FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2034346500> ?p ?o ?g. }

• W2034346500 endingPage "20456" @default.
• W2034346500 startingPage "20450" @default.
• W2034346500 abstract "XCE, a new member of the endothelin-converting enzyme and neutral endopeptidase family, is preferentially expressed in specific areas of the central nervous system including spinal chord and medulla. To elucidate the importance and function of XCE, we disrupted its gene in mouse embryonic stem cells by homologous recombination and created mice deficient in XCE. The resulting phenotype is characterized by neonatal lethality. All XCE −/− homozygous mice died of respiratory failure shortly after birth, and in most cases their lungs were never ventilated. Apart from the atelectasis, anatomical and histological examinations of embryonic day 18.5 XCE −/− embryos and newborn homozygotes did not reveal any obvious abnormalities in organs and tissues. Malformations that are related to the knock-out were also not found in the skeletons of XCE −/− mice. In addition, XCE knock-out animals showed no deficiency of pulmonary surfactant proteins and had normal heart beat frequencies. Taken together, our results demonstrate that XCE is an essential gene. The phenotype of the XCE-deficient mice together with the central nervous system-specific expression further suggest that XCE may play a vital role in the control of respiration. XCE, a new member of the endothelin-converting enzyme and neutral endopeptidase family, is preferentially expressed in specific areas of the central nervous system including spinal chord and medulla. To elucidate the importance and function of XCE, we disrupted its gene in mouse embryonic stem cells by homologous recombination and created mice deficient in XCE. The resulting phenotype is characterized by neonatal lethality. All XCE −/− homozygous mice died of respiratory failure shortly after birth, and in most cases their lungs were never ventilated. Apart from the atelectasis, anatomical and histological examinations of embryonic day 18.5 XCE −/− embryos and newborn homozygotes did not reveal any obvious abnormalities in organs and tissues. Malformations that are related to the knock-out were also not found in the skeletons of XCE −/− mice. In addition, XCE knock-out animals showed no deficiency of pulmonary surfactant proteins and had normal heart beat frequencies. Taken together, our results demonstrate that XCE is an essential gene. The phenotype of the XCE-deficient mice together with the central nervous system-specific expression further suggest that XCE may play a vital role in the control of respiration. XCE is the latest member of the zinc metallopeptidase family, which includes the endothelin-converting enzymes ECE-1 and ECE-2, NEP (neutral endopeptidase or enkephalinase), Kell blood group antigen (KELL), and PEX (for a review, see Ref. 1Turner A.J. Tanzawa K. FASEB J. 1997; 1: 355-364Crossref Scopus (384) Google Scholar). The corresponding cDNA was cloned recently from human caudate nucleus and spinal cord cDNA libraries (2Valdenaire O. Richards J.G. Faull R.L.M. Schweizer A. Mol. Brain Res. 1999; 64: 211-221Crossref PubMed Scopus (82) Google Scholar). It encodes a type II transmembrane protein of 775 amino acids with a short cytosolic tail of 59 residues and a large luminal domain that contains the characteristic zinc-binding motif HEXXH. XCE shares the highest homology with ECE-1 (53% homology and 42% identity over the last 500 amino acids), but in contrast to ECE-1 it is only present as a single transcript. Expression in various cell types revealed a 95-kDa glycosylated protein consistent with the presence of three putative sites for Asn-linked glycosylation in its cDNA. XCE mRNA is preferentially expressed in the central nervous system (CNS). 1The abbreviations CNScentral nervous systemEembryonic dayRTreverse transcriptionPCRpolymerase chain reactionTKthymidine kinaseHSVherpes simplex virusbpbase pair(s)kbkilobase pair(s) In human Northern blot experiments, highest expression was found in putamen, medulla, subthalamic nucleus, and spinal cord. In the rat and human CNS, a very specific pattern of neuronal labeling in presumptive cholinergic interneurons of basal ganglia, basal forebrain neurons, as well as brainstem and spinal cord motor neurons was detected by in situ hybridization histochemistry. In contrast, other brain regions including cerebellum and cerebral cortex were not labeled. Among the peripheral tissues, strong hybridization signals were observed in rat uterine subepithelial cells and around renal blood vessels. central nervous system embryonic day reverse transcription polymerase chain reaction thymidine kinase herpes simplex virus base pair(s) kilobase pair(s) For all previously known members of the NEP/ECE family, either a function or a clinical importance has been described. NEP, which is identical to the common acute lymphoblastic leukemia antigen or CALLA (3Devault A. Lazure C. Nault C. Le Moual H. Seidah N.G. Chretien M. Kahn P. Powell J. Mallet J. Beaumont A. Roques B.P. Crine