FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2034003930> ?p ?o ?g. }

• W2034003930 endingPage "30359" @default.
• W2034003930 startingPage "30352" @default.
• W2034003930 abstract "We investigated the interaction dynamics of human abasic endonuclease, the Ape1 protein (also called Ref1, Hap1, or Apex), with its DNA substrate and incised product using electrophoretic assays and site-specific amino acid substitutions. Changing aspartate 283 to alanine (D283A) left 10% residual activity, contrary to a previous report, but complementation of repair-deficient bacteria by the D283A Ape1 protein was consistent with its activity in vitro. The D308A, D283/D308A double mutant, and histidine 309 to asparagine proteins had 22, 1, and ∼0.02% of wild-type Ape1 activity, respectively. Despite this range of enzymatic activities, all the mutant proteins had near-wild-type binding affinity specific for DNA containing a synthetic abasic site. Thus, substrate recognition and cleavage are genetically separable steps. Both the wild-type and mutant Ape1 proteins bound strongly to the enzyme incision product, an incised abasic site, which suggested that Ape1 might exhibit product inhibition. The use of human DNA polymerase β to increase Ape1 activity by eliminating the incision product supports this conclusion. Notably, the complexes of the D283A, D308A, and D283A/D308A double mutant proteins with both intact and incised abasic DNA were significantly more stable than complexes containing wild-type Ape1, which may contribute to the lower turnover numbers of the mutant enzymes. Wild-type Ape1 protein bound tightly to DNA containing a one-nucleotide gap but not to DNA with a nick, consistent with the proposal that substrate recognition by Ape1 involves a space bracketed by duplex DNA, rather than mere flexibility of the DNA. We investigated the interaction dynamics of human abasic endonuclease, the Ape1 protein (also called Ref1, Hap1, or Apex), with its DNA substrate and incised product using electrophoretic assays and site-specific amino acid substitutions. Changing aspartate 283 to alanine (D283A) left 10% residual activity, contrary to a previous report, but complementation of repair-deficient bacteria by the D283A Ape1 protein was consistent with its activity in vitro. The D308A, D283/D308A double mutant, and histidine 309 to asparagine proteins had 22, 1, and ∼0.02% of wild-type Ape1 activity, respectively. Despite this range of enzymatic activities, all the mutant proteins had near-wild-type binding affinity specific for DNA containing a synthetic abasic site. Thus, substrate recognition and cleavage are genetically separable steps. Both the wild-type and mutant Ape1 proteins bound strongly to the enzyme incision product, an incised abasic site, which suggested that Ape1 might exhibit product inhibition. The use of human DNA polymerase β to increase Ape1 activity by eliminating the incision product supports this conclusion. Notably, the complexes of the D283A, D308A, and D283A/D308A double mutant proteins with both intact and incised abasic DNA were significantly more stable than complexes containing wild-type Ape1, which may contribute to the lower turnover numbers of the mutant enzymes. Wild-type Ape1 protein bound tightly to DNA containing a one-nucleotide gap but not to DNA with a nick, consistent with the proposal that substrate recognition by Ape1 involves a space bracketed by duplex DNA, rather than mere flexibility of the DNA. apurinic/apyrimidinic tetrahydrofuran 51-mer double-strand DNA containing a tetrahydrofuran residue at position 22 electrophoretic-mobility-shift assay DNA polymerase β polymerase chain reaction methyl methanesulfonate bovine serum albumin polyacrylamide gel electrophoresis. Base excision repair (1Seeberg E. Eide L. Bjorås M. Trends Biochem. Sci. 1995; 20: 391-397Abstract Full Text PDF PubMed Scopus (472) Google Scholar, 2Wilson S.H. Mutat. Res. 1998; 407: 203-215Crossref PubMed Scopus (265) Google Scholar) is a multistep process that corrects a diverse array of spontaneous and mutagen-induced DNA lesions. The process can be initiated by DNA glycosylases, which excise damaged bases to create apurinic/apyrimidinic (AP)1 sites. Modified abasic sites can arise directly from oxidative DNA-damaging agents, such as ionizing radiation (3von Sonntag C. The Chemical Basis of Radiation Biology. Taylor and Francis, London1987Google Scholar). The AP and modified abasic sites are substrates for class II AP endonucleases, which cleave the 5′ phosphodiester of both regular (hydrolytic) AP sites (4Demple B. Harrison L. Annu. Rev. Biochem. 