FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2034364425> ?p ?o ?g. }

• W2034364425 endingPage "12221" @default.
• W2034364425 startingPage "12212" @default.
• W2034364425 abstract "We have discovered a new member of the class I small leucine-rich repeat proteoglycan (SLRP) family which is distinct from the other class I SLRPs since it possesses a unique stretch of aspartate residues at its N terminus. For this reason, we called the molecule asporin. The deduced amino acid sequence is about 50% identical (and 70% similar) to decorin and biglycan. However, asporin does not contain a serine/glycine dipeptide sequence required for the assembly of O-linked glycosaminoglycans and is probably not a proteoglycan. The tissue expression ofasporin partially overlaps with the expression ofdecorin and biglycan. During mouse embryonic development, asporin mRNA expression was detected primarily in the skeleton and other specialized connective tissues; very little asporin message was detected in the major parenchymal organs. The mouse asporin gene structure is similar to that of biglycan and decorin with 8 exons. The asporin gene is localized to human chromosome 9q22–9q21.3 where asporin is part of a SLRP gene cluster that includes extracellular matrix protein 2,osteoadherin, and osteoglycin. Further analysis shows that, with the exception of biglycan, all known SLRP genes reside in three gene clusters. We have discovered a new member of the class I small leucine-rich repeat proteoglycan (SLRP) family which is distinct from the other class I SLRPs since it possesses a unique stretch of aspartate residues at its N terminus. For this reason, we called the molecule asporin. The deduced amino acid sequence is about 50% identical (and 70% similar) to decorin and biglycan. However, asporin does not contain a serine/glycine dipeptide sequence required for the assembly of O-linked glycosaminoglycans and is probably not a proteoglycan. The tissue expression ofasporin partially overlaps with the expression ofdecorin and biglycan. During mouse embryonic development, asporin mRNA expression was detected primarily in the skeleton and other specialized connective tissues; very little asporin message was detected in the major parenchymal organs. The mouse asporin gene structure is similar to that of biglycan and decorin with 8 exons. The asporin gene is localized to human chromosome 9q22–9q21.3 where asporin is part of a SLRP gene cluster that includes extracellular matrix protein 2,osteoadherin, and osteoglycin. Further analysis shows that, with the exception of biglycan, all known SLRP genes reside in three gene clusters. The small leucine-rich repeatproteoglycans (or SLRPs) 1The abbreviations used are: SLRPsmall leucine-rich repeat proteoglycanLRRleucine-rich repeatBACbacterial artificial chromosomeORFopen reading frameRACErapid amplification of cDNA endsdpcdays postcoitumECMextracellular matrixPCRpolymerase chain reactionESTexpressed sequence tagbpbase pair(s)aaamino acidkbkilobase pair(s)MEmouse embryonic are a group of extracellular proteins (ECM) that belong to the leucine-rich repeat (LRR) superfamily of proteins (1Iozzo R.V. Murdoch A.D. FASEB J. 1996; 10: 598-614Crossref PubMed Scopus (550) Google Scholar, 2Hocking A. Shinomura T. McQuillan D. Matrix Biol. 1998; 17: 1-19Crossref PubMed Scopus (416) Google Scholar). The LRR is a protein folding motif composed of 20–30 amino acids with leucines in conserved positions. LRR-containing proteins are present in a broad spectrum of organisms and possess diverse cellular functions and localization (3Kobe B. Deisenhofer J. Trends Biochem. Sci. 1994; 19: 415-421Abstract Full Text PDF PubMed Scopus (1052) Google Scholar). The members of the SLRP subfamily have core proteins of similar size (about 40 kilodaltons) that are dominated by a central domain composed of 6–10 tandemly repeated LRRs. This domain is flanked by smaller, less conserved N-terminal and C-terminal regions containing cysteines in characteristic positions. small leucine-rich repeat proteoglycan leucine-rich repeat bacterial artificial chromosome open reading frame rapid amplification of cDNA ends days postcoitum extracellular matrix polymerase chain reaction expressed sequence tag base pair(s) amino acid kilobase pair(s) mouse embryonic Most of the SLRP proteins are proteoglycans, and the SLRP gene family has been subdivided into 3 classes based on similarities in overall amino acid sequence, spacing of cysteine residues in the N terminus, and gene structure. The previously identified class I members, decorin (4Krusius T. Ruoslahti E. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 7683-7687Crossref PubMed Scopus (415) Google Scholar) and biglycan (5Fisher L.W. Termine J.D. Young M.F. J. Biol. Chem. 1989; 264: 4571-4576Abstract Full Text PDF PubMed Google Scholar), are the most closely related SLRPs based on amino acid sequences; the human sequences are 57% identical. The core proteins contain 10 LRRs, and the N-terminal regions of decorin and biglycan are substituted with one and two chondroitin/dermatan sulfate chains, respectively. The cysteine-rich cluster in the N terminus of class I SLRPs has an amino acid spacing of CX 3CXCX 6C. The mouse decorin (6Scholzen T. Solursh M. Suzuki S. Reiter R. Morgan J.L. Buchberg A.M. Siracusa L.D. Iozzo R.V. J. Biol. Chem. 1994; 269: 28270-28281Abstract Full Text PDF PubMed Google Scholar) and biglycan genes (7Wegrowski Y. Pillarisetti J. Danielson K.G. Suzuki S. Iozzo R.V. Genomics. 1995; 30: 8-17Crossref PubMed Scopus (54) Google Scholar) contain 8 exons. The class II members, fibromodulin (8Oldberg A. Antonsson P. Lindblom K. Heinegard D. EMBO. 1989; 8: 2601-2604Crossref PubMed Scopus (229) Google Scholar), lumican (9Blochberger T. Vergnes J. Hempel J. Hassell J. J. Biol. Chem. 1992; 267: 347-352Abstract Full Text PDF PubMed Google Scholar), PRELP (10Bengtsson E. Neame P.J. Heinegard D. Sommarin Y. J. Biol. Chem. 1995; 270: 25639-25644Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar), keratocan (11Corpuz L.M. Funderburgh J.L. Funderburgh M.L. Bottomley G.S. Prakash S. Conrad G.W. J. Biol. Chem. 1996; 271: 9759-9763Abstract Full Text Full Text PDF PubMed Scopus (197) Google Scholar), and osteoadherin (12Sommarin Y. Wendel M. Shen Z. Hellman U. Heinegard D. J. Biol. Chem. 1998; 273: 16723-16729Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar), have a pairwise amino acid sequence identity between 37 and 55% and have a common gene structure composed of three exons. The cysteine spacing in the N-terminal region of class II SLRPs is identical (CX 3CXCX 9C) but different from the other SLRP classes. The core proteins of class II SLRPs contain 10 LRRs and (with the exception of PRELP) can be substituted with N-linked keratan sulfate glycosaminoglycan chain(s). The class III members, epiphycan/PG-Lb (13Shinomura T. Kimata K. J. Biol. Chem. 1992; 267: 1265-1270Abstract Full Text PDF PubMed Google Scholar, 14Johnson H.J. Rosenberg L. Choi H.U. Garza S. Höök M. Neame P.J. J. Biol. Chem. 1997; 272: 18709-18717Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar), osteoglycin/mimecan (15Madisen L. Neubauer M. Plowman G. Rosen D. Segarini P. Dasch J. Thompson A. Ziman J. Bentz H. Purchio A.F. DNA Cell Biol. 1990; 9: 303-309Crossref PubMed Scopus (75) Google Scholar, 16Funderburgh J.L. Corpuz L.M. Roth M.R. Funderburgh M.L. Tasheva E.S. Conrad G.W. J. Biol. Chem. 1997; 272: 28089-28095Abstract Full Text Full Text PDF PubMed Scopus (167) Google Scholar), and opticin (17Reardon A.J. Le Goff M. Briggs M.D. McLeod D. Sheehan J.K. Thornton D.J. Bishop P.N. J. Biol. Chem. 2000; 275: 2123-2129Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar), have a pairwise amino acid sequence identity between 35 and 42% and have a common gene structure composed of either 7 or 8 exons. Class III SLRPs contain only 6 LRRs, and the cysteine spacing in the N-terminal region is identical (CX 2CXCX 6C) for all members of this class. The recently identified opticin is substituted with O-linked sialylated oligosaccharides, and consequently is a glycoprotein rather than a proteoglycan. On the other hand, osteoglycin/mimecan and epiphycan can be substituted withN-linked keratan sulfate glycosaminoglycan chain(s) andO-linked chondroitin/dermatan sulfate chain(s), respectively. Many of the SLRP proteoglycans can be isolated from tissues without attached glycosaminoglycans, suggesting that they are “part-time” proteoglycans (11Corpuz L.M. Funderburgh J.L. Funderburgh M.L. Bottomley G.S. Prakash S. Conrad G.W. J. Biol. Chem. 1996; 271: 9759-9763Abstract Full Text Full Text PDF PubMed Scopus (197) Google