P. Boileau G. EMBO J. 1987; 6: 1317-1322Crossref PubMed Scopus (175) Google Scholar, 4LeTarte M. Vera S. Tran R. Addis J.B. Onizuka R.J. Quackenbush E.J. Jongeneel C.V. McInnes R.R. J. Exp. Med. 1988; 168: 1247-1253Crossref PubMed Scopus (289) Google Scholar, 5Malfroy B. Kuang W.J. Seeburg P.H. Mason A.J. Schofield P.R. FEBS Lett. 1988; 229: 206-210Crossref PubMed Scopus (163) Google Scholar), metabolizes many substrates including enkephalins, tachykinins, atrial natriuretic factor, and bradykinin (6Roques B.P. Noble F. Daugé V. Fournié-Zaluski M.C. Beaumont A. Pharmacol. Rev. 1993; 45: 87-146PubMed Google Scholar). ECE-1 (7Xu D. Emoto N. Giaid A. Slaughter C. Kaw S. deWit D. Yanagisawa M. Cell. 1994; 78: 473-485Abstract Full Text PDF PubMed Scopus (862) Google Scholar, 8Ikura T. Sawamura T. Shiraki T. Hosokawa H. Kido T. Hoshikawa H. Shimada K. Tanzawa K. Kobayashi S. Miwa S. Masaki T. Biochem. Biophys. Res. Commun. 1994; 203: 1417-1422Crossref PubMed Scopus (78) Google Scholar, 9Schmidt M. Kröger B. Jacob E. Seulberger H. Subkowski T. Otter R. Meyer T. Schmalzing G. Hillen H. FEBS Lett. 1994; 356: 238-243Crossref PubMed Scopus (184) Google Scholar, 10Shimada K. Takahashi M. Tanzawa K. J. Biol. Chem. 1994; 269: 18275-18278Abstract Full Text PDF PubMed Google Scholar, 11Shimada K. Matsushita Y. Wakabayashi K. Takahashi M. Matsubara A. Iijima Y. Tanzawa K. Biochem. Biophys. Res. Commun. 1995; 207: 807-812Crossref PubMed Scopus (122) Google Scholar, 12Yorimutsu K. Moroi K. Inagaki N. Saito T. Masuda Y. Masaki T. Seino S. Kimura S. Biochem. Biophys. Res. Commun. 1995; 208: 721-727Crossref PubMed Scopus (49) Google Scholar) is mainly responsible for the conversion of the inactive precursors, big endothelins, to the biologically active endothelins that play an important role in the maintenance of vascular tone but also in cell proliferation, hormone production, and various developmental processes. ECE-2 was also shown to convert big endothelins to endothelins but only under acidic conditions (pH5.5) (13Emoto N. Yanagisawa M. J. Biol. Chem. 1995; 270: 15262-15268Abstract Full Text Full Text PDF PubMed Scopus (434) Google Scholar). Mutations in the PEX gene are responsible for the inherited renal disorder X-linked hypophosphatemic rickets (14The HYP Consortium Nat. Genet. 1995; 11: 130-136Crossref PubMed Scopus (974) Google Scholar), and parathyroid hormone-derived peptides have recently been identified as a first substrate for PEX (15Lipman M.L. Panda D. Bennett H.P.J. Henderson J.E. Shane E. Shen Y. Goltzman D. Karaplis A.C. J. Biol. Chem. 1998; 273: 13729-13737Abstract Full Text Full Text PDF PubMed Scopus (127) Google Scholar). Although Kell (16Lee S. Zambas E.D. Marsh W.L. Redman C.M. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 6353-6357Crossref PubMed Scopus (205) Google Scholar,17Lee S. Vox Sang. 1997; 73: 1-11Crossref PubMed Scopus (103) Google Scholar) is still an “orphan enzyme,” it is clear that Kell blood group antigen incompatibility can be associated with severe problems including hemolytic disease of the newborn. The sequence similarity between XCE and members of the NEP/ECE family, in particular the presence of the zinc binding motif HEXXH and the conservation of several amino acids that are crucial for the enzymatic activity in NEP and ECE-1, suggests that XCE functions as a membrane-bound metallopeptidase. The enzyme substrate, as yet unidentified, might be found among the numerous neuropeptide transmitters that colocalize with acetylcholine in the XCE-positive neurons in the CNS. In the present study, we disrupted the XCE gene by homologous recombination and created XCE-deficient mice to gain insight into the importance and physiological role of XCE. We demonstrate that the deletion of XCE results in neonatal lethality and have investigated potential anatomical, skeletal, and histological abnormalities. Genomic clones of XCE were obtained by screening a λ FIXII mouse 129/sv genomic library (Stratagene) with a 654-bp partial rat XCE cDNA (2Valdenaire O. Richards J.G. Faull R.L.M. Schweizer A. Mol. Brain Res. 1999; 64: 211-221Crossref PubMed Scopus (82) Google Scholar). Positive phages encompassing the putative catalytic domain of XCE were mapped and partially sequenced. To generate the targeting vector, the polylinker of the Bluescript vector (Stratagene) was first modified by insertion of two complementary oligonucleotides encodingXhoI-HindIII-BamHI-SalI-NotI restriction sites into the unique XhoI and NotI sites of pBSK resulting in the vector pBSK poly1. The herpes simplex virus (HSV) gene for thymidine kinase (TK) driven by the HSV-TK promoter was subcloned into the XhoI and HindIII sites of this pBSK poly1 giving plasmid pBSK poly 1-TK. The 5′-flanking arm consisting of a 1956-bp BglII XCE genomic fragment (recloned as XhoI-HindIII fragment) was then inserted together with a neomycin resistance cassette (excised asXhoI-BamHI fragment from pMC1 neo; Stratagene) downstream of the TK into the HindIII and BamHI sites of pBSK poly1-TK in a tripartite ligation (pBSK poly1-TK-XCE5′-neo). In