1994; 63: 915-948Crossref PubMed Scopus (1300) Google Scholar) and oxidized abasic residues (5Xu, Y.-J., Kim, E. Y., and Demple, B. (1998) J. Biol. Chem. 273, in pressGoogle Scholar). Excision of the lesion, DNA repair synthesis, and ligation complete the process (1Seeberg E. Eide L. Bjorås M. Trends Biochem. Sci. 1995; 20: 391-397Abstract Full Text PDF PubMed Scopus (472) Google Scholar, 2Wilson S.H. Mutat. Res. 1998; 407: 203-215Crossref PubMed Scopus (265) Google Scholar). Ape1 protein is quantitatively the main AP endonuclease of human cells (6Chen D.S. Herman T. Demple B. Nucleic Acids Res. 1991; 19: 5907-5914Crossref PubMed Scopus (230) Google Scholar, 7Demple B. Herman T. Chen D.S. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 11450-11454Crossref PubMed Scopus (478) Google Scholar). This DNA repair protein was independently named Hap1 (8Robson C.N. Hickson I.D. Nucleic Acids Res. 1991; 19: 5519-5523Crossref PubMed Scopus (293) Google Scholar) and Apex (9Seki S. Hatsushika M. Watanabe S. Akiyama K. Nagao K. Tsutsui K. Biochim. Biophys. Acta. 1992; 1131: 287-299Crossref PubMed Scopus (112) Google Scholar), and as an in vitro activator of DNA binding activity for some oxidized transcription factors, it was also named Ref1 (10Xanthoudakis S. Miao G.G. Curran T. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 23-27Crossref PubMed Scopus (320) Google Scholar, 11Xanthoudakis S. Miao G. Wang F. Pan Y.C. Curran T. EMBO J. 1992; 11: 3323-3335Crossref PubMed Scopus (826) Google Scholar, 12Walker L.J. Robson C.N. Black E. Gillespie D. Hickson I.D. Mol. Cell. Biol. 1993; 13: 5370-5376Crossref PubMed Scopus (264) Google Scholar). Ape1 protein can be separated into two functionally distinct regions, with the N-terminal domain possessing the Ref1 redox activity (10Xanthoudakis S. Miao G.G. Curran T. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 23-27Crossref PubMed Scopus (320) Google Scholar, 12Walker L.J. Robson C.N. Black E. Gillespie D. Hickson I.D. Mol. Cell. Biol. 1993; 13: 5370-5376Crossref PubMed Scopus (264) Google Scholar) and the C-terminal domain contains the AP endonuclease activity within a 280-residue polypeptide sequence (10Xanthoudakis S. Miao G.G. Curran T. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 23-27Crossref PubMed Scopus (320) Google Scholar,12Walker L.J. Robson C.N. Black E. Gillespie D. Hickson I.D. Mol. Cell. Biol. 1993; 13: 5370-5376Crossref PubMed Scopus (264) Google Scholar, 13Izumi T. Mitra S. Carcinogenesis. 1998; 19: 525-527Crossref PubMed Scopus (84) Google Scholar) homologous to exonuclease III of Escherichia coli(27% identity), the ExoA protein of Streptococcus pneumoniae (39% identity), the Rrp1 protein of Drosophila melanogaster (50% identity), and the Arp protein of Arabidopsis thaliana (57% identity) (4Demple B. Harrison L. Annu. Rev. Biochem. 1994; 63: 915-948Crossref PubMed Scopus (1300) Google Scholar, 14Barzilay G. Hickson I.D. BioEssays. 1995; 17: 713-719Crossref PubMed Scopus (198) Google Scholar). The proteins of the Ape1/exonuclease III family exhibit a range of enzymatic activities on duplex DNA. Along with the class II AP endonuclease activity, exonuclease III possesses duplex-specific 3′-5′ exonuclease activity, 3′-repair phosphodiesterase activity, 3′-phosphatase activity, and RNase H activity (15Richardson C. Kornberg A. J. Biol. Chem. 1964; 239: 242-250Abstract Full Text PDF PubMed Google Scholar, 16Richardson C. Lehman I. Kornberg A. J. Biol. Chem. 1964; 239: 251-258Abstract Full Text PDF PubMed Google Scholar, 17Demple B. Johnson A. Fung D. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 7731-7735Crossref PubMed Scopus (200) Google Scholar, 18Bernelot-Moens C. Demple B. Nucleic Acids Res. 1989; 17: 587-600Crossref PubMed Scopus (27) Google Scholar). Ape1 protein also has these multiple activities, but with 3′-repair diesterase, 3′-phosphatase, RNase H, and exonuclease activities 100–10,000-fold lower than its AP endonuclease activity (4Demple B. Harrison L. Annu. Rev. Biochem. 