FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2034384974> ?p ?o ?g. }

• W2034384974 endingPage "13097" @default.
• W2034384974 startingPage "13089" @default.
• W2034384974 abstract "Calnexin is a membrane protein of the endoplasmic reticulum (ER) that functions as a molecular chaperone and as a component of the ER quality control machinery. Calreticulin, a soluble analog of calnexin, is thought to possess similar functions, but these have not been directly demonstrated in vivo. Both proteins contain a lectin site that directs their association with newly synthesized glycoproteins. Although many glycoproteins bind to both calnexin and calreticulin, there are differences in the spectrum of glycoproteins that each binds. Using a Drosophilaexpression system and the mouse class I histocompatibility molecule as a model glycoprotein, we found that calreticulin does possess apparent chaperone and quality control functions, enhancing class I folding and subunit assembly, stabilizing subunits, and impeding export of assembly intermediates from the ER. Indeed, the functions of calnexin and calreticulin were largely interchangeable. We also determined that a soluble form of calnexin (residues 1–387) can functionally replace its membrane-bound counterpart. However, when calnexin was expressed as a soluble protein in L cells, the pattern of associated glycoproteins changed to resemble that of calreticulin. Conversely, membrane-anchored calreticulin bound to a similar set of glycoproteins as calnexin. Therefore, the different topological environments of calnexin and calreticulin are important in determining their distinct substrate specificities. Calnexin is a membrane protein of the endoplasmic reticulum (ER) that functions as a molecular chaperone and as a component of the ER quality control machinery. Calreticulin, a soluble analog of calnexin, is thought to possess similar functions, but these have not been directly demonstrated in vivo. Both proteins contain a lectin site that directs their association with newly synthesized glycoproteins. Although many glycoproteins bind to both calnexin and calreticulin, there are differences in the spectrum of glycoproteins that each binds. Using a Drosophilaexpression system and the mouse class I histocompatibility molecule as a model glycoprotein, we found that calreticulin does possess apparent chaperone and quality control functions, enhancing class I folding and subunit assembly, stabilizing subunits, and impeding export of assembly intermediates from the ER. Indeed, the functions of calnexin and calreticulin were largely interchangeable. We also determined that a soluble form of calnexin (residues 1–387) can functionally replace its membrane-bound counterpart. However, when calnexin was expressed as a soluble protein in L cells, the pattern of associated glycoproteins changed to resemble that of calreticulin. Conversely, membrane-anchored calreticulin bound to a similar set of glycoproteins as calnexin. Therefore, the different topological environments of calnexin and calreticulin are important in determining their distinct substrate specificities. calnexin calreticulin β2-microglobulin endoglycosidase H endoplasmic reticulum influenza hemagglutinin heavy chain of class I histocompatibility molecule, Tm, transmembrane polyacrylamide gel electrophoresis Calnexin (CNX)1 and calreticulin (CRT) are resident ER proteins that bind transiently to many newly synthesized glycoproteins as they pass through the ER (1.Williams D.B. Biochem. Cell Biol. 1995; 73: 123-132Crossref PubMed Scopus (68) Google Scholar,2.Helenius A. Trombetta E.S. Hebert D.N. Simons J.F. Trends Cell Biol. 1997; 7: 193-200Abstract Full Text PDF PubMed Scopus (345) Google Scholar). CNX is a type I membrane protein, whereas CRT resides as a soluble molecule within the ER lumen. CRT and the luminal domain of CNX share extensive amino acid sequence similarity with the highest degree of identity located within a central segment consisting of two tandemly repeated sequence motifs (1.Williams D.B. Biochem. Cell Biol. 1995; 73: 123-132Crossref PubMed Scopus (68) Google Scholar, 3.Michalak M. Milner R.E. Burns K. Opas M. Biochem. J. 1992; 285: 681-692Crossref PubMed Scopus (411) Google Scholar). The repeat sequences contain a high affinity Ca2+ binding site and also form the bulk of a lectin site that specifically recognizes a monoglucosylated Asn-linked processing intermediate, Glc1Man9GlcNAc2 (4.Ware F.E. Vassilakos A. Peterson P.A. Jackson M.R. Lehrman M.A. Williams D.B. J. Biol. Chem. 1995; 270: 4697-4704Abstract Full Text Full Text PDF PubMed Scopus (382) Google Scholar, 5.Spiro R.G. Zhu Q. Bhoyroo V. Soling H.D. J. Biol. Chem. 1996; 271: 11588-11594Abstract Full Text Full Text PDF PubMed Scopus (259) Google Scholar, 6.Vassilakos A. Michalak M. Lehrman M.A. Williams D.B. Biochemistry. 