a last step, an approximately 7-kbHindIII genomic XCE fragment (recloned asSalI-NotI fragment) was inserted downstream of the neomycin resistance cassette into the SalI andNotI sites of pBSK poly1-TK-XCE5′-neo to generate the 3′-flanking arm. In the resulting targeting vector (see Fig.1 A), the 1076 bp of XCE sequence between the two flanking arms including the coding sequence for the zinc binding motif HELTH is replaced by the 1087-bp neomycin resistance cassette. The construct was linearized at its unique NotI site prior to transfection. An E14 ES cell line was grown on a feeder layer of irradiated neomycin-resistant mouse embryonic fibroblasts in standard ES medium (Dulbecco's modified Eagle's medium containing 15% fetal calf serum, 0.1 mm2-mercaptoethanol, 2 mm glutamine, 1× nonessential amino acids, and 1000 units/ml leukemia inhibitory factor (Life Technologies, Inc.). Approximately 20 × 106 ES cells were electroporated with 25 μg of the linearized targeting vector and selected for double resistance to G418 and ganciclovir (Life Technologies, Inc.). The selection was started at day 2 with 350 μg/ml G418. On day 3 ganciclovir was added to a final concentration of 2 μm and was kept in the medium for 3 days. After 10 days double-resistant clones were isolated and expanded for Southern blot analysis and freezing. For Southern blotting genomic DNA from these clones was isolated using the DNazol reagent (Life Technologies, Inc.), digested with BamHI, and hybridized with the 271-bp 5′ external probe shown in Fig. 1 A using standard techniques. The sizes of the wild-type and targeted fragments were approximately 9 and 3.3 kb, respectively. From 100 clones analyzed, 25 homologous recombinants were identified. One correctly targeted ES cell clone was injected into C57BL/6 mouse blastocysts, and resulting chimeric males were bred to C57BL/6 females to produce heterozygous F1 mice carrying the targeted allele. XCE +/− mice were then interbred to obtain homozygotes. Genotyping of postnatal day 7–14 mice, newborn pups, and embryos was performed by Southern blot analysis and/or polymerase chain reaction (PCR) (Qiagen, solution Q system). Genomic DNA was isolated from tail biopsies using proteinase K (18Laird P.W. Zijderveld A. Linders K. Rudnicki M.A. Jaenisch R. Berns A. Nucleic Acid Res. 1991; 19: 4293Crossref PubMed Scopus (1301) Google Scholar). Oligonucleotide primers used for PCR detection were ATGGGTCACTGGTCCCTTTC (P1), TGTTCTCGCCAAGTGTGTGTTTCCC (P2), and CCGGAGAACCTGCGTGCAATCC (P3) (see Fig. 1 A). The reaction was cycled 30 times (14 s 96 °C, 15 s 60 °C, and 90 s 72 °C), which amplified a 864-bp fragment in wild-type +/+ animals, a 410-bp fragment in knock-out −/− mice, and both a 864-bp and 410-bp fragment in heterozygous animals. For Southern blot analysis, genomic DNA was digested with BamHI and hybridized as described above. RT-PCR was performed on total RNA prepared from day 18.5 embryonic brains (analysis of XCE) or lungs (analysis of surfactant-associated proteins) using the RNA-PLUS kit (Quantum-Bioprobe). First strand cDNA was synthesized using oligo(dT) primers with the Reverse Transcription System (Promega) according to the manufacturer's protocol. For PCR amplification of a 500-bp XCE fragment, sense and antisense oligonucleotide primers were 5′-CCGTCAAAAAGATTCGACAGGAGGTGG-3′ and 5′-TGCAAAGGCAATGAAGAAAAGCTGG-3′, respectively. These primers were deduced from mouse sequence located 5′ (5th exon in Fig. 1 A) and 3′ (11th exon in Fig. 1 A) of the disrupted region (8th to 10th exon in Fig. 1 A) and correspond to bp 1854–1880 and bp 2353–2329 of the human cDNA, respectively. For the semiquantitative RT-PCR analysis of surfactant-associated proteins, cDNA was amplified using the following primers: mouse SP-A (406-bp fragment), 5′-GATCAAACATCAGATTCTGCAAACAATGGG-3′ and 5′-AAATTCACAAATGGCCAGCCGGTACTGCAGGC-3′; mouse SP-B (342-bp fragment), 5′-CTTGTCCTCCGATCTTCCACTGAGGATGCC-3′ and 5′-GAGGTGTGGGGTTTGGAACGACTGCAGAGG-3′; mouse SP-C (452-bp fragment), 5′-TGGTCCTCGTTGTCGTGGTGATTGTAGGGG-3′ and 5′-GATATAGTAGAGTGGTAGCTCTCCACACAGGG-3′; and mouse SP-D (403-bp fragment), 5′-GGTTGCCTTCTCCCACTATCAGAAAGCTGC-3′ and 5′-TCAGAACTCACAGATAACAAGGCGCTGCTCTCC-3′. Mouse β-actin (605-bp fragment) was analyzed as an internal control for normalization. Appropriate dilutions were determined for each cDNA preparation and amplified fragment (SP-A, SP-B, SP-C, SP-D, and β-actin) to ensure that the resulting PCR products were derived only from the exponential phase of the amplification. The reaction was cycled 26 times (30 s 94 °C, 30 s 55 °C, and 30 s 72 °C). Aliquots of the PCR reaction were subjected to electrophoresis and the products visualized by ethidium bromide staining. The gel image was digitized with a video camera, and the intensity of the bands was quantitated with the ImageQuant software (Molecular Dynamics). C-sectioned embryos on day 18.5 of gestation and newborn pups were first analyzed for external alterations. For visceral examinations, fetuses and pups from various litters were preserved and subsequently studied for soft tissue anomalies according to Barrow and Taylor (19Barrow M.W. Taylor W.J. J. Morphol. 