FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2034170734> ?p ?o ?g. }

• W2034170734 endingPage "472" @default.
• W2034170734 startingPage "463" @default.
• W2034170734 abstract "Chronic heart failure is associated with an activation of the immune system characterized among other factors by the cardiac synthesis and serum expression of proinflammatory cytokines. There is unequivocal clinical and experimental evidence that the cytokine tumor necrosis factor-α is involved in the development of chronic heart failure, but a putative cardiotoxic potential of the proinflammatory cytokine interferon (IFN)-γ remains primarily unknown. To investigate this issue we analyzed the cardiac phenotype of SAP-IFN-γ transgenic mice, which constitutively express IFN-γ in their livers and hence exhibit high circulating serum levels of this cytokine. SAP-IFN-γ mice spontaneously developed chronic active myocarditis, characterized by the infiltration of not only CD4+ and CD8+ T cells but also Mac2+ (galectin 3+) macrophages and CD11c+ dendritic cells, eventually culminating in cardiomyopathy. Echocardiographic analyses exhibited a left ventricular dilation and impaired systolic function induced by IFN-γ overexpression. IFN-γ-mediated cardiotoxicity was associated with high-level cardiac transcription of the proinflammatory cytokines tumor necrosis factor-α and interleukin-12 and the macrophage-attracting chemokines MCP1 and MIP1-α. Myotoxic IFN-γ effects could not be detected in smooth or striated muscle tissue, suggesting cardiomyocellular specificity of the toxic IFN-γ effect. The precise mechanism of IFN-γ cardiotoxicity remains to be elucidated. Chronic heart failure is associated with an activation of the immune system characterized among other factors by the cardiac synthesis and serum expression of proinflammatory cytokines. There is unequivocal clinical and experimental evidence that the cytokine tumor necrosis factor-α is involved in the development of chronic heart failure, but a putative cardiotoxic potential of the proinflammatory cytokine interferon (IFN)-γ remains primarily unknown. To investigate this issue we analyzed the cardiac phenotype of SAP-IFN-γ transgenic mice, which constitutively express IFN-γ in their livers and hence exhibit high circulating serum levels of this cytokine. SAP-IFN-γ mice spontaneously developed chronic active myocarditis, characterized by the infiltration of not only CD4+ and CD8+ T cells but also Mac2+ (galectin 3+) macrophages and CD11c+ dendritic cells, eventually culminating in cardiomyopathy. Echocardiographic analyses exhibited a left ventricular dilation and impaired systolic function induced by IFN-γ overexpression. IFN-γ-mediated cardiotoxicity was associated with high-level cardiac transcription of the proinflammatory cytokines tumor necrosis factor-α and interleukin-12 and the macrophage-attracting chemokines MCP1 and MIP1-α. Myotoxic IFN-γ effects could not be detected in smooth or striated muscle tissue, suggesting cardiomyocellular specificity of the toxic IFN-γ effect. The precise mechanism of IFN-γ cardiotoxicity remains to be elucidated. Chronic heart failure (CHF) is a consequence of cardiac remodeling processes that can be induced by various types of heart disease1Cohn JN Ferrari R Sharpe N Cardiac remodeling—concepts and clinical implications: a consensus paper from an international forum on cardiac remodeling. Behalf of an International Forum on Cardiac Remodeling.J Am Coll Cardiol. 2000; 35: 569-582Abstract Full Text Full Text PDF PubMed Scopus (1925) Google Scholar such as infections with cardiotrophic microorganisms (certain viruses or parasites), host-versus-graft reactions, toxic agents, or other exogenous noxae. The development of CHF is associated with characteristic activation of the immune system2Devaux B Scholz D Hirche A Klovekorn WP Schaper J Upregulation of cell adhesion molecules and the presence of low grade inflammation in human chronic heart failure.Eur Heart J. 1997; 18: 470-479Crossref PubMed Scopus (235) Google Scholar, 3Paulus WJ Cytokines and heart failure.Heart Fail Monit. 2000; 1: 50-56PubMed Google Scholar, 4Mari D Di Berardino F Cugno M Chronic heart failure and the immune system.Clin Rev Allergy Immunol. 