1998; 37: 3480-3490Crossref PubMed Scopus (228) Google Scholar). As a consequence of their lectin functions, both CNX and CRT exhibit a marked preference for binding to Asn-linked glycoproteins (7.Ou W.J. Cameron P.H. Thomas D.Y. Bergeron J.J. Nature. 1993; 364: 771-776Crossref PubMed Scopus (487) Google Scholar, 8.Hammond C. Braakman I. Helenius A. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 913-917Crossref PubMed Scopus (719) Google Scholar). Indeed, treatment of cells with tunicamycin or with castanospermine, an inhibitor that prevents the formation of the Glc1Man9GlcNAc2 oligosaccharide, abrogates the association of CNX and CRT with most glycoproteins (7.Ou W.J. Cameron P.H. Thomas D.Y. Bergeron J.J. Nature. 1993; 364: 771-776Crossref PubMed Scopus (487) Google Scholar, 8.Hammond C. Braakman I. Helenius A. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 913-917Crossref PubMed Scopus (719) Google Scholar, 9.Hammond C. Helenius A. Science. 1994; 266: 456-458Crossref PubMed Scopus (275) Google Scholar, 10.Kearse K.P. Williams D.B. Singer A. EMBO J. 1994; 13: 3678-3686Crossref PubMed Scopus (111) Google Scholar, 11.Peterson J.R. Ora A. Van P.N. Helenius A. Mol. Biol. Cell. 1995; 6: 1173-1184Crossref PubMed Scopus (266) Google Scholar). CNX is thought to function as a molecular chaperone, since its expression enhances the in vivo folding and assembly of class I histocompatibility molecules (12.Vassilakos A. Cohen-Doyle M.F. Peterson P.A. Jackson M.R. Williams D.B. EMBO J. 1996; 15: 1495-1506Crossref PubMed Scopus (170) Google Scholar), the nicotinic acetylcholine receptor (13.Chang W. Gelman M.S. Prives J.M. J. Biol. Chem. 1997; 272: 28925-28932Abstract Full Text Full Text PDF PubMed Scopus (68) Google Scholar), and the vesicular stomatitis G glycoprotein (9.Hammond C. Helenius A. Science. 1994; 266: 456-458Crossref PubMed Scopus (275) Google Scholar). It also prevents the aggregation of various unfolded proteins in vitro (14.Ihara Y. Cohen-Doyle M.F. Saito Y. Williams D.B. Mol. Cell. 1999; 4: 331-341Abstract Full Text Full Text PDF PubMed Scopus (150) Google Scholar). In addition to its chaperone function, CNX participates in quality control, retarding the export of incompletely assembled protein subunits from the ER (15.Jackson M.R. Cohen-Doyle M.F. Peterson P.A. Williams D.B. Science. 1994; 263: 384-387Crossref PubMed Scopus (224) Google Scholar, 16.Rajagopalan S. Xu Y. Brenner M.B. Science. 1994; 263: 387-390Crossref PubMed Scopus (210) Google Scholar, 17.Rajagopalan S. Brenner M.B. J. Exp. Med. 1994; 180: 407-412Crossref PubMed Scopus (84) Google Scholar). CRT is believed to possess similar chaperone and quality control functions, since the simultaneous inhibition of CNX and CRT binding by castanospermine treatment is accompanied by impaired folding and subunit assembly, more rapid degradation, and premature release of glycoproteins from the ER in a variety of model systems (12.Vassilakos A. Cohen-Doyle M.F. Peterson P.A. Jackson M.R. Williams D.B. EMBO J. 1996; 15: 1495-1506Crossref PubMed Scopus (170) Google Scholar, 13.Chang W. Gelman M.S. Prives J.M. J. Biol. Chem. 1997; 272: 28925-28932Abstract Full Text Full Text PDF PubMed Scopus (68) Google Scholar, 18.Moore S.E. Spiro R.G. J. Biol. Chem. 1993; 268: 3809-3812Abstract Full Text PDF PubMed Google Scholar, 19.Tector M. Salter R.D. J. Biol. Chem. 1995; 270: 19638-19642Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar, 20.Hebert D.N. Foellmer B. Helenius A. EMBO J. 1996; 15: 2961-2968Crossref PubMed Scopus (256) Google Scholar, 21.Zhang J.X. Braakman I. Matlack K.E. Helenius A. Mol. Biol. Cell. 1997; 8: 1943-1954Crossref PubMed Scopus (171) Google Scholar, 22.Bass J. Chiu G. Argon Y. Steiner D.F. J. Cell Biol. 1998; 141: 637-646Crossref PubMed Scopus (95) Google Scholar, 23.Toyofuku K. Wada I. Hirosaki K. Park J.S. Hori Y. Jimbow K. J. Biochem. (Tokyo). 