1969; 127: 291-305Crossref PubMed Scopus (333) Google Scholar). For the skeletal analysis, fetal E18.5 skeletons from several litters were processed with Alizarin Red S stain according to Dawson (20Dawson A.A. Stain Technol. 1926; 1: 123-124Crossref Scopus (960) Google Scholar). For the determination of heart beat frequencies, C-sectioned embryos on day 12 of gestation were placed in prewarmed Williams' Medium E (Life Technologies) containing 10% rat serum. The heart beats were counted three times for 1 min each. All animals and organs were fixed in 10% neutral buffered formalin. The following organs were embedded in paraffin wax, sectioned at 2–3 μm, and stained with hematoxylin-eosin for routine histological examination: Adrenal glands, aorta, brain, eyes, heart, mesenteric lymph nodes, kidneys, small and large intestine (duodenum, jejunum, ileum, cecum, colon, rectum) liver, lungs, esophagus, pancreas, salivary glands, skin, spleen, stomach, thymus, thyroid/parathyroid, urinary bladder, and trachea. Serial sections were performed of the brainstem and stained with hematoxylin-eosin or cresyl fast violet to demonstrate Nissl substance. We used homologous recombination in ES cells to generate mice lacking functional XCE. Genomic clones of the mouse XCE gene were isolated from a 129/sv mouse genomic library, mapped, and partially sequenced. The luminal domain of XCE contains the HEXXH zinc-binding motif (HELTH), which is likely to be essential for its enzymatic activity. In a number of metallopeptidases including ECE-1 and NEP, mutation of either histidine or the glutamic acid of this motif resulted in a totally inactive enzyme (see Ref. 1Turner A.J. Tanzawa K. FASEB J. 1997; 1: 355-364Crossref Scopus (384) Google Scholar and references therein). To disrupt XCE in vivo, the exon encoding the zinc-binding motif and the next two downstream exons were replaced with a neomycin resistance cassette (Fig. 1 A). A thymidine kinase gene was included at the 5′ end of the targeting vector as a negative selection marker against random integration. The targeting vector was electroporated into ES cells (derived from the 129/sv mouse strain), and clones resistant to G418 and gancyclovir were screened for homologous recombination events by Southern blot analysis. Genomic DNA was digested with BamHI and probed with a XCE gene fragment external to the targeting vector. The wild-type XCE allele gave an approximately 9-kb band, while the targeted allele resulted in a 3.3-kb fragment (Fig. 1 B). The correct targeting event was detected in 25 out of 100 ES cell clones that were screened. Recombinant ES cells were injected into C57BL/6 mouse blastocysts, and resulting male chimeras were bred to C57BL/6 females. Germline transmission of the disrupted allele resulted in heterozygous mice that developed normally, were fertile, and showed no obvious abnormalities. To determine the effect of the targeted XCE allele in the homozygous state, heterozygous mice were intercrossed and the offspring were genotyped by Southern and PCR analysis. No viable homozygotes (XCE −/−) were found when 310 offspring were analyzed at 1–2 weeks of age (Table I). The ratio of wild-type to heterozygous progeny was approximately 1:2 (Table I). These findings indicate that XCE is an essential gene, disruption of which results in perinatal death.Table IGenotypes of the progeny from XCE (+/−) intercrossesAgeNo. of pupsGenotype+/++/−−/−Knock-outaXCE −/− (knock-out) mice calculated as the percentage of all genotyped mice in the same age group.%18.5 dpc174437853301–2 weeks dpp3109221800Genomic DNA was extracted from the tails of E18.5 embryos or neonates (1–2 weeks dpp) and then subjected to PCR analysis to determine the genotype. dpp, days post partum; dpc, days post coitum.a XCE −/− (knock-out) mice calculated as the percentage of all genotyped mice in the same age group. Open table in a new tab Genomic DNA was extracted from the tails of E18.5 embryos or neonates (1–2 weeks dpp) and then subjected to PCR analysis to determine the genotype. dpp, days post partum; dpc, days post coitum. To investigate the lethality of XCE −/− homozygotes, we performed timed matings of heterozygotes and analyzed embryos of various gestational age. At 18.5 days post coitum, 53 out of 174 offspring were viable XCE −/− homozygotes with beating hearts (Table I). Fig.1 C shows the genotypes of a representative litter, which were determined by PCR using the primers shown in Fig. 1 A. The number of homozygous mice (30%) was close to the expected Mendelian frequency, indicating that the XCE knock-out did not cause intrauterine death during development. No significant difference in size or overall appearance could be detected between E18.5 XCE −/− embryos and their wild-type and heterozygous littermates. The sex ratio of wild-type and XCE −/− fetuses was also comparable. To confirm complete inactivation of the XCE gene, XCE expression was examined by RT-PCR. As expected, RT-PCR revealed no expression