FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2034385545> ?p ?o ?g. }

• W2034385545 endingPage "5684" @default.
• W2034385545 startingPage "5677" @default.
• W2034385545 abstract "Ceramide is an important lipid signaling molecule and a key intermediate in sphingolipid biosynthesis. Recent studies have implied a previously unappreciated role for the ceramide N-acyl chain length, inasmuch as ceramides containing specific fatty acids appear to play defined roles in cell physiology. The discovery of a family of mammalian ceramide synthases (CerS), each of which utilizes a restricted subset of acyl-CoAs for ceramide synthesis, strengthens this notion. We now report the characterization of mammalian CerS2. qPCR analysis reveals that CerS2 mRNA is found at the highest level of all CerS and has the broadest tissue distribution. CerS2 has a remarkable acyl-CoA specificity, showing no activity using C16:0-CoA and very low activity using C18:0, rather utilizing longer acyl-chain CoAs (C20–C26) for ceramide synthesis. There is a good correlation between CerS2 mRNA levels and levels of ceramide and sphingomyelin containing long acyl chains, at least in tissues where CerS2 mRNA is expressed at high levels. Interestingly, the activity of CerS2 can be regulated by another bioactive sphingolipid, sphingosine 1-phosphate (S1P), via interaction of S1P with two residues that are part of an S1P receptor-like motif found only in CerS2. These findings provide insight into the biochemical basis for the ceramide N-acyl chain composition of cells, and also reveal a novel and potentially important interplay between two bioactive sphingolipids that could be relevant to the regulation of sphingolipid metabolism and the opposing functions that these lipids play in signaling pathways. Ceramide is an important lipid signaling molecule and a key intermediate in sphingolipid biosynthesis. Recent studies have implied a previously unappreciated role for the ceramide N-acyl chain length, inasmuch as ceramides containing specific fatty acids appear to play defined roles in cell physiology. The discovery of a family of mammalian ceramide synthases (CerS), each of which utilizes a restricted subset of acyl-CoAs for ceramide synthesis, strengthens this notion. We now report the characterization of mammalian CerS2. qPCR analysis reveals that CerS2 mRNA is found at the highest level of all CerS and has the broadest tissue distribution. CerS2 has a remarkable acyl-CoA specificity, showing no activity using C16:0-CoA and very low activity using C18:0, rather utilizing longer acyl-chain CoAs (C20–C26) for ceramide synthesis. There is a good correlation between CerS2 mRNA levels and levels of ceramide and sphingomyelin containing long acyl chains, at least in tissues where CerS2 mRNA is expressed at high levels. Interestingly, the activity of CerS2 can be regulated by another bioactive sphingolipid, sphingosine 1-phosphate (S1P), via interaction of S1P with two residues that are part of an S1P receptor-like motif found only in CerS2. These findings provide insight into the biochemical basis for the ceramide N-acyl chain composition of cells, and also reveal a novel and potentially important interplay between two bioactive sphingolipids that could be relevant to the regulation of sphingolipid metabolism and the opposing functions that these lipids play in signaling pathways. The past decade has seen an upsurge of interest in sphingolipids (SLs), 2The abbreviations used are:SLsphingolipidCerSceramide synthaseESI-MS/MSelectrospray ionization-tandem mass spectrometryHexCerhexosylceramideSKsphingosine kinaseS1Psphingosine 1-phosphateLCliquid chromatographyHAhemagglutininqPCRquantitative PCRsiRNAsmall interference RNACMVcytomegalovirusSMsphingomyelin.2The abbreviations used are:SLsphingolipidCerSceramide synthaseESI-MS/MSelectrospray ionization-tandem mass spectrometryHexCerhexosylceramideSKsphingosine kinaseS1Psphingosine 