2002; 23: 325-340Crossref PubMed Scopus (27) Google Scholar, 5Torre-Amione G Immune activation in chronic heart failure.Am J Cardiol. 2005; 95: 3C-40CAbstract Full Text Full Text PDF PubMed Scopus (224) Google Scholar; however, the exact mechanisms leading to transition from cardiac disease to heart failure and the precise role of the immune system remain be elucidated in detail. Typical hallmarks for the involvement of immune mechanisms in CHF pathogenesis are the infiltration of the cardiac tissue by leukocytes and the increased cardiac expression of cytokines. In particular, cardiac as well as serum levels of tumor necrosis factor (TNF)-α are significantly elevated in CHF patients suggesting an influence of this proinflammatory cytokine on disease development.6Levine B Kalman J Mayer L Fillit HM Packer M Elevated circulating levels of tumor necrosis factor in severe chronic heart failure.N Engl J Med. 1990; 323: 236-241Crossref PubMed Scopus (2244) Google Scholar, 7Zhao SP Zeng LH Elevated plasma levels of tumor necrosis factor in chronic heart failure with cachexia.Int J Cardiol. 1997; 58: 257-261Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar, 8Rauchhaus M Doehner W Francis DP Davos C Kemp M Liebenthal C Niebauer J Hooper J Volk HD Coats AJ Anker SD Plasma cytokine parameters and mortality in patients with chronic heart failure.Circulation. 2000; 102: 3060-3067Crossref PubMed Scopus (702) Google Scholar, 9Kubota T Miyagishima M Alvarez RJ Kormos R Rosenblum WD Demetris AJ Semigran MJ Dec GW Holubkov R McTiernan CF Mann DL Feldman AM McNamara DM Expression of proinflammatory cytokines in the failing human heart: comparison of recent-onset and end-stage congestive heart failure.J Heart Lung Transplant. 2000; 19: 819-824Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar, 10Cunha-Neto E Dzau VJ Allen PD Stamatiou D Benvenutti L Higuchi ML Koyama NS Silva JS Kalil J Liew CC Cardiac gene expression profiling provides evidence for cytokinopathy as a molecular mechanism in Chagas' disease cardiomyopathy.Am J Pathol. 2005; 167: 305-313Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar The cardiotoxic properties of TNF-α are furthermore supported by a characteristic phenotype of TNF-α-overexpressing transgenic mice.11Kubota T McTiernan CF Frye CS Slawson SE Lemster BH Koretsky AP Demetris AJ Feldman AM Dilated cardiomyopathy in transgenic mice with cardiac-specific overexpression of tumor necrosis factor-α.Circ Res. 1997; 81: 627-635Crossref PubMed Google Scholar, 12Bryant D Becker L Richardson J Shelton J Franco F Peshock R Thompson M Giroir B Cardiac failure in transgenic mice with myocardial expression of tumor necrosis factor-α.Circulation. 1998; 97: 1375-1381Crossref PubMed Scopus (545) Google Scholar Interferon (IFN)-γ is another important proinflammatory cytokine with pleiotropic biological effects. Produced by Th1 cells, its most prominent functions are the up-regulation of MHC class I and class II molecules, eventually leading to 1) high-level antigen presentation, 2) suppression of Th2 immune responses, and 3) activation of macrophages.13Strehl B Seifert U Kruger E Heink S Kuckelkorn U Kloetzel PM Interferon-γ, the functional plasticity of the ubiquitin-proteasome system, and MHC class I antigen processing.Immunol Rev. 2005; 207: 19-30Crossref PubMed Scopus (182) Google Scholar, 14Mosmann TR Coffman RL TH1 and TH2 cells: different patterns of lymphokine secretion lead to different functional properties.Annu Rev Immunol. 1989; 7: 145-173Crossref PubMed Scopus (6861) Google Scholar, 15Ma J Chen T Mandelin J Ceponis A Miller NE Hukkanen M Ma GF Konttinen YT Regulation of macrophage activation.Cell Mol Life Sci. 2003; 60: 2334-2346Crossref PubMed Scopus (284) Google Scholar To date, the role of IFN-γ in the development of human CHF has not been investigated. In Chagas' disease, T cells prepared from patients exhibit an increased parasite-specific IFN-γ response, and intensive IFN-γ signaling has been demonstrated in the hearts of these patients.10Cunha-Neto E Dzau VJ Allen PD Stamatiou D Benvenutti L Higuchi ML Koyama NS Silva JS Kalil J Liew CC Cardiac gene expression profiling provides evidence for cytokinopathy as a molecular mechanism in Chagas' disease cardiomyopathy.Am J Pathol. 