of the XCE gene in homozygous E18.5 XCE −/− embryos (Fig.1 D). At birth all XCE −/− pups displayed the same striking characteristics. The newborn homozygotes could open their mouths but remained cyanotic and died of anoxia within 10–30 min. It is important to note that none of the XCE −/− homozygotes survived beyond this very early neonatal stage. The breathing problems were not due to an occlusion of the trachea, as demonstrated by probing of several embryos. Examination of their lungs, however, indicated that the vast majority were never ventilated. Taken together, these results demonstrate that XCE −/− homozygous mice die shortly after birth from impaired breathing and suggest that XCE may be important in the control of respiration. Given the normal gross appearance of E18.5 XCE −/− embryos and XCE −/− newborn, we next performed a thorough visceral examination of 57 E18.5 embryos (18 −/−) derived from 6 intercrosses of heterozygotes as well as of 20 newborn pups (11 −/−). Although we observed some anomalies that occurred in wild-type (+/+), heterozygous (+/−), and homozygous (−/−) animals at about the same frequency, the study did not reveal any anatomical malformations specific for the XCE knock-out. As an example, a comparison of the great vessels from XCE-deficient and wild-type mice is shown in Fig.2 (A and B). To study the skeleton in the XCE knock-out animals, embryos from 7 litters obtained by C-section on day 18.5 (21 −/−) were analyzed and stained with Alizarin Red S. The skeletal and cartilage components of XCE −/− embryos did not show any abnormal characteristics that are related to the gene targeting (Table II). The examination revealed some retardations and variations that were, however, present in wild-type, heterozygous, and homozygous fetuses at about the same incidence, indicating that they are typical for the strain of mouse. The only remarkable skeletal malformations, which were detected, affect the sternum and also occurred with comparable frequency in wild-type, heterozygous, and homozygous embryos. It is worth noting that our skeletal analysis did also not detect any craniofacial abnormalities, such as the fusion of the thyroid cartilage, hyoid bone, and basisphenoid bone, which could contribute to the respiratory failure in XCE −/− homozygotes (Fig. 2, Cand D).Table IISummary of skeletal anomaliesNo. of +/+No. of +/−No. of −/−Fetuses (E18.5)/litters16 /731 /721 /7Alive/dead16 /031 /021 /0Male/female7 /9aNot all fetuses could be sexed.15 /13aNot all fetuses could be sexed.10 /6aNot all fetuses could be sexed.Fetuses with retardationsIncompletely ossified bones or unossified bones112213Fetuses with variationsExtra cervical rib81610Thoracic rib 13 rudimentary100Fetuses with abnormalitiesLumbar vertebra missing100Sternal elements misshapen, fused, or misaligned61212Abnormality, permanent structural change which may adversely affect survival, development, or function; variation, deviation beyond the normal range of structural constitution, but which may not adversely affect survival, development or function; retardation, structure which has not developed fully corresponding to its chronological age.a Not all fetuses could be sexed. Open table in a new tab Abnormality, permanent structural change which may adversely affect survival, development, or function; variation, deviation beyond the normal range of structural constitution, but which may not adversely affect survival, development or function; retardation, structure which has not developed fully corresponding to its chronological age. To further characterize the XCE −/− animals, a histopathological evaluation of all major organs was performed. The examination of lungs obtained from several litters confirmed that the vast majority of lungs from XCE −/− mice remained atelectatic after birth (Fig.3). Congenital atelectasis was found in 15/20 homozygous animals analyzed. From the five non-atelectatic lungs, three were only minimally aerated. In contrast, the lungs of XCE +/+ mice were all properly inflated. Besides the atelectasis, the lung structures of the XCE −/− animals did not show any obvious anomalies when compared with their wild-type littermates. As mentioned above, XCE mRNA is preferentially expressed in the CNS where medulla, spinal chord, putamen, and subthalamic nucleus show highest levels of expression. This tissue distribution, together with the early respiratory failure of XCE −/− animals, prompted us to study the CNS and especially the brain stem region with the medulla oblongata, known to be of importance in the regulation of vegetative functions, such as respiration, in more detail. To this end, serial sections of the brainstem were prepared and stained with hematoxylin-eosin and cresyl fast violet (Nissl). The histopathological examination did not reveal any obvious differences between XCE −/− and wild-type control animals. In particular, no changes in morphology and distribution of neuronal cells were detected in the medulla oblongata of XCE −/− mice (Fig. 4). Differences between mutant and wild-type animals were