Scholar, 16Funderburgh J.L. Corpuz L.M. Roth M.R. Funderburgh M.L. Tasheva E.S. Conrad G.W. J. Biol. Chem. 1997; 272: 28089-28095Abstract Full Text Full Text PDF PubMed Scopus (167) Google Scholar, 18Grover J. Chen X.N. Korenberg J.R. Roughley P.J. J. Biol. Chem. 1995; 270: 21942-21949Abstract Full Text Full Text PDF PubMed Scopus (164) Google Scholar). Several SLRP proteins display potent effects in vitro. For example, recombinant decorin, biglycan, and fibromodulin bind to transforming growth factor-β in vitro (19Hildebrand A. Romaris M. Rasmussen L. Heingard D. Twardzick D.R. Borders W.A. Ruoslahti E. Biochem. J. 1994; 302: 527-534Crossref PubMed Scopus (866) Google Scholar), and decorin can interfere with transforming growth factor-β-dependent proliferation of Chinese hamster ovary cells (20Yamaguchi Y. Ruoslahti E. Nature. 1988; 336: 244-246Crossref PubMed Scopus (212) Google Scholar). Furthermore, injection of decorin into rats with experimental glomerulonephritis curtailed the abnormal deposition of matrix suggesting that decorin may affect transforming growth factor-β activity also in vivo (21Border W.A. Ruoslahti E. Cell Differ. Dev. 1990; 32: 425-431Crossref PubMed Scopus (62) Google Scholar, 22Border W.A. Noble N.A. Yamamoto T. Harper J.R. Yamaguchi Y. Pierschbacher M.D. Ruoslahti E. Nature. 1992; 360: 361-364Crossref PubMed Scopus (928) Google Scholar). Recently, it has been shown that decorin can down-regulate epidermal growth factor receptor leading to growth suppression, and decorin may act as a natural inhibitor of the epidermal growth factor receptor signaling pathway (23Csordas G. Santra M. Reed C.C. Eichstetter I. McQuillan D.J. Gross D. Nugent M.A. Hajnoczky G. Iozzo R.V. J. Biol. Chem. 2000; 275: 32879-32887Abstract Full Text Full Text PDF PubMed Scopus (199) Google Scholar). The SLRPs have been shown to interact with a variety of extracellular matrix proteins, such as collagens (24Gallagher J.T. Gasiunas N. Schor S.L. Biochem. J. 1983; 215: 107-116Crossref PubMed Scopus (33) Google Scholar), fibronectin (25Schmidt G. Robenek H. Harrach B. Glossl J. Nolte V. Hormann H. Richter H. Kresse H. J. Cell Biol. 1987; 104: 1683-1691Crossref PubMed Scopus (130) Google Scholar), and thrombospondin (26Winnemoller M. Schon P. Vischer P. Kresse H. Eur J. Cell Biol. 1992; 59: 47-55PubMed Google Scholar), as well as serum proteins, heparin cofactor II (27Whinna H.C. Choi H.U. Rosenberg L.C. Church F.C. J. Biol. Chem. 1993; 268: 3920-3924Abstract Full Text PDF PubMed Google Scholar) and C1q (28Krumdieck R. Hook M. Rosenberg L.C. Volanakis J.E. J. Immunol. 1992; 149: 3695-3701PubMed Google Scholar). Biochemical assays have demonstrated that decorin (29Vogel K.G. Paulsson M. Heinegard D. Biochem. J. 1984; 223: 587-597Crossref PubMed Scopus (705) Google Scholar), fibromodulin (30Hedbom E. Heinegard D. J. Biol. Chem. 1989; 264: 6898-6905Abstract Full Text PDF PubMed Google Scholar), and lumican (31Rada J.A. Cornuet P.K. Hassell J.R. Exp. Eye Res. 1993; 56: 635-648Crossref PubMed Scopus (291) Google Scholar) bind to collagens in vitro and modulate collagen fibril formation. Morphological analysis of mouse “knockouts” demonstrates that decorin (32Danielson K.G. Baribault H. Holmes D.F. Graham H. Kadler K.E. Iozzo R.V. J. Cell Biol. 1997; 136: 729-743Crossref PubMed Scopus (1189) Google Scholar), fibromodulin (33Svensson L. Aszodi A. Reinholt F.P. Fassler R. Heinegard D. Oldberg A. J. Biol. Chem. 1999; 274: 9636-9647Abstract Full Text Full Text PDF PubMed Scopus (380) Google Scholar), and lumican (34Chakravarti S. Magnuson T. Lass J.H. Jepsen K.J. LaMantia C. Carroll H. J. Cell Biol. 1998; 141: 1277-1286Crossref PubMed Scopus (581) Google Scholar), respectively, are necessary for normal collagen fibril formation in specialized connective tissues of skin, tendon, and cornea. Therefore, a role for SLRPs in collagen fiber formation is clearly established both in vivo and in vitro. Biglycan-null mice exhibit a mild osteoporosis-like phenotype (35Xu T. Bianco P. Fisher L.W. Longenecker G. Smith E. Goldstein S. Bonadio J. Boskey A. Heegaard A.M. Sommer B. Satomura K. Dominguez P. Zhao C. Kulkarni A.B. Robey P.G. Young M.F. Nat. Genet. 