2005; 167: 305-313Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar, 16Abel LC Rizzo LV Ianni B Albuquerque F Bacal F Carrara D Bocchi EA Teixeira HC Mady C Kalil J Cunha-Neto E Chronic Chagas' disease cardiomyopathy patients display an increased IFN-γ response to Trypanosoma cruzi infection.J Autoimmun. 2001; 17: 99-107Crossref PubMed Scopus (148) Google Scholar It has hence been proposed that IFN-γ contributes to disease progression from acute cardiac Trypanosoma infection to chronic Chagas' cardiomyopathy.10Cunha-Neto E Dzau VJ Allen PD Stamatiou D Benvenutti L Higuchi ML Koyama NS Silva JS Kalil J Liew CC Cardiac gene expression profiling provides evidence for cytokinopathy as a molecular mechanism in Chagas' disease cardiomyopathy.Am J Pathol. 2005; 167: 305-313Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar, 16Abel LC Rizzo LV Ianni B Albuquerque F Bacal F Carrara D Bocchi EA Teixeira HC Mady C Kalil J Cunha-Neto E Chronic Chagas' disease cardiomyopathy patients display an increased IFN-γ response to Trypanosoma cruzi infection.J Autoimmun. 2001; 17: 99-107Crossref PubMed Scopus (148) Google Scholar, 17Gomes JA Bahia-Oliveira LM Rocha MO Martins-Filho OA Gazzinelli G Correa-Oliveira R Evidence that development of severe cardiomyopathy in human Chagas' disease is due to a Th1-specific immune response.Infect Immun. 2003; 71: 1185-1193Crossref PubMed Scopus (232) Google Scholar There is clinical evidence that T-cellular IFN-γ gene expression is increased in patients with CHF,18Yndestad A Holm AM Muller F Simonsen S Froland SS Gullestad L Aukrust P Enhanced expression of inflammatory cytokines and activation markers in T-cells from patients with chronic heart failure.Cardiovasc Res. 2003; 60: 141-146Crossref PubMed Scopus (138) Google Scholar and Morino and colleagues19Morino Y Hara K Ushikoshi H Tanabe K Kuroda Y Noguchi T Ayabe S Hara H Yanbe Y Kozuma K Ikari Y Saeki F Tamura T γ-Interferon-induced cardiomyopathy during treatment of renal cell carcinoma: a case report.J Cardiol. 2000; 36: 49-57PubMed Google Scholar published a case report of congestive reversible heart failure as a consequence of systemic IFN-γ therapy in a patient with renal cell carcinoma. The role of IFN-γ in viral myocarditis appears to be less clear-cut. On one hand, there is evidence that IFN-γ affords protection during the acute stages of virally induced murine myocarditis.20Horwitz MS La Cava A Fine C Rodriguez E Ilic A Sarvetnick N Pancreatic expression of interferon-gamma protects mice from lethal coxsackievirus B3 infection and subsequent myocarditis.Nat Med. 2000; 6: 693-697Crossref PubMed Scopus (142) Google Scholar, 21Fairweather D Frisancho-Kiss S Yusung SA Barrett MA Davis SE Gatewood SJ Njoku DB Rose NR Interferon-γ protects against chronic viral myocarditis by reducing mast cell degranulation, fibrosis, and the profibrotic cytokines transforming growth factor-β1, interleukin-1β, and interleukin-4 in the heart.Am J Pathol. 2004; 165: 1883-1894Abstract Full Text Full Text PDF PubMed Scopus (160) Google Scholar On the other hand, IFN-γ seems to entertain the gradual progression from an acute virus-specific inflammatory reaction to a chronic cardiomyopathy in mice.22Shioi T Matsumori A Sasayama S Persistent expression of cytokine in the chronic stage of viral myocarditis in mice.Circulation. 1996; 94: 2930-2937Crossref PubMed Scopus (152) Google Scholar Similar to the murine model, many cases of human dilated cardiomyopathy probably represent a long-term sequela of myocarditis caused by coxsackievirus and other viruses.23MacArthur CG Tarin D Goodwin JF Hallidie-Smith KA The relationship of myocarditis to dilated cardiomyopathy.Eur Heart J. 1984; 5: 1023-1035Crossref PubMed Scopus (14) Google Scholar, 24Baboonian C Davies MJ Booth JC McKenna WJ Coxsackie B viruses and human heart disease.Curr Top Microbiol Immunol. 1997; 223: 31-52PubMed Google Scholar, 25Hill SL Rose NR The transition from viral to autoimmune myocarditis.Autoimmunity. 