1999; 125: 82-89Crossref PubMed Scopus (63) Google Scholar). However, CRT's individual role in these processes has never been examined. A prevalent view of how CNX and CRT associate with folding glycoproteins is that the interaction is regulated by the availability of monoglucosylated oligosaccharides. Following the initial attachment of the Glc3Man9GlcNAc2oligosaccharide to a nascent polypeptide chain, ER glucosidases I and II remove the two outer glucose residues to create the Glc1Man9GlcNAc2 species that is recognized by the lectin site of CNX and CRT. Once formed, complexes of a glycoprotein with CNX or CRT are dissociated through the further action of glucosidase II, which removes the single remaining glucose residue (24.Hebert D.N. Foellmer B. Helenius A. Cell. 1995; 81: 425-433Abstract Full Text PDF PubMed Scopus (490) Google Scholar). Another resident ER enzyme, UDP-glucose:glycoprotein glucosyltransferase, regulates the rebinding of the glycoprotein to CNX and CRT by adding back a single glucose residue to recreate the Glc1Man9GlcNAc2 structure (24.Hebert D.N. Foellmer B. Helenius A. Cell. 1995; 81: 425-433Abstract Full Text PDF PubMed Scopus (490) Google Scholar, 25.van Leeuwen J.E. Kearse K.P. J. Biol. Chem. 1997; 272: 4179-4186Abstract Full Text Full Text PDF PubMed Scopus (44) Google Scholar, 26.Wada I. Kai M. Imai S. Sakane F. Kanoh H. EMBO J. 1997; 16: 5420-5432Crossref PubMed Scopus (79) Google Scholar). The glucosyltransferase is selective in that it only reglucosylates incompletely folded glycoproteins (27.Sousa M. Parodi A.J. EMBO J. 1995; 14: 4196-4203Crossref PubMed Scopus (242) Google Scholar). Hence, cycles of glucose removal and readdition regulate CNX and CRT binding to nonnative glycoproteins with the glucosyltransferase acting as the folding sensor. In this model, CNX and CRT do not function as classical chaperones, but rather the lectin-oligosaccharide interaction itself is thought to enhance folding or subunit assembly, stabilize intermediates, and exert quality control (2.Helenius A. Trombetta E.S. Hebert D.N. Simons J.F. Trends Cell Biol. 1997; 7: 193-200Abstract Full Text PDF PubMed Scopus (345) Google Scholar, 8.Hammond C. Braakman I. Helenius A. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 913-917Crossref PubMed Scopus (719) Google Scholar, 24.Hebert D.N. Foellmer B. Helenius A. Cell. 1995; 81: 425-433Abstract Full Text PDF PubMed Scopus (490) Google Scholar). CNX and CRT may also promote folding by recruiting folding catalysts such as the thiol oxidoreductase, ERp57, to the vicinity of the folding glycoprotein (28.Elliott J.G. Oliver J.D. High S. J. Biol. Chem. 1997; 272: 13849-13855Abstract Full Text Full Text PDF PubMed Scopus (119) Google Scholar,29.Zapun A. Darby N.J. Tessier D.C. Michalak M. Bergeron J.J. Thomas D.Y. J. Biol. Chem. 1998; 273: 6009-6012Abstract Full Text Full Text PDF PubMed Scopus (304) Google Scholar). The question of whether CNX and CRT recognize the polypeptide portion of glycoproteins is controversial. On the one hand, in vitrostudies have shown that CNX and CRT do not discriminate in their binding between reduced and native forms of RNase B and that complexes with RNase B can be dissociated solely by oligosaccharide modification (30.Rodan A.R. Simons J.F. Trombetta E.S. Helenius A. EMBO J. 1996; 15: 6921-6930Crossref PubMed Scopus (139) Google Scholar, 31.Zapun A. Petrescu S.M. Rudd P.M. Dwek R.A. Thomas D.Y. Bergeron J.J.M. Cell. 1997; 88: 29-38Abstract Full Text Full Text PDF PubMed Scopus (185) Google Scholar). Alternatively, there is abundant evidence indicating that CNX and CRT are capable of binding to the polypeptide portion of other glycoprotein substrates (4.Ware F.E. Vassilakos A. Peterson P.A. Jackson M.R. Lehrman M.A. Williams D.B. J. Biol. Chem. 1995; 270: 4697-4704Abstract Full Text Full Text PDF PubMed Scopus (382) Google Scholar, 32.Arunachalam B. Cresswell P. J. Biol. Chem. 1995; 270: 2784-2790Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar, 33.Zhang Q. Tector M. Salter R.D. J. Biol. Chem. 1995; 270: 3944-3948Abstract Full Text Full Text PDF PubMed Scopus (106) Google Scholar, 34.Harris M.R., Yu, Y.Y. Kindle C.S. Hansen T.H. Solheim J.C. J. Immunol. 