1-phosphateLCliquid chromatographyHAhemagglutininqPCRquantitative PCRsiRNAsmall interference RNACMVcytomegalovirusSMsphingomyelin. due largely to the extraordinary number of complex species that have been found in eukaryotes (1Merrill Jr., A.H. Wang M.D. Park M. Sullards M.C. Trends Biochem. Sci. 2007; 32: 457-468Abstract Full Text Full Text PDF PubMed Scopus (95) Google Scholar), as well as the involvement of the lipid backbones in signaling pathways as both first and second messengers (2Lahiri S. Futerman A.H. Cell Mol. Life Sci. 2007; 64: 2270-2284Crossref PubMed Scopus (262) Google Scholar, 3Hannun Y.A. Obeid L.M. J. Biol. Chem. 2002; 277: 25847-25850Abstract Full Text Full Text PDF PubMed Scopus (743) Google Scholar, 4Futerman A.H. Hannun Y.A. EMBO Reps. 2004; 5: 777-782Crossref PubMed Scopus (535) Google Scholar). Indeed, ceramide (3Hannun Y.A. Obeid L.M. J. Biol. Chem. 2002; 277: 25847-25850Abstract Full Text Full Text PDF PubMed Scopus (743) Google Scholar) and sphingosine 1-phosphate (S1P) (5Spiegel S. Milstien S. Nat. Rev. Mol. Cell. Biol. 2003; 4: 397-407Crossref PubMed Scopus (1756) Google Scholar) appear to play opposing roles in cell proliferation, migration, and survival, which underscores how the balance of the levels of these two lipids has ramifications for diverse pathological and pathophysiological processes (6Hait N.C. Oskeritzian C.A. Paugh S.W. Milstien S. Spiegel S. Biochim. Biophys. Acta. 2006; 1758: 2016-2026Crossref PubMed Scopus (409) Google Scholar, 7Schenck M. Carpinteiro A. Grassme H. Lang F. Gulbins E. Arch. Biochem. Biophys. 2007; 462: 171-175Crossref PubMed Scopus (77) Google Scholar, 8Ogretmen B. Hannun Y.A. Nat. Rev. Cancer. 2004; 4: 604-616Crossref PubMed Scopus (1006) Google Scholar). sphingolipid ceramide synthase electrospray ionization-tandem mass spectrometry hexosylceramide sphingosine kinase sphingosine 1-phosphate liquid chromatography hemagglutinin quantitative PCR small interference RNA cytomegalovirus sphingomyelin. sphingolipid ceramide synthase electrospray ionization-tandem mass spectrometry hexosylceramide sphingosine kinase sphingosine 1-phosphate liquid chromatography hemagglutinin quantitative PCR small interference RNA cytomegalovirus sphingomyelin. In mammals, ceramide is synthesized by a family of six enzymes, ceramide synthases (CerS) 1–6 (9Pewzner-Jung Y. Ben-Dor S. Futerman A.H. J. Biol. Chem. 2006; 281: 25001-25005Abstract Full Text Full Text PDF PubMed Scopus (362) Google Scholar), each of which uses a relatively restricted subset of fatty acyl-CoAs for N-acylation (10Venkataraman K. Riebeling C. Bodennec J. Riezman H. Allegood J.C. Sullards M.C. Merrill Jr., A.H. Futerman A.H. J. Biol. Chem. 2002; 277: 35642-35649Abstract Full Text Full Text PDF PubMed Scopus (234) Google Scholar, 11Riebeling C. Allegood J.C. Wang E. Merrill Jr., A.H. Futerman A.H. J. Biol. Chem. 2003; 278: 43452-43459Abstract Full Text Full Text PDF PubMed Scopus (246) Google Scholar, 12Mizutani Y. Kihara A. Igarashi Y. Biochem. J. 2005; 390: 263-271Crossref PubMed Scopus (303) Google Scholar) of the sphingoid long chain base. Thus, CerS1 and CerS5, which are the best characterized CerS proteins, synthesize C18- and C16-ceramide, respectively (10Venkataraman K. Riebeling C. Bodennec J. Riezman H. Allegood J.C. Sullards M.C. Merrill Jr., A.H. Futerman A.H. J. Biol. Chem. 2002; 277: 35642-35649Abstract Full Text Full Text PDF PubMed Scopus (234) Google Scholar, 11Riebeling C. Allegood J.C. Wang E. Merrill Jr., A.H. Futerman A.H. J. Biol. Chem. 2003; 278: 43452-43459Abstract Full Text Full Text PDF PubMed Scopus (246) Google Scholar, 13Koybasi S. Senkal C.E. Sundararaj K. Spassieva S. Bielawski J. Osta W. Day T.A. Jiang J.C. Jazwinski S.M. Hannun Y.A. Obeid L.M. Ogretmen B. J. Biol. Chem. 2004; 279: 44311-44319Abstract Full Text Full Text PDF PubMed Scopus (180) Google Scholar, 14Lahiri S. Futerman A.H. J. Biol. Chem. 2005; 280: 