1994; 63: 915-948Crossref PubMed Scopus (1300) Google Scholar, 19Wilson III, D.M. Takeshita M. Grollman A.P. Demple B. J. Biol. Chem. 1995; 270: 16002-16007Abstract Full Text Full Text PDF PubMed Scopus (245) Google Scholar, 20Barzilay G. Walker L.J. Robson C.N. Hickson I.D. Nucleic Acids Res. 1995; 23: 1544-1550Crossref PubMed Scopus (108) Google Scholar, 21Suh D. Wilson III, D.M. Povirk L.F. Nucleic Acids Res. 1997; 25: 2495-2500Crossref PubMed Scopus (150) Google Scholar). The presence of multiple catalytic functions for exonuclease III, a relatively small (M r ∼30,000), monomeric protein suggested that a single active site catalyzes all the enzymatic reactions (22Weiss B. J. Biol. Chem. 1976; 251: 1896-1901Abstract Full Text PDF PubMed Google Scholar). In that model, distinct recognition elements in the protein were proposed to interact with duplex DNA 5′ to the target site, and a “space” in the DNA duplex caused by a missing base or frayed 3′-end. The crystal structure of exonuclease III has been solved, and a catalytic mechanism was proposed involving a single active site (23Mol C.D. Kuo C.F. Thayer M.M. Cunningham R.P. Tainer J.A. Nature. 1995; 374: 381-386Crossref PubMed Scopus (343) Google Scholar). The recently proposed crystal structure of Ape1/Hap1 protein (24Gorman M.A. Morera S. Rothwell D.G. de La Fortelle E. Mol C.D. Tainer J.A. Hickson I.D. Freemont P.S. EMBO J. 1997; 16: 6548-6558Crossref PubMed Scopus (289) Google Scholar) prompted an essentially identical proposal that involves a single active site for this enzyme. Both models involve amino acid residues that are conserved in the Ape1/exonuclease III family, and the properties of some site-specific mutant Ape1 proteins are consistent with the proposal (25Barzilay G. Mol C.D. Robson C.N. Walker L.J. Cunningham R.P. Tainer J.A. Hickson I.D. Nat. Struct. Biol. 1995; 2: 561-568Crossref PubMed Scopus (121) Google Scholar, 26Rothwell D.G. Hickson I.D. Nucleic Acids Res. 1996; 24: 4217-4221Crossref PubMed Scopus (40) Google Scholar). In a reverse approach, Gu et al.(27Gu L. Huang S.M. Sander M. J. Biol. Chem. 1994; 269: 32685-32692Abstract Full Text PDF PubMed Google Scholar) used an in vivo complementation assay to isolate mutants of the Drosophila Rrp1 protein with altered repair capacity or specificity. Some of the alterations in these proteins were mapped to conserved residues that do not correspond to functional residues proposed for exonuclease III or Ape1. One of the Rrp1 mutant proteins had diminished 3′-repair diesterase activity but normal AP endonuclease activity. Thus, either these proteins have more than one active site, or substrate specificity can be modulated independently of the catalytic activity. We have previously addressed the mechanism of substrate recognition by Ape1 protein using electrophoretic mobility shift assay (EMSA) and footprinting methods (28Wilson III, D.M. Takeshita M. Demple B. Nucleic Acids Res. 1997; 25: 933-939Crossref PubMed Scopus (84) Google Scholar). Those studies showed that Ape1 binds specifically around the abasic site in DNA and causes a pronounced distortion at the abasic site in a preincision complex (19Wilson III, D.M. Takeshita M. Grollman A.P. Demple B. J. Biol. Chem. 1995; 270: 16002-16007Abstract Full Text Full Text PDF PubMed Scopus (245) Google Scholar). However, the EMSA conditions and those of others (26Rothwell D.G. Hickson I.D. Nucleic Acids Res. 1996; 24: 4217-4221Crossref PubMed Scopus (40) Google Scholar, 29Strauss P.R. Beard W.A. Patterson T.A. Wilson S.H. J. Biol. Chem. 1997; 272: 1302-1307Abstract Full Text Full Text PDF PubMed Scopus (141) Google Scholar) were not suitable for biochemical characterization, because the protein-DNA complexes were relatively unstable. Here we report improved conditions for EMSA and use the assay to monitor Ape1 binding and dissociation from an abasic substrate and the incised product. We have examined the interactions for several site-specific mutant forms of Ape1. We show here that Ape1 has a high affinity to the incised product DNA and to DNA with a one-nucleotide gap, and the several mutations that affect the catalytic activity to different degrees do not significantly affect abasic site recognition but do affect the dynamics of the protein-DNA interaction. For plasmid construction, strain DH5α (endA1 hsdR17 (r K − m K + ) supE44 thi-1 recA1 gyrA (NalR) relA1Δ(lacZYA-argF)U169 deoR(φ80dlacΔ(lacZ)M15)) was used (30Woodcock D.M. Crowther P.J. Doherty J. Jefferson S. DeCruz E. Noyer-Weidner M. Smith S.S. Michael M.Z. Graham M.W. Nucleic Acids Res. 1989; 17: 3469-3478Crossref PubMed Scopus (640) Google Scholar). Strain BW528 (Δxth nfo::kan) (31Cunningham R.P. Saporito S.M. Spitzer S.G. Weiss B. J. Bacteriol. 