1998; 160: 5404-5409PubMed Google Scholar, 35.Jannatipour M. Callejo M. Parodi A.J. Armstrong J. Rokeach L.A. Biochemistry. 1998; 37: 17253-17261Crossref PubMed Scopus (29) Google Scholar, 36.Basu S. Srivastava P.K. J. Exp. Med. 1999; 189: 797-802Crossref PubMed Scopus (210) Google Scholar) and that they can discriminate between native and nonnative conformations of both glycosylated and nonglycosylated proteins (14.Ihara Y. Cohen-Doyle M.F. Saito Y. Williams D.B. Mol. Cell. 1999; 4: 331-341Abstract Full Text Full Text PDF PubMed Scopus (150) Google Scholar, 37.Svaerke C. Houen G. Acta Chem. Scand. 1998; 52: 942-949Crossref PubMed Scopus (27) Google Scholar). This raises the possibility that in conjunction with the regulated lectin binding and release cycle, CNX and CRT also bind to unfolded polypeptide segments and promote folding in a manner analogous to classical chaperones. Given the identical lectin specificities of CNX and CRT, it is not surprising that there is overlap in the glycoproteins that they bind and that they can, in some instances, associate simultaneously with the same glycoprotein (2.Helenius A. Trombetta E.S. Hebert D.N. Simons J.F. Trends Cell Biol. 1997; 7: 193-200Abstract Full Text PDF PubMed Scopus (345) Google Scholar). However, it is clear from an examination of the overall spectrum of glycoproteins co-isolated with CNX or CRT that there are distinct differences in binding specificity (11.Peterson J.R. Ora A. Van P.N. Helenius A. Mol. Biol. Cell. 1995; 6: 1173-1184Crossref PubMed Scopus (266) Google Scholar, 38.Wada I. Imai S. Kai M. Sakane F. Kanoh H. J. Biol. Chem. 1995; 270: 20298-20304Abstract Full Text Full Text PDF PubMed Scopus (142) Google Scholar, 39.Van Leeuwen J.E.M. Kearse K.P. J. Biol. Chem. 1996; 271: 25345-25349Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar). Furthermore, it has been demonstrated that the vesicular stomatitis virus G glycoprotein binds to CNX but not to CRT (11.Peterson J.R. Ora A. Van P.N. Helenius A. Mol. Biol. Cell. 1995; 6: 1173-1184Crossref PubMed Scopus (266) Google Scholar) and that CRT dissociates more rapidly than CNX as the folding/assembly of the T cell receptor (39.Van Leeuwen J.E.M. Kearse K.P. J. Biol. Chem. 1996; 271: 25345-25349Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar) and the influenza virus hemagglutinin (40.Hebert D.N. Zhang J.X. Chen W. Foellmer B. Helenius A. J. Cell Biol. 1997; 139: 613-623Crossref PubMed Scopus (221) Google Scholar) proceeds. Also, during the assembly of class I histocompatibility molecules, only CNX binds to the newly synthesized heavy chain, but it is partially or completely replaced by CRT upon subsequent heavy chain assembly with β2-microglobulin (41.Nossner E. Parham P. J. Exp. Med. 1995; 181: 327-337Crossref PubMed Scopus (135) Google Scholar, 42.Sadasivan B. Lehner P.J. Ortmann B. Spies T. Cresswell P. Immunity. 1996; 5: 103-114Abstract Full Text Full Text PDF PubMed Scopus (589) Google Scholar). These observations suggest that the two proteins may collaborate during the biogenesis of various glycoproteins and raise the question of what the functional relationship is between CNX and CRT. Do they possess distinct functions that are utilized at different stages in glycoprotein biogenesis? Alternatively, are they functionally interchangeable but bind differentially to certain glycoproteins by virtue of their distinct membrane versus soluble dispositions or through differences in polypeptide binding specificity? To address these questions, we first asked whether CRT alone is capable of enhancing protein folding and participating in quality control processes in vivo using the well characterized mouse class I histocompatibility molecule as a model glycoprotein. We then compared the results with those previously obtained for CNX to determine the extent to which the functions of these two proteins are interchangeable. Furthermore, we examined the influence of the different topological environments of CNX and CRT by removing the cytoplasmic and transmembrane segments of CNX and assessing the impact on its chaperone/quality control functions and its substrate binding specificity. We found that CRT does indeed function as an apparent chaperone and component of the ER quality control machinery and that these functions are largely interchangeable with those of CNX. Furthermore, CNX retains