also not found in the other regions of the CNS including spinal chord and putamen. In addition, the histological analysis did not detect apparent abnormalities in any other organs, such as heart, kidney, liver, eyes, intestine, and trachea. To extent the analysis of the XCE-deficient mice, we first compared the heart beat frequency of wild-type and XCE mutant embryos. No significant differences in the mean heart rate were detected between XCE +/+ (87 ± 14 bpm), XCE +/− (83 ± 12 bpm), and XCE −/− (81 ± 9 bpm) mice, indicating that the presence of XCE is not important for a normal heart beat frequency. Postnatal respiratory failure can be due to a deficiency of pulmonary surfactant proteins (21Clark J.C. Wert S.E. Bachurski C.J. Stahlman M.T. Stripp B.R. Weaver T.E. Whitsett J.A. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 7794-7798Crossref PubMed Scopus (561) Google Scholar, 22Tokieda K. Whitsett J.A. Clark J.C. Weaver T.E. Ikeda K. McConnell K.B. Jobe A.H. Ikegami M. Iwamoto H.S. Am. J. Physiol. 1997; 273: L875-L882PubMed Google Scholar). To test whether this is the case in XCE knock-out animals, the expression of the surfactant-associated proteins SP-A, SP-B, SP-C, and SP-D was examined in lungs of wild-type and XCE −/− E18.5 mice. Semiquantitative RT-PCR analysis revealed very similar mRNA levels of each of the four surfactant-associated proteins in XCE +/+ and XCE −/− animals (Fig.5). When the results of several experiments were quantitated, the expression in XCE-deficient mice was found to be 111 ± 11% of the wild-type level for SP-A, 92 ± 8% for SP-B, 97 ± 10% for SP-C, and 102 ± 7% for SP-D. Thus, the loss of XCE function does not cause a deficiency of pulmonary surfactant proteins. In the present study, we disrupted the XCE gene in mouse ES cells by gene targeting and established mice bearing the mutant XCE allele. The resulting phenotype is characterized by neonatal lethality of 100% of the XCE −/− homozygotes, demonstrating for the first time that XCE has a critical, non-redundant function. The cause of death in the XCE-deficient animals appears to be anoxia due to respiratory failure. While observing female mice giving birth, we found that homozygous mutant neonates were born alive but died shortly thereafter. In contrast to their wild-type and heterozygous littermates, which turned pink within minutes, all XCE −/− newborns remained cyanotic. An examination of their lungs revealed that the vast majority were never ventilated. Other than atelectasis, no detectable pathological changes in the lung structures of XCE −/− mice were observed in histological sections, demonstrating that the respiratory distress is not intrinsic to this organ. The absence of obvious craniofacial abnormalities affecting the upper airway or mouth, the lack of thoracic malformations, as well as the absence of a tracheal occlusion or a fusion between craniofacial bones and the trachea indicate that the respiratory failure after birth is most likely not caused by mechanical obstruction. Another possible reason for impaired breathing can be the reduced production of surfactant proteins, a family of polypeptides in pulmonary alveoli implicated in lung function. Similar to the phenotype of XCE −/− mice, disruption of the surfactant protein B gene resulted in lethal postnatal respiratory distress associated with atelectasis (21Clark J.C. Wert S.E. Bachurski C.J. Stahlman M.T. Stripp B.R. Weaver T.E. Whitsett J.A. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 7794-7798Crossref PubMed Scopus (561) Google Scholar, 22Tokieda K. Whitsett J.A. Clark J.C. Weaver T.E. Ikeda K. McConnell K.B. Jobe A.H. Ikegami M. Iwamoto H.S. Am. J. Physiol. 1997; 273: L875-L882PubMed Google Scholar). However, no significant differences in the expression of the surfactant-associated proteins SP-A, SP-B, SP-C, and SP-D were found between XCE +/+ and XCE −/− mice, indicating that a deficiency of pulmonary surfactant proteins is not the cause for the respiratory failure in XCE −/− animals. The same was true for the Clara cell 10-kDa protein (CC10), another pulmonary differentiation marker. 2A. Schweizer and J. Rohrer, unpublished data. The respiratory distress appears also not to be the result of cardiac problems since no anomalies of the heart or great vessels were found. Furthermore, the heart beat frequency was not significantly affected in XCE −/− mice. Thus, a dysfunction in the central respiratory control becomes a likely possibility for the observed lethality of the XCE −/− newborns. Spontaneous automatic respiration is controlled by the respiratory center in the medulla and transmitted via the spinal chord to motor neurons that control the respiratory muscles. In the rat, for example, phasic respiratory neurons have been located in the ventrolateral part of the medulla oblongata (23Bystrzycka E.K. Nail B.S. Paxinos G. The Rat Nervous System. Academic Press Australia, Sydney1985: 95-110Google Scholar). This is particularly intriguing since the medulla and the spinal chord were among the tissues with the highest expression levels for the