1986; 168: 1120-1127Crossref PubMed Google Scholar) was obtained originally from Dr. Bernard Weiss (University of Michigan Medical School). For overproduction of human Ape1 and human DNA polymerase β (Polβ) proteins, strain BL21 (DE3) (ompT lon hsdR (rB–mB–)) was used (32Studier F.W. Rosenberg A.H. Dunn J.J. Dubendorff J.W. Methods Enzymol. 1990; 185: 60-89Crossref PubMed Scopus (6006) Google Scholar). The Ape1 expression plasmid, pXC53, was obtained from DuPont Merck Pharmaceutical Co., and the expression plasmid for human Polβ was a generous gift of Dr. Stuart Linn (University of California, Berkeley, CA) “DeepVent” DNA polymerase (New England Biolabs, Beverly, MA) was used in the polymerase chain reaction (PCR) to generate site-specific mutations in APE1 cDNA. In the final expression constructs, any DNA products that resulted from PCRs were sequenced to verify that only the desired mutation had been introduced. Using plasmid pCW26 (7Demple B. Herman T. Chen D.S. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 11450-11454Crossref PubMed Scopus (478) Google Scholar) as the template DNA, the 5′-portion of the APE1 gene was amplified with T3 (ATTAACCCTCACTAAAG) and D308A(–) primers (TAGGACAGTGAGCACTCGCGA). Likewise, the 3′-portion of the gene was amplified with T7 (AATACGACTCACTATAG) and D308A primer (TCGCGAGTGCTCACTGTCCTA) in a separate reaction. The reaction products were then isolated, mixed together, and PCR-amplified with the T7 and T3 primers to generate a complete APE1 cDNA with the desired site-specific mutation. The final PCR product was cut withEcoRI and subcloned into Bluescript KS (Stratagene, La Jolla, CA) at the EcoRI site. Note that the sequence of D308A primer had been designed to change two amino acid residues, although the final plasmid had in fact only one mutation, D308A. Mutagenesis was exactly as for D308A, except that the H309N (CGGCAGTGATAACTGTCCTAT) or D283A (GTTGGTTGGCGCCTTGCTTAC) primer and the H309N(–) (ATAGGACAGTTATCACTGCCG) or D283A(–) (GTAAGCAAGGCGCCAACCAAC) primer were used to mutate the gene. The intermediate PCR products were amplified with hAPE15NcoI (CAGCTGCCATGGGGTTCG) and hAPE13HindIII (TCTCTGAAGCTTGTTTAAAG) primers to generate the entire gene with the desired site-specific mutation. The final PCR product was cut with NcoI and HindIII and subcloned into NcoI/HindIII-digested pSE380 (Invitrogen, Carlsbad, CA). The technique described for generating the D308A substitution was used to construct this double mutant, except that the template DNA for the PCR was the single mutant D283A in pSE380. The primers D308A and D308A(–) were used to create the second site-specific mutation. To construct expression plasmids for the mutant portion, the 238-base pair PstI-HindIII fragment encompassing the 3′-portion of APE1 cDNA from pXC53 was replaced with the corresponding PstI-HindIII fragment from the mutagenized plasmids. For in vivo complementation tests, aXbaI-HindIII fragment containing the entireAPE1 DNA from pXC53 or its derivatives was inserted downstream of the arabinose-regulated promoter of pBAD22A (obtained from The Cloning Vector Collection of the National Institute of Genetics, Shizuoka, Japan). Strain BW528 was transformed by pBAD22A or the derivatives carrying the wild-type or mutant APE1 gene. The resulting strains were tested for their ability to form single colonies by streak-dilution on LB agar plates (33Miller J. A Short Course in Bacterial Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1992Google Scholar) containing 0.025% methyl methanesulfonate (MMS) and 0.2% l-arabinose. The colony-forming ability was checked after incubation for 24 h at 37 °C. Poly[d(A-T)] containing [α-32P,uracil-3H]dUMP at a frequency of one per 500 nucleotides was synthesized as described by Levin and Demple (34Levin J.D. Demple B. Nucleic Acids Res. 1990; 18: 5069-5075Crossref PubMed Scopus (68) Google Scholar), except that the [α-32P]dUTP was prepared from labeled dCTP (Andotek, Irvine, CA) by deamination with dCTP deaminase (35Wang L. Weiss B. J. Bacteriol. 