default.
• W2033679307 cites W2042324409 @default.
• W2033679307 cites W2044084413 @default.
• W2033679307 cites W2046643533 @default.
• W2033679307 cites W2053507081 @default.
• W2033679307 cites W2064406341 @default.
• W2033679307 cites W2064523806 @default.
• W2033679307 cites W2066108081 @default.
• W2033679307 cites W2071102056 @default.
• W2033679307 cites W2075188939 @default.
• W2033679307 cites W2075805773 @default.
• W2033679307 cites W2079944376 @default.
• W2033679307 cites W2089472706 @default.
• W2033679307 cites W2107625881 @default.
• W2033679307 cites W2110726109 @default.
• W2033679307 cites W2125753995 @default.
• W2033679307 cites W2126496496 @default.
• W2033679307 cites W2131943106 @default.
• W2033679307 cites W2136184845 @default.
• W2033679307 cites W2139130671 @default.
• W2033679307 cites W2151397718 @default.
• W2033679307 cites W2167146326 @default.
• W2033679307 cites W2168586729 @default.
• W2033679307 cites W2170996392 @default.
• W2033679307 cites W2172048983 @default.
• W2033679307 cites W2324328780 @default.
• W2033679307 doi "https://doi.org/10.1074/jbc.m410713200" @default.
• W2033679307 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15579908" @default.
• W2033679307 hasPublicationYear "2005" @default.
• W2033679307 type Work @default.
• W2033679307 sameAs 2033679307 @default.
• W2033679307 citedByCount "60" @default.
• W2033679307 countsByYear W20336793072013 @default.
• W2033679307 countsByYear W20336793072014 @default.
• W2033679307 countsByYear W20336793072015 @default.
• W2033679307 countsByYear W20336793072016 @default.
• W2033679307 countsByYear W20336793072017 @default.
• W2033679307 countsByYear W20336793072018 @default.
• W2033679307 countsByYear W20336793072019 @default.
• W2033679307 countsByYear W20336793072020 @default.
• W2033679307 crossrefType "journal-article" @default.
• W2033679307 hasAuthorship W2033679307A5003421949 @default.
• W2033679307 hasAuthorship W2033679307A5005071379 @default.
• W2033679307 hasAuthorship W2033679307A5014100567 @default.
• W2033679307 hasAuthorship W2033679307A5039399300 @default.
• W2033679307 hasAuthorship W2033679307A5043301950 @default.
• W2033679307 hasAuthorship W2033679307A5057743188 @default.
• W2033679307 hasAuthorship W2033679307A5074449595 @default.
• W2033679307 hasAuthorship W2033679307A5075971611 @default.
• W2033679307 hasAuthorship W2033679307A5090946299 @default.
• W2033679307 hasAuthorship W2033679307A5091538279 @default.
• W2033679307 hasBestOaLocation W20336793071 @default.
• W2033679307 hasConcept C104317684 @default.
• W2033679307 hasConcept C125705527 @default.
• W2033679307 hasConcept C142669718 @default.
• W2033679307 hasConcept C1491633281 @default.
• W2033679307 hasConcept C178790620 @default.
• W2033679307 hasConcept C185592680 @default.
• W2033679307 hasConcept C2776000893 @default.
• W2033679307 hasConcept C2778153459 @default.
• W2033679307 hasConcept C2780939953 @default.
• W2033679307 hasConcept C2993400109 @default.
• W2033679307 hasConcept C44228677 @default.
• W2033679307 hasConcept C521977710 @default.
• W2033679307 hasConcept C55493867 @default.
• W2033679307 hasConcept C86803240 @default.
• W2033679307 hasConcept C95444343 @default.
• W2033679307 hasConceptScore W2033679307C104317684 @default.
• W2033679307 hasConceptScore W2033679307C125705527 @default.

• next