XCE mRNA, which is preferentially expressed in the CNS (2Valdenaire O. Richards J.G. Faull R.L.M. Schweizer A. Mol. Brain Res. 1999; 64: 211-221Crossref PubMed Scopus (82) Google Scholar). Although we did not detect obvious abnormalities in the formation of the medulla oblongata or other structures of the CNS in XCE −/− mice by our histopathological examination, the possibility that subtle defects within these structures underlie the loss of vital functions will have to be investigated. For example, these may involve synaptic connections or transmission. The latter possibility is especially attractive since the specific neuronal expression pattern of XCE together with the fact that it belongs to a metallopeptidase family suggests that it may be involved in the maturation of one or several neuropeptide transmitters (2Valdenaire O. Richards J.G. Faull R.L.M. Schweizer A. Mol. Brain Res. 1999; 64: 211-221Crossref PubMed Scopus (82) Google Scholar). An alternative explanation for the lethality of the XCE −/− animals, that we consider, however, less likely, are abnormalities in the respiratory muscles themselves, in particular the muscles of the diaphragm and the intercostal muscles. Targeted disruption has previously been reported for other members of the NEP/ECE zinc metallopeptidase family. No developmental abnormalities have been detected in ECE-2-deficient mice (24.Yanagisawa, M. (1997) 5th International Conference on Endothelins, Sept. 12–15, 1997, Kyoto, Japan, Abstr. O-21.Google Scholar). Mice lacking NEP also appeared developmentally normal except for some minor differences in lymphoid development. However, a strongly enhanced susceptibility to endotoxin shock was observed (25Lu B. Gerard N.P. Kolakowski L.F. Bozza M. Zurakowski D. Finco O. Carrol M.C. Gerard C. J. Exp. Med. 1995; 181: 2271-2275Crossref PubMed Scopus (142) Google Scholar). ECE-1 null mice, on the other hand, showed a lethal phenotype (26Yanagisawa H. Yanagisawa M. Kapur R.P. Richardson J.A. Williams S.C. Clouthier D.E. de Wit D. Emoto N. Hammer R.E. Development. 1998; 125: 825-836Crossref PubMed Google Scholar). Approximately 75% of the ECE-1 −/− embryos died in utero, and the ECE-1 −/− term embryos all died within 30 min of birth from impaired breathing. The ECE-1 −/− mice exhibited severe craniofacial and cardiac abnormalities comparable to the defects seen in ET-1 −/− (27Kurihara Y. Kurihara H. Suzuki H. Kodama T. Maemura K. Nagai R. Oda H. Kuwaki T. Cao W.-H. Kamada N. Jishage K. Ouchi Y. Azuma S. Toyoda Y. Ishikawa T. Kumada M. Yazaki Y. Nature. 1994; 368: 703-710Crossref PubMed Scopus (892) Google Scholar) and endothelin receptor A (ETA) −/− (28Couthier D.E. Hosoda K. Richardson J.A. Williams S.C. Yanagisawa H. Kuwaki T. Kumada M. Hammer R.E. Yanagisawa M. Development. 1998; 125: 813-824PubMed Google Scholar) homozygotes. In addition, enteric neurons and epidermal melanocytes are absent in the ECE-1-deficient embryos, recapitulating the developmental changes found in endothelin receptor B (ETB) −/− (29Hosoda K. Hammer R.E. Richardson J.A. Baynash A.G. Cheung J.C. Giaid A. Yanagisawa M. Cell. 1994; 79: 1267-1276Abstract Full Text PDF PubMed Scopus (893) Google Scholar) and ET-3 −/− (30Baynash A.G. Hosoda K. Giaid A. Richardson J.A. Emoto N. Hammer R.E. Yanagisawa M. Cell. 1994; 79: 1277-1285Abstract Full Text PDF PubMed Scopus (831) Google Scholar) mice. Although XCE −/− homozygous animals share the respiratory failure with the ECE-1 −/−, ET-1 −/−, and ETA −/− mice, we did not detect any of the neural crest-related malformations seen in these animals. For example, none of the craniofacial abnormalities that could narrow the upper airway were found. The observed differences in the phenotypes between XCE −/− mice and knock-out animals of the major proteins of the endothelin system support our recent evidence that XCE does not appear to play a role in this system (2Valdenaire O. Richards J.G. Faull R.L.M. Schweizer A. Mol. Brain Res. 1999; 64: 211-221Crossref PubMed Scopus (82) Google Scholar). In conclusion, the generation of XCE null mice has given insight into the physiological importance of XCE. The disruption of XCE in mice has proven to be incompatible with life after birth. Although further investigations are clearly necessary to precise the exact mechanism of the lethality, our results suggest that XCE may play an essential role in the regulation of the respiratory system. We thank V. Blumberger, V. Dufour, F. Klein, R. Meier, and R. Schmitt for excellent technical assistance. We are grateful to Dr. J.-P. Clozel and Dr. K. Lindpaintner for their encouragement and support. Dr. U. Müller is acknowledged for helpful discussions." @default.
• W2034346500 created "2016-06-24" @default.
• W2034346500 creator A5007864342 @default.
• W2034346500 creator A5009038540 @default.
• W2034346500 creator A5037869214 @default.
• W2034346500 creator A5048849825 @default.
• W2034346500 creator A5054361077 @default.
• W2034346500 creator A5061937749 @default.
• W2034346500 creator A5074491988 @default.
• W2034346500 creator A5077577259 @default.