its functions when expressed as a soluble molecule, but its substrate specificity is altered to resemble that of CRT. D. melanogasterSchneider cells were maintained in Schneider's insect medium (Sigma) with 10% fetal bovine serum and antibiotics. Stably transfected derivatives were cultured in the same medium supplemented with 500 μg/ml Geneticin (Life Technologies, Inc.). Mouse L cells were grown in Dulbecco's modified Eagle's minimum essential medium supplemented with 10% fetal bovine serum and antibiotics. The following mAbs were used for the isolation of class I molecules: mAb 20-8-4S, which reacts with H-2Kb heavy (H) chains associated with β2-microglobulin (β2m) (43.Ozato K. Sachs D.H. J. Immunol. 1981; 126: 317-321PubMed Google Scholar) and mAb 28-14-8S, which recognizes a conformational epitope in the α3 domain of free or β2m-associated Db H chains (44.Ozato K. Hansen T.H. Sachs D.H. J. Immunol. 1980; 125: 2473-2477PubMed Google Scholar). A rabbit antiserum (anti-8) directed against the C terminus of the H-2Kb H chain, which reacts with all conformational states of Kb, was provided by Dr. Brian Barber (University of Toronto) (45.Smith M.H. Parker J.M.R. Hodges R.S. Barber B.H. Mol. Immunol. 1986; 23: 1077-1092Crossref PubMed Scopus (41) Google Scholar). Unassembled mouse class I H chains were isolated using a rabbit antiserum (anti-HC) provided by Dr. Hidde Ploegh, Harvard University (46.Machold R.P. Andree S. Van Kaer L. Ljunggren H.G. Ploegh H.L. J. Exp. Med. 1995; 181: 1111-1122Crossref PubMed Scopus (69) Google Scholar). A rabbit antiserum raised against the C-terminal 14 amino acids of CNX was used to isolate full-length CNX (15.Jackson M.R. Cohen-Doyle M.F. Peterson P.A. Williams D.B. Science. 1994; 263: 384-387Crossref PubMed Scopus (224) Google Scholar), whereas CNX mutants lacking the C terminus were detected with a rabbit antiserum (αpp90) directed against the N-terminal 268 residues of CNX (provided by Dr. Ikuo Wada, Sapporo Medical University). mAb 12CA5 was used to detect influenza hemagglutinin (HA)-tagged CNX and CRT mutants and was provided by Dr. Paul Hamel, (University of Toronto). Fig.1 A depicts the full-length and soluble forms of canine CNX that were expressed in D. melanogaster cells. The insertion of full-length CNX cDNA into the Drosophila expression vector pRMHa3 (CNX-pRMHa3) has been described previously (15.Jackson M.R. Cohen-Doyle M.F. Peterson P.A. Williams D.B. Science. 1994; 263: 384-387Crossref PubMed Scopus (224) Google Scholar). A truncated form of the ER luminal domain corresponding to CNX residues 1–387 (designated CNX 1–387) was generated by inserting an oligocassette, 5′-CCGGATAAGGACGAGCTGTAAGGTACCG-3′/5′-GATCCGGTACCTTACAGCTCGTCCTTAT-3′, containing the KDEL ER localization signal and a stop codon flanked by BspMII and KpnI sites into CNX-pRMHa3 cleaved at the unique BspMII and KpnI sites (KpnI being at the 3′ end of the cDNA in the pRMHa3 multiple cloning site). Rabbit CRT cDNA in the pBluescript vector (pB-CR-2) was obtained from Dr. M. Michalak (University of Alberta). For expression in Drosophila cells, theKpnI/Ecl136II restriction fragment of pB-CR-2, containing full-length CRT cDNA, was subcloned into theKpnI and HincII sites of the pRMHa3 expression vector. In the pRMHa3 vector, cDNAs are under the control of the metallothionein promoter (47.Bunch T.A. Grinblat Y. Goldstein L.S. Nucleic Acids Res. 1988; 16: 1043-1061Crossref PubMed Scopus (369) Google Scholar). Stably transfected D. melanogaster Schneider cell lines were established by co-transfecting a phshsneo plasmid containing the neomycin resistance gene plus multiple pRMHa3 plasmids encoding CRT, CNX, or CNX 1–387 along with H-2Kb or Db H chains in the presence or absence of mouse β2m (15.Jackson M.R. Cohen-Doyle M.F. Peterson P.A. Williams D.B. Science. 