1998; 20: 78-82Crossref PubMed Scopus (389) Google Scholar). However, it is not known if this phenotype is the consequence of a primary defect in collagen fiber formation. Recently, patients with cornea plana 2 (MIM 217300) were shown to have mutations in the keratocan gene, a class II SLRP family member (36Pellegata N.S. Dieguez-Lucena J.L. Joensuu T. Lau S. Montgomery K.T. Krahe R. Kivela T. Kucherlapati R. Forsius H. de la Chapelle A. Nat. Genet. 2000; 25: 91-95Crossref PubMed Scopus (124) Google Scholar). Nucleotide sequencing of a human bacterial artificial chromosome (BAC, RPCI11–917O5), and contigs of overlapping BAC clones revealed that four SLRPs genes (decorin, lumican, keratocan, andepiphycan/PG-Lb) are physically linked on human chromosome 12q (36Pellegata N.S. Dieguez-Lucena J.L. Joensuu T. Lau S. Montgomery K.T. Krahe R. Kivela T. Kucherlapati R. Forsius H. de la Chapelle A. Nat. Genet. 2000; 25: 91-95Crossref PubMed Scopus (124) Google Scholar). Previous genetic linkage studies in the mouse suggested thatdecorin, lumican, and epiphycan map together in a cluster in close proximity to the Mgf gene on mouse chromosome 10, and these genes are deleted in mice that have large deletion mutations at the Steel locus (37Danielson K.G. Siracusa L.D. Donovan P.J. Iozzo R.V. Mamm. Genome. 1999; 10: 201-203Crossref PubMed Scopus (16) Google Scholar). Chromosomal localization of three other SLRPs, fibromodulin(38Sztrolovics R. Chen X.N. Grover J. Roughley P.J. Korenberg J.R. Genomics. 1994; 23: 715-717Crossref PubMed Scopus (37) Google Scholar), PRELP (39Grover J. Chen X. Korenberg J. Recklies A. Roughley P. Genomics. 1996; 38: 109-117Crossref PubMed Scopus (45) Google Scholar), and opticin (40Hobby P. Wyatt M.K. Gan W. Bernstein S. Tomarev S. Slingsby C. Wistow G. Mol. Vis. 2000; 6: 72-78PubMed Google Scholar, 41Friedman J.S. Ducharme R. Raymond V. Walter M.A. Invest. Ophthalmol. Vis. Sci. 2000; 41: 2059-2066PubMed Google Scholar) to human chromosome 1q32 by fluorescent in situ hybridization analysis and/or radiation hybrid mapping raised the possibility that these SLRP genes may also be physically linked. A computer homology search of the genome data bases was, therefore, initiated to look for additional, unidentified SLRP family members that might be associated with these clusters or a yet unidentified cluster. In this study, we identify a novel SLRP family member that belongs to the class I subfamily and is closely related to biglycan and decorin. We have named this new SLRP asporin due to the uniqueaspartate stretch at the N terminus of the translated open reading frame. We report the molecular cloning of the full-length mouse and partial human cDNA and investigate asporin mRNA expression in mouse embryonic development. In addition, we have determined the mouse and human asporin gene structure and discovered that the human asporin gene is part of a SLRP gene cluster on human chromosome 9q21.3–9q22 that also containsosteoadherin, osteoglycin/mimecan, and a gene encoding another LRR-containing protein, ECM2 (42Nishiu J. Tanaka T. Nakamura Y. Genomics. 1998; 52: 378-381Crossref PubMed Scopus (19) Google Scholar). Chemicals and supplies were purchased from Sigma, Fisher, and Intermountain Scientific. Total RNA was extracted from confluent mouse ATDC5 cells (43Atsumi T. Miwa Y. Kimata K. Ikawa Y. Cell Differ Dev. 1990; 30: 109-116Crossref PubMed Scopus (339) Google Scholar) by using the QIAshredder kit and purified with the RNAeasy mini kit (Qiagen, Santa Clarita, CA). Total human heart RNA was obtained from Ambion (Austin, TX). Reverse transcriptase used was SuperScript II (Life Technologies, Inc., Rockville, MD), and first strand cDNA was synthesized by 5′ and 3′-rapid amplification of cDNA ends (5′ and 3′ RACE) using SMARTTM (Switch MechanismAt the 5′ end of RNA Templates) technology (CLONTECH, Palo Alto, CA). The QIAPREP spin miniprep kit and the QIAEX II gel extraction kit (Qiagen) were used to purify DNA. The plasmid vector used in subcloning was pBluescriptKS (Stratagene, La Jolla, CA). Nucleotide sequencing reactions were performed at a University of Texas sequencing core facility. Oligonucleotides were purchased from Sigma-Genosys (Woodlands, TX). Polymerase chain reactions (PCR) were performed with one of the following polymerases: Taq polymerase (Life Technologies, Inc.), Advantage 2 Polymerase Mix (CLONTECH), Pfu Polymerase (Stratagene), or Takara LA Taq TM polymerase (Takara Biomedicals, Japan). PCR