1992; 174: 5647-5653Crossref PubMed Google Scholar) (kindly provided by Dr. Bernard Weiss, University of Michigan Medical School). After the reaction, more than 95% of dCTP had been converted to dUTP, as determined using thin layer chromatography on polyethyleneimine cellulose (36Shlomai J. Kornberg A. J. Biol. Chem. 1978; 253: 3305-3312Abstract Full Text PDF PubMed Google Scholar). A 51-mer synthetic oligonucleotide (37Singhal R.K. Prasad R. Wilson S.H. J. Biol. Chem. 1995; 270: 949-957Abstract Full Text Full Text PDF PubMed Scopus (294) Google Scholar) containing a tetrahydrofuran residue (51F), a uracil (51U), or a cytosine at position 22 (51C) and the related oligonucleotides (see Fig. 6 A) were purchased from Operon Technologies Inc. (Alameda, CA). The concentration of high pressure liquid chromatography-purified oligonucleotides was determined by measuring absorbance at 260 nm (38Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). To generate a double-stranded substrate, 100 pmol of oligonucleotide was 5′-end-labeled with [γ-32P]ATP using T4 polynucleotide kinase (New England Biolabs, Beverly, MA) and then annealed to the complementary oligonucleotide (see Fig. 6 A). After precipitation with ethanol, the amount of DNA recovered was determined by monitoring the recovered radioactivity. To prepare incised 51F, the double-stranded oligonucleotide (100 pmol) was treated with 12.5 pmol of Ape1 in a 100-μl reaction (50 mm Tris-HCl (pH 8.4), 10 mm MgCl2, and 0.2 mg/ml BSA) at 37 °C for 10 min. The reaction was stopped by adding 5 μl of 0.5 m EDTA. After the reaction, 98% of substrate had been converted to the incised form (data not shown). The DNA was sequentially extracted with phenol-chloroform and chloroform and then precipitated with ethanol. A substrate with a single AP site was prepared according to Bennettet al. (39Bennett R.A.O. Wilson III, D.M. Wong D. Demple B. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 7166-7169Crossref PubMed Scopus (327) Google Scholar), except that the Ape1 reaction buffer was used (50 mm HEPES-KOH (pH 7.5), 50 mm KCl, 0.1 mg/ml BSA, 10 mm MgCl2, and 0.05% Triton X-100). After treatment with recombinant E. coli uracil-DNA glycosylase (a generous gift of Dr. Dale Mosbaugh, Oregon State University), the reaction mixture was used directly for incision assays. To purify the recombinant Ape1 proteins, expression was accomplished by addition of isopropyl β-d-thiogalactopyranoside when the bacterial cultures had reached an absorbance at 600 nm to 0.5, and the incubation was continued for 90 min according to Marians (40Marians K.J. Methods Enzymol. 1995; 262: 507-521Crossref PubMed Scopus (54) Google Scholar). Cell lysates (fraction I) were prepared as described by Hupp and Kaguni (41Hupp T.R. Kaguni J.M. J. Biol. Chem. 1993; 268: 13128-13136Abstract Full Text PDF PubMed Google Scholar). The cell lysate was fractionated at a 55% saturation of ammonium sulfate, and the remaining soluble proteins were then precipitated at 80% saturation of ammonium sulfate. The proteins were resuspended in Buffer A (50 mm HEPES-KOH (pH 7.5), 1 mm EDTA, 0.1 mm dithiothreitol, 10% (v/v) glycerol) containing 100 mm KCl and dialyzed against the same buffer (fraction II). Fraction II was applied to a 20-ml phosphocellulose (Whatman P11) column and then eluted with a linear gradient of 100–750 mm KCl in Buffer A. The peak fractions containing Ape1 were pooled and dialyzed against Buffer A containing 100 mm KCl, (fraction III). Fraction III was applied to a MonoS 5/5 column (Amersham Pharmacia Biotech) and then eluted with a linear gradient of 100–250 mm KCl in Buffer A. The peak fractions containing Ape1 were pooled and concentrated by dialysis against Buffer A containing 200 mm KCl and 20% polyethylene glycol (average molecular weight, 8000) (fraction IV). Fraction IV was applied to a Superose-12 column (Amersham Pharmacia Biotech), which yielded a first, symmetrical peak corresponding to Ape1 protein and the AP endonuclease activity, and a second peak corresponding to residual lysozyme from the cell lysis procedure (41Hupp T.R. Kaguni J.M. J. Biol. Chem. 1993; 268: 13128-13136Abstract Full Text PDF PubMed Google Scholar). For Polβ purification, expression of the protein and preparation of lysate (fraction I) were performed basically the same as