• W2034346500 date "1999-07-01" @default.
• W2034346500 modified "2023-10-12" @default.
• W2034346500 title "Neonatal Lethality in Mice Deficient in XCE, a Novel Member of the Endothelin-converting Enzyme and Neutral Endopeptidase Family" @default.
• W2034346500 cites W1562766383 @default.
• W2034346500 cites W1895241692 @default.
• W2034346500 cites W1951867641 @default.
• W2034346500 cites W1990402565 @default.
• W2034346500 cites W1998042856 @default.
• W2034346500 cites W1999319209 @default.
• W2034346500 cites W2008101181 @default.
• W2034346500 cites W2008580181 @default.
• W2034346500 cites W2017054020 @default.
• W2034346500 cites W2018139276 @default.
• W2034346500 cites W2025376287 @default.
• W2034346500 cites W2033138908 @default.
• W2034346500 cites W2047130270 @default.
• W2034346500 cites W2054455131 @default.
• W2034346500 cites W2062049304 @default.
• W2034346500 cites W2066602623 @default.
• W2034346500 cites W2074170762 @default.
• W2034346500 cites W2076839619 @default.
• W2034346500 cites W2092842648 @default.
• W2034346500 cites W2109980291 @default.
• W2034346500 cites W2116461923 @default.
• W2034346500 cites W2146046550 @default.
• W2034346500 cites W2167700163 @default.
• W2034346500 cites W2197227471 @default.
• W2034346500 cites W265666328 @default.
• W2034346500 cites W4237821825 @default.
• W2034346500 doi "https://doi.org/10.1074/jbc.274.29.20450" @default.
• W2034346500 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10400672" @default.
• W2034346500 hasPublicationYear "1999" @default.
• W2034346500 type Work @default.
• W2034346500 sameAs 2034346500 @default.
• W2034346500 citedByCount "59" @default.
• W2034346500 countsByYear W20343465002012 @default.
• W2034346500 countsByYear W20343465002013 @default.
• W2034346500 countsByYear W20343465002014 @default.
• W2034346500 countsByYear W20343465002015 @default.
• W2034346500 countsByYear W20343465002016 @default.
• W2034346500 countsByYear W20343465002017 @default.
• W2034346500 countsByYear W20343465002018 @default.
• W2034346500 countsByYear W20343465002019 @default.
• W2034346500 countsByYear W20343465002020 @default.
• W2034346500 countsByYear W20343465002021 @default.
• W2034346500 crossrefType "journal-article" @default.
• W2034346500 hasAuthorship W2034346500A5007864342 @default.
• W2034346500 hasAuthorship W2034346500A5009038540 @default.
• W2034346500 hasAuthorship W2034346500A5037869214 @default.
• W2034346500 hasAuthorship W2034346500A5048849825 @default.
• W2034346500 hasAuthorship W2034346500A5054361077 @default.
• W2034346500 hasAuthorship W2034346500A5061937749 @default.
• W2034346500 hasAuthorship W2034346500A5074491988 @default.
• W2034346500 hasAuthorship W2034346500A5077577259 @default.
• W2034346500 hasBestOaLocation W20343465001 @default.
• W2034346500 hasConcept C104826730 @default.
• W2034346500 hasConcept C126322002 @default.
• W2034346500 hasConcept C134018914 @default.
• W2034346500 hasConcept C144980905 @default.
• W2034346500 hasConcept C170493617 @default.
• W2034346500 hasConcept C181199279 @default.
• W2034346500 hasConcept C185592680 @default.
• W2034346500 hasConcept C20379349 @default.
• W2034346500 hasConcept C2777774944 @default.
• W2034346500 hasConcept C54355233 @default.
• W2034346500 hasConcept C55493867 @default.
• W2034346500 hasConcept C71924100 @default.
• W2034346500 hasConcept C86803240 @default.
• W2034346500 hasConceptScore W2034346500C104826730 @default.
• W2034346500 hasConceptScore W2034346500C126322002 @default.
• W2034346500 hasConceptScore W2034346500C134018914 @default.
• W2034346500 hasConceptScore W2034346500C144980905 @default.
• W2034346500 hasConceptScore W2034346500C170493617 @default.
• W2034346500 hasConceptScore W2034346500C181199279 @default.
• W2034346500 hasConceptScore W2034346500C185592680 @default.
• W2034346500 hasConceptScore W2034346500C20379349 @default.
• W2034346500 hasConceptScore W2034346500C2777774944 @default.
• W2034346500 hasConceptScore W2034346500C54355233 @default.
• W2034346500 hasConceptScore W2034346500C55493867 @default.
• W2034346500 hasConceptScore W2034346500C71924100 @default.
• W2034346500 hasConceptScore W2034346500C86803240 @default.
• W2034346500 hasIssue "29" @default.
• W2034346500 hasLocation W20343465001 @default.
• W2034346500 hasOpenAccess W2034346500 @default.
• W2034346500 hasPrimaryLocation W20343465001 @default.
• W2034346500 hasRelatedWork W1983371938 @default.
• W2034346500 hasRelatedWork W1994496908 @default.
• W2034346500 hasRelatedWork W2032437128 @default.

• next