products were ligated into a TA-cloning vector (44Marchuk D. Drumm M. Saulino A. Collins F. Nucleic Acids Res. 1990; 19: 1154Crossref Scopus (1130) Google Scholar) or the pGEMTM T-easy vector system (Promega). The mouse poly(A)+ multiple tissue Northern blot was from OriGene Technologies, Inc. The mouse BAC library was from Research Genetics (Huntsville, AL). Radioisotopes [α-32P]dATP and [α-32P]dCTP were purchased from PerkinElmer Life Sciences. Random labeling kits, T7 QuickPrime kit (Amersham Pharmacia Biotech), and DNA Strip-EZ (Ambion, Austin, TX) kit were used. Hybridization fluids used were either Rapid-Hyb (Amersham Pharmacia Biotech) or UltraHyb (Ambion). Imaging film and emulsion were purchased from Kodak (X-Omat AR film and NTB-2 emulsion). The full-length mouse cDNA was obtained by aligning nucleotide sequences of overlapping PCR products. RNA was extracted from mouse ATDC5 cells and first-strand cDNA was synthesized by reverse transcriptase SuperScript II (Life Technologies, Inc.) using the reagents provided in the SMARTTM RACE cDNA amplification kit (CLONTECH). The gene-specific primers for mouseasporin were designed from nucleotide sequences contained in expressed sequence tags (ESTs) that were publicly available in GenBankTM data bases. For 5′ RACE reactions, reverse oligonucleotide primers were designed against mouse EST GenBankTM accession number AI 006670 (MS ASP RV 406, 5′-AGGCTTCACTGGCTCTTTCGTAGGAAAAAG; and MS ASP RV 343, 5′-CGTCATCATCTGTGTCTTCCATATCCTTC). For 3′ RACE reactions, forward oligonucleotides were designed against mouse EST GenBankTMaccession number AA980962 (MS ASP FW 983, 5′-CTTGAAGATCTTAAACGGTACAGGGAACTGC; and MS ASP FW 1077, 5′-CCACGTGTGAGAGAGATACACTTGGAACAC). First round PCR conditions for 5′ and 3′ RACE were as follows: the template-RACE ready cDNA; gene specific oligonucleotides, MS ASP RV 406 (5′ RACE) and MS ASP FW 983 (3′ RACE), 25 cycles (5 s 94 °C, 10 s 60 °C, 2 min 72 °C). First round PCR products were diluted and used as template in a second round “nested” PCR as recommended by the instructions provided with the kit. Nested PCR products for 14 clones harboring 5′ RACE products were resolved electrophoretically on an ethidium bromide-stained 1% agarose gel. Five of the plasmids containing 5′ RACE products of different sizes were sequenced in both directions using the T3 and T7 primers. The largest fragment was called p329, and was used in subsequent Northern, Southern, and in situhybridization experiments. Analysis of this sequence in GenBankTM failed to reveal any homology to known cDNA or genomic sequences. Also, two clones harboring 3′ RACE products of identical size were sequenced in both directions using the T3 and T7 primers. Since the complete open reading frame (ORF) for mouse asporin could not be determined by alignment of overlapping mouse ESTs, two primers (Ms Start FW, 5′-CGCGGATCCAAACCCTTCTTTAGCCCTTCCCAC; Ms Stop RV, 5′-CGCGGATCCTTATTTTCCAACATTCCCAAGCTG) were designed to amplify by PCR the mouse asporin ORF (template of mouse RACE-ready cDNA,Pfu polymerase, 20 cycles (20 s 94 °C, 30 s 60 °C, 2 min 72 °C). The amplified mouse asporin ORF was digested with BamHI restriction enzyme and ligated toBamHI-cleaved pBluescript KS+. The resulting subcloned ORF plasmid was sequenced with three primers: T3, T7, and MS FW 775 (5′-GGACACGTTCAAGGGAATGAATGC) to determine the open reading frame of mouse asporin. Human heart RNA (Ambion) was reverse transcribed to first strand cDNA by using the SMARTTMRACE cDNA amplification kit (CLONTECH). A partial human cDNA was obtained that contained the open reading frame and the 5′-untranslated region. The gene-specific primers for human asporin were designed from nucleotide sequences contained in human ESTs, AK000136, FLJ20129, and AI539334. PCR conditions were as follows: template-human RACE ready cDNA; gene-specific oligonucleotides, HU ASP RV STOP (5′-CCGCTCGAGTTACATTCCAAAGTTCCCAAGCTGAAC) and HU ASP RV 1503 (5′-ACTGCAATAGATGCTTGTTTCTCTCAACCC), 30 cycles (5 s 94 °C, 10 s 60 °C, 2 min 72 °C). PCR-amplified products from first round 5′ RACE reactions were sequenced. Three consecutive Northern hybridizations were performed on a single mouse multi-tissue poly(A)+ RNA blot (Origene). DNA fragments of mouseasporin, biglycan, and decorin cDNAs were random-labeled in separate Northern hybridizations. The asporin probe (p329) is a 478-base pair (bp) PCR-amplified 5′ RACE product that encodes for the 5′ end of the mouse asporin cDNA that includes the 5′-untranslated region (region of cDNA that is encoded by exon I) and a portion of the open reading frame (a fragment of the cDNA that is encoded by exon 2). The biglycan probe (p368) is a 731-bp PCR-amplified fragment that encodes for a portion of the 3′-untranslated region of mouse biglycan (7Wegrowski Y. Pillarisetti J. Danielson K.G. Suzuki S. Iozzo R.V. Genomics. 