for Ape1 purification. After dialysis against Buffer B (50 mmTris-HCl (pH 8.0), 1 mm EDTA, 0.1 mmdithiothreitol, and 10% (v/v) glycerol) containing 100 mmKCl, fraction I was applied to a 60-ml phosphocellulose (Whatman P11) column and then eluted with a linear gradient of 100–800 mm KCl in Buffer B. The peak fractions containing active Polβ were pooled and dialyzed against Buffer B containing 100 mm KCl, (fraction II). Fraction II was applied to a 1-ml heparin column (Amersham Pharmacia Biotech) and eluted with a linear gradient of 50–750 mm KCl in Buffer B. Fractions containing active Polβ were pooled. Analysis of these fractions by SDS-PAGE indicated that they contained only a single protein detectable by silver staining (data not shown). Protein concentrations were determined by the Bio-Rad protein assay (Bio-Rad), based on the method of Bradford (42Bradford M.M. Anal. Biochem. 1976; 72: 248-254Crossref PubMed Scopus (217544) Google Scholar), using BSA (Amersham Pharmacia Biotech) as the standard. The following binding methods were adapted from the protocols of Wilson et al. (28Wilson III, D.M. Takeshita M. Demple B. Nucleic Acids Res. 1997; 25: 933-939Crossref PubMed Scopus (84) Google Scholar), Ng and Marians (43Ng J.Y. Marians K.J. J. Biol. Chem. 1996; 271: 15642-15648Abstract Full Text Full Text PDF PubMed Scopus (87) Google Scholar), and Hendrickson and Schleif (44Hendrickson W. Schleif R.F. J. Mol. Biol. 1984; 178: 611-628Crossref PubMed Scopus (100) Google Scholar). Modification of the binding conditions of Wilson et al. (28Wilson III, D.M. Takeshita M. Demple B. Nucleic Acids Res. 1997; 25: 933-939Crossref PubMed Scopus (84) Google Scholar) involved exploring the pH range 7.5–8.8 with different buffers and a range of KCl concentrations up to 50 mm NaCl (data not shown); however, the most important factors in the improved electrophoretic resolution were the reduction of the concentration of EDTA and omission of glycerol from the buffer. For binding measurements, reaction mixtures (10 μl) in 50 mm Tris-HCl (pH 8.4), 1 mm EDTA (pH 8.0), and 0.2 mg/ml BSA containing 51F DNA (1 nm) were mixed with proteins as indicated in the figure legends. The mixtures were incubated on ice for 10 min and loaded on a prerunning 8% polyacrylamide gel (80:1 acrylamide:bisacrylamide). The electrophoresis buffer contained 6 mm Tris-HCl (pH 7.8), 5 mmsodium acetate, and 0.1 mm EDTA (43Ng J.Y. Marians K.J. J. Biol. Chem. 1996; 271: 15642-15648Abstract Full Text Full Text PDF PubMed Scopus (87) Google Scholar), and the gels were subjected to a constant voltage of 8 V/cm applied for 2 h at 4 °C. Following gel electrophoresis, the gels were dried and autoradiographed at –80 °C. The amount of DNA present in each band was quantified using a Molecular Imager system (Bio-Rad). To follow dissociation, binding reaction mixtures (100 μl) containing 1 nm 51F DNA and 7.8 nm Ape1 protein were incubated on ice for 10 min. The subsequent steps were carried out at 0–4 °C using equipment prechilled to 4 °C. At time 0, 10-μl samples were removed, mixed with 1 μl of a 1-μmunlabeled 51F stock, and incubated for various times on ice before being loaded on a prerunning gel to separate free DNA from the Ape1-DNA complexes. To deplete the Ape1 reaction product from the reaction mixture, we used human Polβ and a 51-mer oligonucleotide (100 nm) containing a natural AP site as the substrate. The concentration of proteins used is indicated in the figure legends. After the incision reactions, the AP site was treated with NaBH4 (140 mm) to reduce and stabilize it against spontaneous β-elimination (45Matsumoto Y. Kim K. Science. 1995; 269: 699-702Crossref PubMed Scopus (650) Google Scholar). After inactivation of the enzymes by heating at 80 °C for 1 min, the DNA was analyzed on a 20% polyacrylamide gel containing 8 m urea. The amount of DNA present in each band was quantified using a Molecular Imager system (Bio-Rad). To monitor AP endonuclease activity during purification, poly[d(A-T)] containing [α-32P,uracil-3H]dUMP was used as a substrate. Just before use, the polymer was treated with uracil-DNA glycosylase (kindly provided by Dr. Dale Mosbaugh, Oregon State University) at 37 °C for 1.5 h under standard assay conditions. The AP endonuclease assays contained DNA with 1.8 pmol of AP sites in 25 μl, and the reactions were