2001; 34: 169-176Crossref PubMed Scopus (27) Google Scholar, 26Feldman AM McNamara D Myocarditis.N Engl J Med. 2000; 343: 1388-1398Crossref PubMed Scopus (962) Google Scholar, 27Noutsias M Pauschinger M Poller WC Schultheiss HP Kuhl U Immunomodulatory treatment strategies in inflammatory cardio-myopathy: current status and future perspectives.Expert Rev Cardiovasc Ther. 2004; 2: 37-51Crossref PubMed Scopus (19) Google Scholar, 28Rutschow S Li J Schultheiss HP Pauschinger M Myocardial proteases and matrix remodeling in inflammatory heart disease.Cardiovasc Res. 2006; 69: 646-656Crossref PubMed Scopus (87) Google Scholar Hence, there is sufficient reason to consider IFN-γ as a candidate cytokine involved in the pathomechanism leading to CHF. In the present study, we analyzed the cardiac phenotype of SAP-IFN-γ transgenic mice, which constitutively express IFN-γ in their livers and also show markedly elevated cytokine serum levels.29Toyonaga T Hino O Sugai S Wakasugi S Abe K Shichiri M Yamamura K Chronic active hepatitis in transgenic mice expressing interferon-γ in the liver.Proc Natl Acad Sci USA. 1994; 91: 614-618Crossref PubMed Scopus (197) Google Scholar We provide evidence that SAP-IFN-γ mice spontaneously develop chronic active myocarditis, characterized by infiltration of T cells, macrophages, and dendritic cells and by expression of MCP1, MIP1-α, interleukin (IL)-12, and TNF-α, eventually culminating in the development of severe cardiomyopathy. Production and characteristics of transgenic lineage SAP-IFN-γ5 (here referred to as SAP-IFN-γ) has been described previously.29Toyonaga T Hino O Sugai S Wakasugi S Abe K Shichiri M Yamamura K Chronic active hepatitis in transgenic mice expressing interferon-γ in the liver.Proc Natl Acad Sci USA. 1994; 91: 614-618Crossref PubMed Scopus (197) Google Scholar In brief, SAP-IFN-γ transgenic mice carry the cDNA of the murine IFN-γ gene cloned downstream from the liver-specific promoter of the human serum amyloid P component (SAP) gene. The SAP-IFN-γ strain was previously backcrossed to the C57BL/6 (B6) inbred strain30Merkle H Nusser P Knehr S Lohler J Barsig J Yamamura KI Reifenberg K Hepatocytes of double-transgenic mice expressing high levels of hepatitis B virus e antigen and interferon-γ are not injured by HBeAg specific autoantibodies.Arch Virol. 2000; 145: 1081-1098Crossref PubMed Scopus (5) Google Scholar and was propagated by mating hemizygous transgenic males with B6 females. Transgenic offspring could be discriminated from their nontransgenic littermates by polymerase chain reaction (PCR) amplification as described previously.30Merkle H Nusser P Knehr S Lohler J Barsig J Yamamura KI Reifenberg K Hepatocytes of double-transgenic mice expressing high levels of hepatitis B virus e antigen and interferon-γ are not injured by HBeAg specific autoantibodies.Arch Virol. 2000; 145: 1081-1098Crossref PubMed Scopus (5) Google Scholar Mice were housed in the Central Laboratory Animal Facility of the University of Mainz under specific pathogen-free conditions. Mice were sacrificed by exposure to CO2, and cardiac tissue specimens were fixed in 4% buffered formaldehyde solution or in Bouin's fixative. Sections were immediately embedded in paraffin, and 4-μm sections were stained with hematoxylin and eosin (H&E) or the periodic acid-Schiff reaction according to standard protocols. Apoptosis was analyzed using the in situ cell death detection kit (Roche, Basel, Switzerland). Immunohistological staining of the Mac2 and CD3 antigens was performed on Bouin-fixed sections using immunoenzymatic methods. Deparaffinized sections were reacted before antibody incubation with a commercial target unmasking fluid (Dianova, Hamburg, Germany) in a microwave oven. For macrophage staining the sections were incubated overnight with a biotinylated Mac2-specific (CL8942B; Cedarlane-Biozol, Eching, Germany) antibody. For T-cell immunohistochemistry, the slides were incubated with a CD3-specific (CBL1303; Chemicon, Temecula, CA) primary antibody and a biotinylated secondary antibody (CLCC6015, Cedarlane-Biozol). Biotinylated antibodies were counterstained with phosphatase-conjugated streptavidin (DAKO Diagnostika, Hamburg, Germany). Enzyme activity was revealed with naphthol AS-Bi phosphate in combination with hexazotized new fuchsine (Merck, Darmstadt, Germany). As controls, heart tissue from nontransgenic mice were used. Cryosections were prepared from snap-frozen murine hearts and analyzed by immunofluorescence staining. Immunofluorescence was performed using the TSA Cy3 system (Perkin Elmer, Rodgau, Germany) and a fluorescence microscope (Olympus, Melville, NY). In brief, cryosections were fixed in paraformaldehyde for 10 minutes followed by sequential incubation with methanol, avidin/biotin (Vector Laboratories, Burlingame, CA), and protein blocking reagent (DAKO, Wiesbaden, Germany) to eliminate unspecific background staining. Slides were then incubated overnight with primary antibodies specific for CD11c, CD4, B220 (BD Bioscience, Heidelberg, Germany), CD8 (Southern Biotechnology, Birmingham, AL), Mac2 (Cederlane Laboratories, Hornby, ON, Canada). Subsequently, the slides were incubated for 30 minutes at room temperature with biotinylated secondary antibodies (Dianova, Darmstadt, Germany). All samples were finally treated with streptavidin-horseradish peroxidase and stained with tyramide (Cy3) according to the manufacturer's instructions (Perkin Elmer). Before examination, the nuclei were counterstained with Hoechst3342 (Molecular Probes, Eugene, OR). Total RNA was extracted from heart samples (0.5 to 1.0 g) by acid guanidinium thiocyanate-phenol-chloroform extraction, as described.31Chomczynski P Sacchi N Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.Anal Biochem. 1987; 162: 156-159Crossref PubMed Scopus (63183) Google Scholar One-step RT-PCR was performed in 25-μl reactions in a 96-well spectrofluorometric thermal cycler (iCycler; Bio-Rad, München, Germany). For the real-time quantitative RT-PCR analyses (30 minutes at 50°C, 15 minutes at 95°C, and 40 cycles of 15 seconds at 94°C, 60 seconds at 60°C), the following oligonucleotides served as sense and anti-sense primers and TaqMan hybridization probes: Casp3: sense 5′TGATGAGGAGATGGCTTGCC3′, anti-sense 5′GTGCGCGTACAGCTTCAGC3′, probe 5′CAAAGGACGGGTCGTGGTTCATCCAG3′; Casp7: sense 5′ACATTGACGCTAATCCCCGC3′, anti-sense 5′ TTG CCA TGC TCA TTC AGG ATG 3′, probe 5′TCCTCTTTGCTTACTCCACGGTTCCAGGTTATTA3′; IL-12-p40: sense 5′TACTCCGGACGGTTCACGTG3′, anti-sense 5′GTCACTGCCCGAGAGTCAGG3′, probe 5′AAGAAACATGGACTTGAAGTTCAACATCAAGAGCA3′; inducible nitric-oxide synthase: sense 5′CAGCTGGGCTGTACAAACCTT3′, anti-sense 5′CATTGGAAGTGAAGCGTTTCG3′, probe 5′CGGGCAGCCTGTGAGACCTTTGA3′; Mcp1: sense 5′CTTCTGGGCCTGCTGTTCA3′, anti-sense 5′CCAGCCTACTCATTGGGATC3′, probe 5′CTCAGCCAGATGCAGTTAACGCCC3′; Mip1-α sense 5′CTGCAACCAAGTCTTCTCAGC3′, anti-sense 5′CTGCCTCCAAGACTCTCAGG3′, probe 5′ACTGCCTGCTGCTTCTCCTACAGCC3′; TGF-β1: sense 5′TGACGTCACTGGAGTTGTACGG3′, anti-sense 5′GGTTCATGTCATGGATGGTGC3′, probe 5′TTCAGCGCTCACTGCTCTTGTGACAG3′; TNF-α sense 5′CATCTTCTCAAAATTCGAGTGACAA3′, anti-sense 5′TGGGAGTAGACAAGGTACAACCC3′, probe 5′CACGTCGTAGCAAACCACCAAGTGGA3′; and Pol2A: sense 5′ACCACGTCCAATGATATTGTGGAG3′, anti-sense 5′ATGTCATAGTGTCACACAGGAGCG3′, probe 5′CTGGGCATTGAGGCTGTGCGGAA3′. TaqMan hybridization probes were double-labeled with 6-carboxyfluorescein (FAM) as reporter fluorophore and carboxytetramethyl-rhodamine (TAMRA) as quencher. All primers and dual-labeled probes (5′-FAM, 3′-TAMRA) were purchased from MWG-Biotech (Ebersberg, Germany). Fluorescence was monitored at each 60°C step. Each experimental reaction was performed in triplicate. All primer/probes sets had efficiencies of 100% (±10%). To calculate the relative expression of caspase 3, caspase 7, IL-12-p40, inducible nitric-oxide synthase, Mcp1, Mip1-α, TGF-β1, and TNF-α mRNA the 2−ΔΔC(T) method32Livak KJ Schmittgen TD Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔC(T) method.Methods. 2001; 25: 402-408Crossref PubMed Scopus (124645) Google Scholar was used. C(T) values of mRNA expression were normalized to the C(T) values of Pol2A mRNA. The 2−ΔΔC(T) values of the B6 mice were set to 100% for each mRNA analyzed. IL-12p40/p70, IL-6, IL-2, IFN-γ, and TNF-α enzyme-linked immunosorbent assay antibodies and recombinant standards were bought from BD Pharmingen (Heidelberg, Germany) and used according to the manufacturer's instructions. The capture antibody was bound onto the Maxisorb (Nunc, Roskilde, Denmark) assay plate overnight at 4°C. The amount of biotinylated detection antibody was determined using streptavidin-conjugated horseradish peroxidase, an enzyme that interacts with the 3,3′,5,5′ TMB liquid substrate (Sigma, St. Louis, MO). After stopping of reaction with 2 mol/L H2SO4 the assay was read out at an absorbance of 450 nm with the SpectraFluorPlus reader from Tecan (Crailsheim, Germany). Alanine transaminase, urea, and creatinine concentrations were determined in murine sera with a SCIL Reflovet Plus system (Scil Animal Care Company, Viernheim, Germany). Echocardiographic analyses were performed in anesthesia. Two-dimensional guided M-mode echoes (30 MHz) were obtained from short- and long-axis views at the level of the largest left ventricular (LV) diameter using a VS-VEVO 660/230 high-resolution imaging system (Visualsonics, Toronto, ON, Canada). LV end-diastolic (LVEDD) and end-systolic (LVESD) dimensions were measured from original tracings by using the leading edge convention of the American Society of Echocardiography. Percent fractional shortening (FS), LV mass (LVM), and end-diastolic wall-thickness/cavity ratio (h/r) were calculated as previously described.33Schmidt AG Kadambi VJ Ball N Sato Y Walsh RA Kranias EG Hoit BD Cardiac-specific overexpression of calsequestrin results in left ventricular hypertrophy, depressed force-frequency relation and pulsus alternans in vivo.J Mol Cell Cardiol. 2000; 32: 1735-1744Abstract Full Text PDF PubMed Scopus (43) Google Scholar Statistical significance was calculated by Student's t-test. We conducted a long-term histological follow-up study investigating at least six transgenic mice, as well as the same number of nontransgenic controls, at three distinct age levels. Because almost all IFN-γ-expressing mice die prematurely at an age of ∼6 to 12 months,29Toyonaga T Hino O Sugai S Wakasugi S Abe K Shichiri M Yamamura K Chronic active hepatitis in transgenic mice expressing interferon-γ in the liver.Proc Natl Acad Sci USA. 1994; 91: 614-618Crossref PubMed Scopus (197) Google Scholar we decided to analyze the SAP-IFN-γ cardiac phenotype at age levels of 2, 4, and 6 months. In hearts obtained from mutant mice of an age of 2 months, we found only minimal alterations characterized by a low-level interstitial mononuclear infiltrate and discrete signs of disseminated cardiomyolysis (not shown). These cardiac alterations were more advanced in the hearts of 4-month-old SAP-IFN-γ mice (Figure 1). At an age of 6 months, the SAP-IFN-γ hearts exhibited besides enhanced myodegenerative and inflammatory alterations a reactive interstitial fibrosis with deposition of extracellular matrix (Figure 2D, arrows). At this age level, the cardiopathological process culminated in a notable atrophy of the heart musculature, morphologically characterized by drop-out and variation in the size and shape of cardiac muscle fibers (Figure 2, A–D). This phenomenon was more pronounced in hearts taken from moribund animals (Figure 2, E and F), sacrificed at an age of ∼10 months. No pathological cardiac changes could be detected in the nontransgenic controls (not shown).Figure 2Myocarditis and cardiomyopathy in 6-month-old and moribund SAP-IFN-γ transgenic mice. A–F: Representative longitudinal and cross sections of SAP-IFN-γ transgenic hearts of 6-month-old mice (A–D) and of moribund (E: 10.1-month-old; F: 10.5-month-old) animals. At an age of 6 months, systemic IFN-γ expression had induced in the SAP-IFN-γ hearts (A, B; H&E) a variably intensive cardiac inflammatory reaction characterized by abundant infiltration of mononuclear cells (arrows). The advanced disease process is further characterized by myofiber apoptosis (C, arrows; H&E), cardiomyocellular atrophy and a pronounced fibrosis (D, arrows; periodic acid-Schiff). Cardiomyolyses and interstitial fibrosis were accentuated in the subendocardial ventricular myocardium and in the muscular septum of SAP-IFN-γ hearts. Note the obvious increase of myofiber atrophy and fibrosis in the hearts of moribund animals (E, F; H&E). No cardiac abnormalities could be detected in the age-matched wild-type controls (not shown). G and H: Venous congestion in the livers of moribund 6-month-old SAP-IFN-γ mice (G, H; H&E). Note the characteristic liver alterations such as centrolobular dilation of sinusoids (G, arrows), trabecular atrophy (H, arrows), and centrolobular fatty change (cytoplasmic empty spaces). Scale bars: 200 μm (A, B, E, and G); 100 μm (C, D, F, and H).View Large Image Figure ViewerDownload Hi-res image Download (PPT) Because apoptotic cells had been detected in the cardiac slides of SAP-IFN-γ mice of an age of 6 months (Figure 