1995; 30: 8-17Crossref PubMed Scopus (54) Google Scholar). PCR parameters are as follows: primers are MS BGN3, 5′-CCTGAGACCCTGAACGAACTTCACCTGG, and MS BGN4, 5′ CGGTGGCAGTGTGCTCTATCCATCTTTCC; template is mouse RACE-ready cDNA as described previously, 30 cycles (20 s 94 °C, 20 s 60 °C, 1 min 72 °C). The decorin probe (p280) is a 399-bp XbaI/HindIII fragment from the 3′ end of the mouse decorin open reading frame (6Scholzen T. Solursh M. Suzuki S. Reiter R. Morgan J.L. Buchberg A.M. Siracusa L.D. Iozzo R.V. J. Biol. Chem. 1994; 269: 28270-28281Abstract Full Text PDF PubMed Google Scholar). DNA probes were random-labeled by using the Strip-EZTM kit (Ambion). Following an overnight hybridization at 42 °C, the blot was washed under high stringency (1% SDS, 2 × SSC) at 65 °C. The same blot was subjected to 3 separate Northern hybridizations in this order: asporin hybridization, strip blot of probe, decorin hybridization, strip blot of probe, and biglycan hybridization. Radiolabeled probes were removed using Ambion's Strip-EZ technology between consecutive hybridizations. The wash conditions following each hybrization are as follows: asporin, 2 washes of 5 min, film exposure 16 h; decorin, 2 washes of 30 min, film exposure 2 h; biglycan, 3 washes of 10 min, film exposure 7 h. Radioactive Northern blots were exposed to Kodak film (X-Omat AR). A PCR-amplified 5′ RACE product (p329) described earlier was used as a radiolabeled probe in a Southern hybridization to screen a mouse genomic BAC library (Research Genetics). After an overnight hybridization at 65 °C, the blots were washed under high stringency (1% SDS, 2 × SSC) at 65 °C (3 × 15 min) and exposed to x-ray film. Two BAC clones corresponding to positive signals seen on the developed film were purchased from Research Genetics. After annotation of the genomic nucleotide sequence from BAC numberAL137848, the exon/intron boundaries of the human asporingene were determined by aligning homologous regions of this sequence with sequence from available human ESTs. Assuming that the mouse gene structure is similar to the human gene structure, the regions in the mouse cDNA that encoded for exons in the mouse gene were predicted. Forward and reverse primers were designed from regions in the mouse cDNA that were predicted to encode for consecutive exons (i.e. forward primer in exon 1, reverse primer in exon 2). With purified mouse BAC DNA as template, such primer pairs were used in long distance PCR reactions to amplify the introns of the mouseasporin gene. Amplified fragments were separated by electrophoresis on an ethidium bromide-stained 0.8% agarose gel to judge intron size and were subcloned using the pGEMTMT-easy vector system. Subcloned fragments were sequenced with the T7 and SP6 primers to determine the sequence of the mouse exon/intron boundaries. The primer pairs used to amplify the introns of the mouseasporin gene are as follows: intron 1: Asp Ex1 Fw38, 5′-GCACATAGAGGCTGTTAGGAGGGCTGG; Asp Ex2 Rv343, 5′-CGTCATCATCTGTGTCTTCCATATCCTTC; Intron 2: Asp Ex2 Start, 5′-CGCGGATCCAAACCCTTCTTTAGCCCTTCCCAC; Asp Ex3 Rv, 5- 5′-CGAGTATCAAATGGAATGTTGTTTGGAACCG; Intron 3: Asp Ex3 Fw, 5′-GCGTTCCAAACAACATTCCATTTGATACTCG, Asp Ex4 Rv, 5′-GTTGGTTGTGGGATAAATATAGCCTTCTC; Intron 4: Asp Ex4 Fw, 5′-GAGAAGGCTATATTTATCCCACAACCAAC, Asp Ex5 Rv, 5′-CCCTGGTTCTATCCCGTTGTTCTCAAGAGG; Intron 5: Asp Ex5 Fw, 5′-CCTCTTGAGAACAACGGGATAGAACCAGGG, Asp Ex6 Rv, 5′-CTTTGCAGTTCCCTGTACCGTTTAAGATC; Intron 6: Asp Ex6 Fw, 5′-CTTGAAGATCTTAAACGGTACAGGGAACTGC, Asp Ex7 Rv, 5′-GAGTTCCAAGTGTATCTCTCTCACACGTGG; Intron 7: Asp Ex7 Fw, 5′ CCACGTGTGAGAGAGATACACTTGGAACAC, Asp Ex8 Stop, 5′-CGCGGATCCTTATTTTCCAACATTCCCAAGCTG. Cycling parameters are as follows: template, 25 ng of purified BAC DNA, primers at a final concentration of 1 μm, Takara LATaq