initiated by addition of an enzyme sample (≤2 μl), followed by incubation at 37 °C for 5 min. The reactions were stopped by addition of 25 μl of stop solution (0.45n NaOH, 25 mm EDTA) and heating for 45 min at 65 °C. The amount of incised AP sites was determined as the acid-soluble, Norit-nonadsorbed radioactivity following treatment at alkaline pH; β-elimination of nonincised AP sites does not liberate the 32P label in Norit-nonadsorbable form (34Levin J.D. Demple B. Nucleic Acids Res. 1990; 18: 5069-5075Crossref PubMed Scopus (68) Google Scholar). One unit of AP endonuclease was defined as the amount of activity that cleaves 1 pmol of AP sites per min. To monitor the Polβ activity during purification, a hairpin-structured oligonucleotide DNA (46Maki H. Kornberg A. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 4389-4392Crossref PubMed Scopus (94) Google Scholar) was used as a substrate. Assays contained 50 pmol of substrate DNA in buffer, 25 μl of 50 mm HEPES-KOH (pH 7.5), 50 mm KCl, 0.1 mg/ml BSA, 10 mm MgCl2, 0.5 mmdithiothreitol, and 100 μm each of [α-32P]dTTP, dGTP, dCTP, and dATP and were initiated by the addition of an enzyme sample (≤2 μl) and incubation at 37 °C for 5 min. The reactions were stopped by addition of 25 μl of 50 mm EDTA, and 5-μl samples were spotted on DE81 paper (Whatman), which was washed three times with 0.5 mNa2HPO4. The amount of incorporated dTMP was determined as the radioactivity retained on the paper (38Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). The site-specifically mutated Ape1 proteins were purified following overexpression in E. coli strain BL21 (DE3). After induction of the D283A and D308A mutant proteins, the crude extracts (fraction I) containing these proteins displayed significantly higher AP endonuclease activity than extracts of the control strain (data not shown), which indicated that both the D283A and D308A proteins retain substantial enzymatic activity. This result seemed to contrast with the data of Barzilayet al. (25Barzilay G. Mol C.D. Robson C.N. Walker L.J. Cunningham R.P. Tainer J.A. Hickson I.D. Nat. Struct. Biol. 1995; 2: 561-568Crossref PubMed Scopus (121) Google Scholar), who reported a D283A mutant protein that had ∼2000-fold reduced activity. Therefore, we purified the mutant proteins very carefully, and both the AP endonuclease activity and the amount of the induced M r 37,000 protein were monitored during all purification steps. In contrast to the above, for the D283A/D308A double-mutant and H309N proteins, no increase was detected in the total AP endonuclease activity in crude extracts of cells after protein induction, even though substantial amounts of the induced recombinant proteins were detected by SDS-PAGE (data not shown). Thus, only the inducedM r 37,000 protein could be monitored during the purification of the D283A/D308A and H309N proteins. In the final step of the H309N purification, the leading edge of a bacterial AP endonuclease peak introduced <5% contaminating activity (data not shown). Analysis of these preparations by SDS-PAGE and staining with Coomassie Brilliant Blue (Fig. 1) or silver (data not shown) indicated that they contained only a single predominant polypeptide (≥95%) with M r ∼37,000 as expected for this protein of 35,500 Da (7Demple B. Herman T. Chen D.S. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 11450-11454Crossref PubMed Scopus (478) Google Scholar). Interestingly, the two proteins containing the D283A mutation migrated slightly faster in the gel. Table I summarizes the enzymatic activity of the purified proteins.Table IAP endonuclease activity of purified wild-type and mutant Ape1 proteinsProteinSpecific activityRelative AP endonuclease activityunits/mg%Wild type900,000≡100D308A200,00022D283A90,00010D283A/D308A90001.0H309N1400.016 Open table" @default.
• W2034003930 created "2016-06-24" @default.
• W2034003930 creator A5023057218 @default.
• W2034003930 creator A5040871390 @default.
• W2034003930 creator A5054706661 @default.
• W2034003930 date "1998-11-01" @default.
• W2034003930 modified "2023-09-29" @default.
• W2034003930 title "Dynamics of the Interaction of Human Apurinic Endonuclease (Ape1) with Its Substrate and Product" @default.
• W2034003930 cites W1497818297 @default.
• W2034003930 cites W1508028184 @default.
• W2034003930 cites W1516502444 @default.