2C), quantitative terminal deoxynucleotidyl transferase dUTP nick-end labeling stainings were performed to investigate this issue further. The mean (±SEM) number of apoptotic cells was found to be increased in the hearts of 6-month-old SAP-IFN-γ mice (2.3 ± 0.9 HPF, n = 7) compared with the age-matched controls (1.1 ± 0.4 HPF, n = 7); however, the differences did not attain statistical significance. In our next experiment, we analyzed the composition of the cardiac mononuclear infiltrates of the SAP-IFN-γ hearts. To this end, cryosections of snap-frozen hearts prepared from 6-month-old SAP-IFN-γ mutant and control animals were subjected to immunofluorescence studies. As depicted in Figure 3, the mononuclear infiltrations of SAP-IFN-γ mice were comprised of abundant CD4+ T cells, CD8+ T cells, Mac2+ macrophages, and CD11c+ dendritic cells. In contrast, virtually no B220+ B could be detected in the hearts of the mutant mice. No notable cellular infiltrate of either cell type was seen in control animals. Because a previous study34Sharma UC Pokharel S van Brakel TJ van Berlo JH Cleutjens JP Schroen B Andre S Crijns HJ Gabius HJ Maessen J Pinto YM Galectin-3 marks activated macrophages in failure-prone hypertrophied hearts and contributes to cardiac dysfunction.Circulation. 2004; 110: 3121-3128Crossref PubMed Scopus (701) Google Scholar has suggested galectin-3 as a relevant marker of activated macrophages in cardiac dysfunction, SAP-IFN-γ cardiac slides were immunohistochemically investigated for Mac2+ (galectin 3+) macrophages. Further, CD3-specific immunohistochemical analyses were performed to get a better impression of the cardiac distribution of T cells in SAP-IFN-γ hearts. As depicted in Figure 4, the myocardia of SAP-IFN-γ mice exhibited significant infiltrations with Mac2+ (galectin 3+) macrophages and CD3+ T cells, whereas the hearts of the B6 controls were free of such infiltrates. Because the cytokine TNF-α has a well-documented cardiotoxic potential,11Kubota T McTiernan CF Frye CS Slawson SE Lemster BH Koretsky AP Demetris AJ Feldman AM Dilated cardiomyopathy in transgenic mice with cardiac-specific overexpression of tumor necrosis factor-α.Circ Res. 1997; 81: 627-635Crossref PubMed Google Scholar, 12Bryant D Becker L Richardson J Shelton J Franco F Peshock R Thompson M Giroir B Cardiac failure in transgenic mice with myocardial expression of tumor necrosis factor-α.Circulation. 1998; 97: 1375-1381Crossref PubMed Scopus (545) Google Scholar we speculated that this proinflammatory cytokine might be involved in the pathomechanism underlying SAP-IFN-γ-induced cardiomyopathy. To test this hypothesis, we performed quantitative RT-PCR analyses using RNA samples prepared from 6-month-old male SAP-IFN-γ mice and age- and sex-matched controls. As depicted in Figure 5, the SAP-IFN-γ hearts exhibited a significant increase of transcription of the proinflammatory cytokines TNF-α and IL-12 as well as the macrophage-attracting chemokines MCP1 and MIP1-α. Casp3 and Casp7 transcription was only slightly increased in the SAP-IFN-γ hearts, but the differences did not attain statistical significance. No differences of inducible nitric-oxide synthase and TGF-β1 transcription could be detected between SAP-IFN-γ and control hearts. Given the significant histological (Figure 1, Figure 2, Figure 3, Figure 4) and transcriptional (Figure 5) features of myocarditis and cardiomyopathy in SAP-IFN-γ mice, it was of great interest to investigate whether IFN-γ transgenesis might affect cardiac function. We therefore investigated anesthetized SAP-IFN-γ transgenic and B6 control mice of an age of 6 months by echocardiography. As shown in Figure 6 the imaging revealed a significant increase of relative left ventricular mass (LVM/BW) and of left ventricular end diastolic (LVEDD) and end systolic diameter (LVESD) in SAP-IFN-γ mice compared with C57BL/6 wild-type controls. Likewise, fractional shortening (FS), interventricular septum (SEPth), and posterior wall (PWth) thickness were decreased in SAP-IFN-γ mice compared with B" @default.
• W2034170734 created "2016-06-24" @default.
• W2034170734 creator A5001371042 @default.
• W2034170734 creator A5001550826 @default.
• W2034170734 creator A5005143948 @default.
• W2034170734 creator A5008213395 @default.