1994; 263: 384-387Crossref PubMed Scopus (224) Google Scholar). To ensure that all three proteins, H chain, β2m, and either CRT, CNX, or CNX 1–387, were expressed within one cell, the cells were cloned by the soft agar technique (48.Hapel A.J. Lee J.C. Farrar W.L. Ihle J.N. Cell. 1981; 25: 179-186Abstract Full Text PDF PubMed Scopus (77) Google Scholar) and screened for expression by metabolic radiolabeling and immunoisolation. Six clones were selected for each transfected cell line, and only clones expressing comparable levels of these proteins were used in all subsequent experiments. For expression in mouse L cells, a variety of CNX C-terminal truncation mutants were generated that possessed a hemagglutinin (HA) tag adjacent to the ER localization signal as depicted in Fig. 1 B. Full-length CNX tagged with HA (pCN (HA)) and HA-tagged CRT (pCR (HA)) were generous gifts of Dr. Ikuo Wada (Sapporo Medical University School of Medicine (38.Wada I. Imai S. Kai M. Sakane F. Kanoh H. J. Biol. Chem. 1995; 270: 20298-20304Abstract Full Text Full Text PDF PubMed Scopus (142) Google Scholar)). The Δcyt mutant of CNX tagged with HA (CNX:Δcyt(HA)) was generated by subcloning dog CNX cDNA into theKpnI and XbaI sites of the pcDNA3 vector (Invitrogen; CNX-pcDNA3). Two polymerase chain reaction primers, one upstream from the unique BspMII restriction site, 5′-CCCGAAGATACCAAATCCGG-3′, and the other downstream from the Tm segment, 5′-CCGCGGATCCTTATTGCATCTTTTTCTCGTCAGCATAATCTGGAACATCATATGGATATCCAGAGCAGCAGAAGAGG-3′, were used to generate a polymerase chain reaction fragment that encodes the HA tag inserted adjacent to the adenovirus E3/19K ER localization sequence (Fig. 1 B). The polymerase chain reaction product digested with BspMII and BamHI was subcloned into the compatible sites of CNX-pcDNA3. The ER luminal domain of CNX tagged with HA (CNX:Δcyt,Tm(HA)) was obtained by inserting a double-stranded oligonucleotide cassette, 5′-CGTGGTATCCATATGATGTTCCAGATTATGCTAAGGACGAGCTGTAAG-3′/5′-GATCCTTACAGCTCGTCCTTAGCATAATCTGGAACATCATATGGATAC-3′, encoding the HA tag, followed by the KDEL localization signal into DsaI/Bam-HI-digested CNX-pRMHa3. The mutated CNX insert was isolated by digestion with BspMII andBamHI and subcloned into compatible sites of CNX-pcDNA3. The truncated ER luminal domain of CNX tagged with HA (CNX:Δcyt,Tm,388–462(HA)) was obtained by inserting a double-stranded oligonucleotide cassette, 5′-CCGGATTATCCATATGATGTTCCAGATTATGCTAAGGACGAGCTGTAAG-3′/5′- GATCCTTACAGCTCGTCCTTAGCATAATCTGGAACATCATATGGATAAT-3′, encoding the HA tag, followed by the KDEL localization signal intoBspMII/BamHI-digested CNX-pcDNA3. To replace CNX's transmembrane domain with that of the adenovirus E3/19K glycoprotein, the CNX:Δcyt(HA) construct was digested withKpnI and BamHI and subcloned into theKpnI and BamHI sites of the pRMHa3 vector. The vector was then digested with DsaI and EcoRV, and a double-stranded oligonucleotide cassette, 5′-CGTGGCTCTTTTGTTCCACCGCTCTGCTTATTACAGCGCTTGCTTTGGTATGTACCTTACTTTATCTCAAATACAAAT-3′/5′-ATTTGTATTTGAGATAAAGTAAGGTACATACCAAAGCAAGCGCTGTAATAAGCAGAGCGGTGGAACAAAAGAGC-3′, encod- ing the E3/19 transmembrane domain, was inserted. The 1588-base pair KpnI/BamHI fragment was then subcloned into KpnI/BamHI-digested pcDNA3 and termed CNX:19KTm,Δcyt(HA). cDNA encoding CRT residues −17 to 340 fused to CNX's transmembrane and cytoplasmic segments (residues 459–573) was obtained from Dr. Ikuo Wada (Sapporo Medical University) and designated CRT:CNXTm/cyt(HA) (38.Wada I. Imai S. Kai M. Sakane F. Kanoh H. J. Biol. Chem. 1995; 270: 20298-20304Abstract Full Text Full Text PDF PubMed Scopus (142) Google Scholar). In all cases, the recombinant plasmids were introduced into L cells using Superfect (Qiagen). The cells were analyzed 2 days after transfection. Radiolabeling of Drosophila cells with [35S]Met, lysis, and immunoisolation were carried out as described previously (12.Vassilakos A. Cohen-Doyle M.F. Peterson P.A. Jackson M.R. Williams D.B. EMBO J. 1996; 15: 1495-1506Crossref PubMed Scopus (170) Google Scholar). Briefly, following induction with 1 mm CuSO4 for 16 h, transfectedDrosophila cells were incubated for 30 min in Met-free Schneider's medium. Cells were then radiolabeled with [35S]Met for 5 min, chased for various times, and lysed in a buffer containing 1% digitonin, phosphate-buffered saline, pH 7.4, 10 mm iodoacetamide, 1% aprotinin, and 10 μg/ml each of chymostatin, leupeptin, antipain, and pepstatin. Lysates were incubated for 2 h at 4 °C with amounts of anti-class I or anti-CNX antibodies previously determined to recover in excess of 97% of their respective antigens in a single round of immunoisolation. Immune complexes were recovered by incubation for 1 h with protein A-agarose beads and were analyzed by SDS-PAGE using 10% gels (49.Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207218) Google Scholar). Radioactive proteins were visualized by fluorography. For quantitation of bands, fluorograms were scanned using an EPSON 1000C scanner and analyzed using NIH Image software. L cells at a density of 5 × 105 cells/60-mm dish were radiolabeled for 30 min with 200 μCi/ml [35S]Met, lysed for 30 min at 4 °C in 1 ml of lysis buffer, and incubated with anti-HA antibodies for 2 h. Immune complexes were collected on protein A-agarose and analyzed by SDS-PAGE. Class I histocompatibility molecules are cell surface glycoproteins that function to present peptide fragments of viral or tumor antigens to cytotoxic T cells. They are composed of three subunits: a glycosylated type I transmembrane H chain, a soluble unglycosylated subunit termed β2-microglobulin (β2m), and a peptide ligand of 8–10 amino acids. The interactions of both mouse and human class I molecules with CNX and CRT have been extensively documented (34.Harris M.R., Yu, Y.Y. Kindle C.S. Hansen T.H. Solheim J.C. J. Immunol. 1998; 160: 5404-5409PubMed Google Scholar, 42.Sadasivan B. Lehner P.J. Ortmann B. Spies T. Cresswell P. Immunity. 1996; 5: 103-114Abstract Full Text Full Text PDF PubMed Scopus (589) Google Scholar, 50.Degen E. Williams D.B. J. Cell Biol. 1991; 112: 1099-1115Crossref PubMed Scopus (246) Google Scholar, 51.van Leeuwen J.E. Kearse K.P. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 13997-14001Crossref PubMed Scopus (76) Google Scholar, 52.Solheim J.C. Harris C.S. Kindle C.S. Hansen T.H. J. Immunol. 1997; 158: 2236-2241PubMed Google Scholar). We previously expressed mouse class I H chains and β2m in D. melanogaster Schneider cells and found that Drosophilahomologs of CNX and CRT could not be detected in association with murine class I molecules as assessed either by chemical cross-linking (15.Jackson M.R. Cohen-Doyle M.F. Peterson P.A. Williams D.B. Science. 1994; 263: 384-387Crossref PubMed Scopus (224) Google Scholar) or by co-immunoprecipitation with anti-H chain mAbs (12.Vassilakos A. Cohen-Doyle M.F. Peterson P.A. Jackson M.R. Williams D.B. EMBO J. 1996; 15: 1495-1506Crossref PubMed Scopus (170) Google Scholar). Consistent with this observation, these cells were unable to support the efficient folding or assembly of class I molecules, and they lacked the quality control capacity to retard the export of incompletely assembled class I molecules from the ER. Since Drosophilacells possess genes encoding CNX and CRT and also a deglucosylation-reglucosylation system (53.Smith M.J. DNA Seq. 1992; 3: 247-250Crossref PubMed Scopus (36) Google Scholar, 54.Parker C.G. Fessler L.I. Nelson R.E. Fessler J.H. EMBO J. 1995; 14: 1294-1303Crossref PubMed Scopus (93) Google Scholar, 55.Christodoulou S. Lockyer A.E. Foster J.M. Hoheisel J.D. Roberts D.B. Gene (Amst.). 1997; 191: 143-148Crossref PubMed Scopus (17) Google Scholar), it is unclear whyDrosophila CNX and CRT do not bind detectably to mouse class I H chains. Nevertheless, these cells provide a useful system to assess the functions of mammalian CNX and CRT in class I biogenesis. Indeed, co-expression of mammalian CNX along with class I H chain and β2m in Drosophila cells revealed that CNX promotes efficient H chain folding and assembly with β2m, stabilizes H chain conformation, and functions as a component of the quality control machinery to retain assembly intermediates within the ER (12.Vassilakos A. Cohen-Doyle M.F. Peterson P.A. Jackson M.R. Williams D.B. EMBO J. 1996; 15: 1495-1506Crossref PubMed Scopus (170) Google Scholar, 15.Jackson M.R. Cohen-Doyle M.F. Peterson P.A. Williams D.B. Science. 1994; 263: 384-387Crossref PubMed Scopus (224) Google Scholar). It is important to note, however, that class I molecules do not acquire peptides in Drosophila cells and hence their assembly cannot be studied beyond the formation of H chain-β2m heterodimers (56.Jackson M.R. Song E.S. Yang Y. Peterson P.A. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 12117-12121Crossref PubMed Scopus (125) Google Scholar). Unlike CNX, which binds rapidly to newly synthesized free H chains and is present throughout the" @default.
• W2034384974 created "2016-06-24" @default.
• W2034384974 creator A5030685650 @default.
• W2034384974 creator A5035802962 @default.
• W2034384974 creator A5058688987 @default.
• W2034384974 date "2000-04-01" @default.