• W2034003930 cites W1553195773 @default.
• W2034003930 cites W1564119816 @default.
• W2034003930 cites W1568904705 @default.
• W2034003930 cites W1873199501 @default.
• W2034003930 cites W1924651386 @default.
• W2034003930 cites W1939685797 @default.
• W2034003930 cites W1949973946 @default.
• W2034003930 cites W1964616976 @default.
• W2034003930 cites W1971040146 @default.
• W2034003930 cites W1972241251 @default.
• W2034003930 cites W1979773241 @default.
• W2034003930 cites W1983700730 @default.
• W2034003930 cites W1984987874 @default.
• W2034003930 cites W1991315224 @default.
• W2034003930 cites W1992767362 @default.
• W2034003930 cites W1994066930 @default.
• W2034003930 cites W1996202279 @default.
• W2034003930 cites W1998564674 @default.
• W2034003930 cites W2000479074 @default.
• W2034003930 cites W2000605935 @default.
• W2034003930 cites W2003567663 @default.
• W2034003930 cites W2004442904 @default.
• W2034003930 cites W2012031105 @default.
• W2034003930 cites W2024122764 @default.
• W2034003930 cites W2025823631 @default.
• W2034003930 cites W202706838 @default.
• W2034003930 cites W2028025897 @default.
• W2034003930 cites W2040825860 @default.
• W2034003930 cites W2042723688 @default.
• W2034003930 cites W2046932795 @default.
• W2034003930 cites W2055952174 @default.
• W2034003930 cites W2059164909 @default.
• W2034003930 cites W2064538331 @default.
• W2034003930 cites W2074964515 @default.
• W2034003930 cites W2077652583 @default.
• W2034003930 cites W2080982746 @default.
• W2034003930 cites W2120993848 @default.
• W2034003930 cites W2141980923 @default.
• W2034003930 cites W2149922717 @default.
• W2034003930 cites W2160046367 @default.
• W2034003930 cites W4293247451 @default.
• W2034003930 cites W88565723 @default.
• W2034003930 doi "https://doi.org/10.1074/jbc.273.46.30352" @default.
• W2034003930 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9804798" @default.
• W2034003930 hasPublicationYear "1998" @default.
• W2034003930 type Work @default.
• W2034003930 sameAs 2034003930 @default.
• W2034003930 citedByCount "107" @default.
• W2034003930 countsByYear W20340039302012 @default.
• W2034003930 countsByYear W20340039302013 @default.
• W2034003930 countsByYear W20340039302014 @default.
• W2034003930 countsByYear W20340039302016 @default.
• W2034003930 countsByYear W20340039302017 @default.
• W2034003930 countsByYear W20340039302018 @default.
• W2034003930 countsByYear W20340039302019 @default.
• W2034003930 countsByYear W20340039302020 @default.
• W2034003930 countsByYear W20340039302022 @default.
• W2034003930 countsByYear W20340039302023 @default.
• W2034003930 crossrefType "journal-article" @default.
• W2034003930 hasAuthorship W2034003930A5023057218 @default.
• W2034003930 hasAuthorship W2034003930A5040871390 @default.
• W2034003930 hasAuthorship W2034003930A5054706661 @default.
• W2034003930 hasBestOaLocation W20340039301 @default.
• W2034003930 hasConcept C121332964 @default.
• W2034003930 hasConcept C12554922 @default.
• W2034003930 hasConcept C145912823 @default.
• W2034003930 hasConcept C150777479 @default.
• W2034003930 hasConcept C181199279 @default.
• W2034003930 hasConcept C185592680 @default.
• W2034003930 hasConcept C18903297 @default.
• W2034003930 hasConcept C24890656 @default.
• W2034003930 hasConcept C2524010 @default.
• W2034003930 hasConcept C2777028655 @default.
• W2034003930 hasConcept C2777289219 @default.
• W2034003930 hasConcept C2994592520 @default.
• W2034003930 hasConcept C33923547 @default.
• W2034003930 hasConcept C552990157 @default.
• W2034003930 hasConcept C55493867 @default.
• W2034003930 hasConcept C86803240 @default.
• W2034003930 hasConcept C90673727 @default.
• W2034003930 hasConceptScore W2034003930C121332964 @default.
• W2034003930 hasConceptScore W2034003930C12554922 @default.
• W2034003930 hasConceptScore W2034003930C145912823 @default.
• W2034003930 hasConceptScore W2034003930C150777479 @default.
• W2034003930 hasConceptScore W2034003930C181199279 @default.
• W2034003930 hasConceptScore W2034003930C185592680 @default.
• W2034003930 hasConceptScore W2034003930C18903297 @default.

• next