TM polymerase, 25 cycles (10 s, 98 °C, 6 min 66 °C). During annotation of the nucleotide sequence from BAC number AL137848, the exon/intron boundaries of the human asporin gene were established by aligning homologous regions of the genomic sequence with available human ESTs (i.e. AK000136, FLJ20129, and AI539334), and determining the regions in the human cDNA that encoded for exons in the human gene. The ENSEMBL web site on the Sanger Center server confirmed the location of an open reading frame (ENST00000026531) in BAC number AL137848 that we have named asporin. In situ hybridizations were performed on sections from different stages of mouse embryos. Sections were hybridized with [35S]UTP-labeled antisense or sense RNA probes generated from the plasmid p329 that contains the extreme 5′ end of the mouse asporin cDNA (1–478 bp). Pregnant C57Bl mice were sacrificed on various days post-coitus (dpc), embryos were harvested, rinsed in phosphate-buffered saline/diethyl pyrocarbonate, and fixed in 10% (v/v) formalin in phosphate-buffered saline for 2–25 h. The fixed tissues were dehydrated through a series of increasing ethanol concentrations and then cleared in xylene before being embedded in paraffin. Sections of 7-μm in thickness were mounted onto Superfrost Plus slides (Fisher Scientific, Pittsburgh, PA). Dimineralization was performed by placing the tissue into a solution of 0.1 m Na phosphate, pH 6.5, containing 0.26m EDTA for 2–3 days at room temperature with several changes in between. The tissue was rinsed in diethyl pyrocarbonate/H2O, then dehydrated through a graded series of ethanol concentrations, and embedded and sectioned as described for embryonic tissue. In situ hybridization was performed essentially as described previously (45Zhao Q. Eberspaecher H. Lefebvre V. De Crombrugghe B. Dev. Dyn. 1997; 209: 377-386Crossref PubMed Scopus (441) Google Scholar). Hybridization was carried out at 50 °C for 16–17 h. Two high stringency washes were performed at 55 °C in 50% formamide, 2 × SSC for 20 min each. Autoradiography was carried out using NTB-2 Kodak emulsion. The slides were exposed for 16 h to 7 days at 4 °C. Photomicrographs were taken using both bright and dark-field optics. A novel member of the class I SLRP gene family has been identified and named asporin. The cDNA sequence of human decorin (4Krusius T. Ruoslahti E. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 7683-7687Crossref PubMed Scopus (415) Google Scholar) was used as a query to search the human dbEST data base of GenBankTM using the BLAST-N algorithm. At the time, the nucleotide sequence of several human expressed sequence tags (ESTs AK000136, FLJ20129, and AI539334) exhibited strong homology to the nucleotide sequence of the class I SLRPs, but individual ESTs did not encode a full-length ORF. Furthermore, alignment of overlapping human ESTs did not establish a complete, “in-frame” ORF, so human genomic sequence from BACAL137848 was used to correct the sequencing errors present in the human ESTs and to fill any gaps that were missing from the alignment of overlapping ESTs. These results revealed an open reading frame of 380 amino acids and were later confirmed experimentally by sequencing PCR products generated from 5′ RACE reactions that used reverse transcribed human heart RNA (first-strand cDNA) as template. The transcription start site of human asporin, as well as the open reading frame and 5′-untranslated region, were determined by nucleotide sequencing of 5′ RACE products obtained with the SMART cDNA amplification kit. Several 5′ RACE products were resolved electrophoretically on an ethidium bromide-stained 1% agarose gel (data not shown). No attempts were made to clone the 3′-untranslated region of human asporin. An open reading frame of mouse asporin could not be obtained from overlapping mouse ESTs thus leaving a central gap in the computer-derived sequence. Furthermore, the genomic sequence of mouseasporin was not available in the public data bases. Therefore, oligonucleotide primers were designed from nucleotide sequences present in available 5" @default.
• W2034364425 created "2016-06-24" @default.
• W2034364425 creator A5006841368 @default.
• W2034364425 creator A5010109894 @default.
• W2034364425 creator A5021320601 @default.
• W2034364425 creator A5043121949 @default.