• W2034384974 modified "2023-10-12" @default.
• W2034384974 title "Functional Relationship between Calreticulin, Calnexin, and the Endoplasmic Reticulum Luminal Domain of Calnexin" @default.
• W2034384974 cites W1495367630 @default.
• W2034384974 cites W174468170 @default.
• W2034384974 cites W1964225173 @default.
• W2034384974 cites W1965917195 @default.
• W2034384974 cites W1968124895 @default.
• W2034384974 cites W1969965954 @default.
• W2034384974 cites W1970788875 @default.
• W2034384974 cites W1976482695 @default.
• W2034384974 cites W1977146969 @default.
• W2034384974 cites W1983504336 @default.
• W2034384974 cites W1993023866 @default.
• W2034384974 cites W1994947913 @default.
• W2034384974 cites W1999466952 @default.
• W2034384974 cites W2008395942 @default.
• W2034384974 cites W2011239271 @default.
• W2034384974 cites W2022802536 @default.
• W2034384974 cites W2031192254 @default.
• W2034384974 cites W2031815941 @default.
• W2034384974 cites W2034264764 @default.
• W2034384974 cites W2038303530 @default.
• W2034384974 cites W2048671779 @default.
• W2034384974 cites W2050479964 @default.
• W2034384974 cites W2051690692 @default.
• W2034384974 cites W2054414232 @default.
• W2034384974 cites W2055775098 @default.
• W2034384974 cites W2056811071 @default.
• W2034384974 cites W2062925772 @default.
• W2034384974 cites W2064721536 @default.
• W2034384974 cites W2068523436 @default.
• W2034384974 cites W2068920418 @default.
• W2034384974 cites W2069015362 @default.
• W2034384974 cites W2070611888 @default.
• W2034384974 cites W2076312977 @default.
• W2034384974 cites W2081327685 @default.
• W2034384974 cites W2082507157 @default.
• W2034384974 cites W2084416493 @default.
• W2034384974 cites W2084866994 @default.
• W2034384974 cites W2087113665 @default.
• W2034384974 cites W2091797397 @default.
• W2034384974 cites W2100837269 @default.
• W2034384974 cites W2106305244 @default.
• W2034384974 cites W2110392390 @default.
• W2034384974 cites W2119347540 @default.
• W2034384974 cites W212119854 @default.
• W2034384974 cites W2121217914 @default.
• W2034384974 cites W2123311867 @default.
• W2034384974 cites W2126552816 @default.
• W2034384974 cites W2127607652 @default.
• W2034384974 cites W2127714688 @default.
• W2034384974 cites W2129596312 @default.
• W2034384974 cites W2131109999 @default.
• W2034384974 cites W2137300408 @default.
• W2034384974 cites W2143359784 @default.
• W2034384974 cites W2169289630 @default.
• W2034384974 cites W2278551788 @default.
• W2034384974 cites W2280007537 @default.
• W2034384974 cites W277055403 @default.
• W2034384974 cites W3024054742 @default.
• W2034384974 cites W314850542 @default.
• W2034384974 cites W4235927881 @default.
• W2034384974 doi "https://doi.org/10.1074/jbc.275.17.13089" @default.
• W2034384974 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10777614" @default.
• W2034384974 hasPublicationYear "2000" @default.
• W2034384974 type Work @default.
• W2034384974 sameAs 2034384974 @default.
• W2034384974 citedByCount "103" @default.
• W2034384974 countsByYear W20343849742012 @default.
• W2034384974 countsByYear W20343849742013 @default.
• W2034384974 countsByYear W20343849742014 @default.
• W2034384974 countsByYear W20343849742015 @default.
• W2034384974 countsByYear W20343849742016 @default.
• W2034384974 countsByYear W20343849742017 @default.
• W2034384974 countsByYear W20343849742019 @default.
• W2034384974 countsByYear W20343849742020 @default.
• W2034384974 countsByYear W20343849742021 @default.
• W2034384974 countsByYear W20343849742022 @default.
• W2034384974 countsByYear W20343849742023 @default.
• W2034384974 crossrefType "journal-article" @default.
• W2034384974 hasAuthorship W2034384974A5030685650 @default.
• W2034384974 hasAuthorship W2034384974A5035802962 @default.
• W2034384974 hasAuthorship W2034384974A5058688987 @default.
• W2034384974 hasBestOaLocation W20343849741 @default.
• W2034384974 hasConcept C130361206 @default.
• W2034384974 hasConcept C134306372 @default.
• W2034384974 hasConcept C158617107 @default.
• W2034384974 hasConcept C33923547 @default.
• W2034384974 hasConcept C36503486 @default.
• W2034384974 hasConcept C47450691 @default.
• W2034384974 hasConcept C86803240 @default.
• W2034384974 hasConcept C95444343 @default.

• next