• W2034170734 creator A5009905903 @default.
• W2034170734 creator A5016531260 @default.
• W2034170734 creator A5024878901 @default.
• W2034170734 creator A5030814855 @default.
• W2034170734 creator A5035254382 @default.
• W2034170734 creator A5041041534 @default.
• W2034170734 creator A5045182863 @default.
• W2034170734 creator A5047521943 @default.
• W2034170734 creator A5066747793 @default.
• W2034170734 creator A5072726806 @default.
• W2034170734 creator A5074883323 @default.
• W2034170734 creator A5076458004 @default.
• W2034170734 creator A5079350161 @default.
• W2034170734 creator A5080433113 @default.
• W2034170734 creator A5083634084 @default.
• W2034170734 date "2007-08-01" @default.
• W2034170734 modified "2023-10-14" @default.
• W2034170734 title "Interferon-γ Induces Chronic Active Myocarditis and Cardiomyopathy in Transgenic Mice" @default.
• W2034170734 cites W1493687925 @default.
• W2034170734 cites W1595293335 @default.
• W2034170734 cites W1964072247 @default.
• W2034170734 cites W1972209585 @default.
• W2034170734 cites W1989920052 @default.
• W2034170734 cites W1991722469 @default.
• W2034170734 cites W1993117371 @default.
• W2034170734 cites W2007754282 @default.
• W2034170734 cites W2010033073 @default.
• W2034170734 cites W2012048878 @default.
• W2034170734 cites W2012514914 @default.
• W2034170734 cites W2012863777 @default.
• W2034170734 cites W2019479110 @default.
• W2034170734 cites W2021284795 @default.
• W2034170734 cites W2028012069 @default.
• W2034170734 cites W2031745114 @default.
• W2034170734 cites W2038725731 @default.
• W2034170734 cites W2039281904 @default.
• W2034170734 cites W2051636000 @default.
• W2034170734 cites W2052780003 @default.
• W2034170734 cites W2062079696 @default.
• W2034170734 cites W2066885413 @default.
• W2034170734 cites W2068609509 @default.
• W2034170734 cites W2076070180 @default.
• W2034170734 cites W2087750804 @default.
• W2034170734 cites W2088499548 @default.
• W2034170734 cites W2092889728 @default.
• W2034170734 cites W2100378067 @default.
• W2034170734 cites W2107152789 @default.
• W2034170734 cites W2107277218 @default.
• W2034170734 cites W2110561490 @default.
• W2034170734 cites W2118820973 @default.
• W2034170734 cites W2123248199 @default.
• W2034170734 cites W2126307010 @default.
• W2034170734 cites W2127688157 @default.
• W2034170734 cites W2130794319 @default.
• W2034170734 cites W2134812217 @default.
• W2034170734 cites W2140489687 @default.
• W2034170734 cites W2148029579 @default.
• W2034170734 cites W2157962982 @default.
• W2034170734 cites W2160440202 @default.
• W2034170734 cites W2163118333 @default.
• W2034170734 cites W2163470859 @default.
• W2034170734 cites W2168345737 @default.
• W2034170734 cites W2170985289 @default.
• W2034170734 cites W2172298170 @default.
• W2034170734 cites W2172466148 @default.
• W2034170734 cites W2192080449 @default.
• W2034170734 cites W2324476825 @default.
• W2034170734 cites W2396894205 @default.
• W2034170734 cites W283476351 @default.
• W2034170734 cites W4232262676 @default.
• W2034170734 cites W4294216491 @default.
• W2034170734 doi "https://doi.org/10.2353/ajpath.2007.060906" @default.
• W2034170734 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/1934522" @default.
• W2034170734 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17556594" @default.
• W2034170734 hasPublicationYear "2007" @default.
• W2034170734 type Work @default.
• W2034170734 sameAs 2034170734 @default.
• W2034170734 citedByCount "83" @default.
• W2034170734 countsByYear W20341707342012 @default.
• W2034170734 countsByYear W20341707342013 @default.
• W2034170734 countsByYear W20341707342014 @default.
• W2034170734 countsByYear W20341707342015 @default.
• W2034170734 countsByYear W20341707342016 @default.
• W2034170734 countsByYear W20341707342017 @default.
• W2034170734 countsByYear W20341707342018 @default.
• W2034170734 countsByYear W20341707342019 @default.
• W2034170734 countsByYear W20341707342020 @default.
• W2034170734 countsByYear W20341707342021 @default.
• W2034170734 countsByYear W20341707342022 @default.
• W2034170734 countsByYear W20341707342023 @default.
• W2034170734 crossrefType "journal-article" @default.
• W2034170734 hasAuthorship W2034170734A5001371042 @default.

• next