• W2034364425 creator A5050983770 @default.
• W2034364425 creator A5055911010 @default.
• W2034364425 creator A5057469947 @default.
• W2034364425 creator A5062527254 @default.
• W2034364425 creator A5083030958 @default.
• W2034364425 date "2001-04-01" @default.
• W2034364425 modified "2023-10-18" @default.
• W2034364425 title "Expression Pattern and Gene Characterization ofAsporin" @default.
• W2034364425 cites W1491950503 @default.
• W2034364425 cites W1497340641 @default.
• W2034364425 cites W1500193811 @default.
• W2034364425 cites W1506057274 @default.
• W2034364425 cites W1506084650 @default.
• W2034364425 cites W1515550479 @default.
• W2034364425 cites W1520651346 @default.
• W2034364425 cites W1521657513 @default.
• W2034364425 cites W1544527238 @default.
• W2034364425 cites W1588140627 @default.
• W2034364425 cites W1599843882 @default.
• W2034364425 cites W1603078285 @default.
• W2034364425 cites W1748510480 @default.
• W2034364425 cites W1876004289 @default.
• W2034364425 cites W1970030546 @default.
• W2034364425 cites W1972574335 @default.
• W2034364425 cites W197569723 @default.
• W2034364425 cites W1978327680 @default.
• W2034364425 cites W1984143412 @default.
• W2034364425 cites W1984452766 @default.
• W2034364425 cites W2009212790 @default.
• W2034364425 cites W2015502810 @default.
• W2034364425 cites W2017096535 @default.
• W2034364425 cites W2022717979 @default.
• W2034364425 cites W2023494944 @default.
• W2034364425 cites W2023707289 @default.
• W2034364425 cites W2033613795 @default.
• W2034364425 cites W2034277054 @default.
• W2034364425 cites W2051107672 @default.
• W2034364425 cites W2051900610 @default.
• W2034364425 cites W2054482368 @default.
• W2034364425 cites W2061509321 @default.
• W2034364425 cites W2068277926 @default.
• W2034364425 cites W2070013317 @default.
• W2034364425 cites W2073764175 @default.
• W2034364425 cites W2075073611 @default.
• W2034364425 cites W2082340092 @default.
• W2034364425 cites W2083849204 @default.
• W2034364425 cites W2083968791 @default.
• W2034364425 cites W2087282233 @default.
• W2034364425 cites W2093498304 @default.
• W2034364425 cites W2110799319 @default.
• W2034364425 cites W2120347833 @default.
• W2034364425 cites W2121094033 @default.
• W2034364425 cites W2129591536 @default.
• W2034364425 cites W2141877739 @default.
• W2034364425 cites W2144816848 @default.
• W2034364425 cites W2151621078 @default.
• W2034364425 cites W2156854226 @default.
• W2034364425 cites W2157573351 @default.
• W2034364425 cites W2159058635 @default.
• W2034364425 cites W2159375050 @default.
• W2034364425 cites W2163692671 @default.
• W2034364425 cites W2171091522 @default.
• W2034364425 cites W783940612 @default.
• W2034364425 doi "https://doi.org/10.1074/jbc.m011290200" @default.
• W2034364425 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11152695" @default.
• W2034364425 hasPublicationYear "2001" @default.
• W2034364425 type Work @default.
• W2034364425 sameAs 2034364425 @default.
• W2034364425 citedByCount "152" @default.
• W2034364425 countsByYear W20343644252012 @default.
• W2034364425 countsByYear W20343644252013 @default.
• W2034364425 countsByYear W20343644252014 @default.
• W2034364425 countsByYear W20343644252015 @default.
• W2034364425 countsByYear W20343644252016 @default.
• W2034364425 countsByYear W20343644252017 @default.
• W2034364425 countsByYear W20343644252018 @default.
• W2034364425 countsByYear W20343644252019 @default.
• W2034364425 countsByYear W20343644252020 @default.
• W2034364425 countsByYear W20343644252021 @default.
• W2034364425 countsByYear W20343644252022 @default.
• W2034364425 countsByYear W20343644252023 @default.
• W2034364425 crossrefType "journal-article" @default.
• W2034364425 hasAuthorship W2034364425A5006841368 @default.
• W2034364425 hasAuthorship W2034364425A5010109894 @default.
• W2034364425 hasAuthorship W2034364425A5021320601 @default.
• W2034364425 hasAuthorship W2034364425A5043121949 @default.
• W2034364425 hasAuthorship W2034364425A5050983770 @default.
• W2034364425 hasAuthorship W2034364425A5055911010 @default.
• W2034364425 hasAuthorship W2034364425A5057469947 @default.
• W2034364425 hasAuthorship W2034364425A5062527254 @default.
• W2034364425 hasAuthorship W2034364425A5083030958 @default.
• W2034364425 hasBestOaLocation W20343644251 @default.

• next