33735-33738Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar), whereas CerS2 and -3 appear to have a broader specificity (15Mizutani Y. Kihara A. Igarashi Y. Biochem. J. 2006; 398: 531-538Crossref PubMed Scopus (138) Google Scholar). The existence of these six CerS genes in mammals implies an important and largely unexplored role for ceramides containing specific fatty acids in cell physiology (9Pewzner-Jung Y. Ben-Dor S. Futerman A.H. J. Biol. Chem. 2006; 281: 25001-25005Abstract Full Text Full Text PDF PubMed Scopus (362) Google Scholar). One possibility is that different tissues contain ceramides with defined fatty acids, necessitating the presence of specific CerS in specific tissues for their synthesis. However, with the exception of an early study by semi-quantitative reverse transcription-PCR (11Riebeling C. Allegood J.C. Wang E. Merrill Jr., A.H. Futerman A.H. J. Biol. Chem. 2003; 278: 43452-43459Abstract Full Text Full Text PDF PubMed Scopus (246) Google Scholar), little is known about CerS tissue distribution. This study describes the characterization of CerS2, which has received relatively little attention. We demonstrate that CerS2 mRNA occurs at much higher levels than most other CerS, has the broadest tissue distribution, and synthesizes ceramides containing mainly C20–C26 fatty acids, with little or no synthesis of C16- and C18-ceramides. Moreover, CerS2 activity is inhibited by S1P via interaction of S1P with an S1P receptor-like motif found only in CerS2. This unique link between S1P and a key enzyme of ceramide metabolism might be of significance to understanding the interplay between these two lipids in metabolic and in signaling pathways. Materials—d-erythro-[4,5-3H]Sphinganine was synthesized as described (16Hirschberg K. Rodger J. Futerman A.H. Biochem. J. 1993; 290: 751-757Crossref PubMed Scopus (162) Google Scholar). S1P was from Sigma-Aldrich or from Avanti Polar Lipids (Alabaster, AL); fatty acyl-CoAs and the internal standards for liquid chromatography electrospray ionization-tandem mass spectrometry (LC ESI MS/MS) were also from Avanti. An anti-protein disulfide isomerase antibody was from Stressgen (Victoria, BC, Canada), and an anti-hemagglutinin (HA) antibody was from Santa Cruz Biotechnology (Santa Cruz, CA). Horseradish peroxidase was from Jackson Laboratories (Bar Harbor, MA). Pfu polymerase was from Promega (Madison, WI) or from Stratagene (La Jolla, CA). TaqMan™ was from Applied Biosystems (Foster City, CA). A PerfectPure RNA Kit was from 5Prime (Gaithersburg, MD). A Reverse-iT first strand synthesis kit was from Thermo Scientific (Epsom, UK). Silica gel 60 TLC plates were from Merck. All solvents were of analytical grade and were purchased from Biolab (Jerusalem, Israel). Real-time qPCR—Tissues were harvested from 6- to 8-week-old mice; females were used for all tissues except prostate and testis. RNA was isolated using a PerfectPure RNA kit according to manufacturer's instructions, which included a DNase step. cDNA synthesis was performed using a Reverse-iT first strand synthesis kit using random decamers with 30-min incubation at 42 °C and then at 47 °C. cDNA generation demonstrated equivalent efficiency of synthesis with input RNA ranging from 15 to 500 ng per reaction (supplemental Fig. S1). 100 ng of total RNA was used to determine expression levels of mouse CerS mRNA, using TaqMan™ analysis and a 7300 Sequence Detection System (Applied Biosystems). Relative CerS expression levels were determined in all tissues as compared with brain; quantitative analysis was assessed in brain by comparison to a standard curve generated via dilution of expression plasmids for each gene. To control for variability of RNA input, all PCR reactions were normalized to the amount of hypoxanthine guanine phosphoribosyltransferase 1 mRNA. Primer/probe sets for CerS1 (Mm00433562_m1), CerS2 (Mm00504086_m1), CerS4 (Mm01212479_m1), CerS5 (Mm00510996_g1), and CerS6 (Mm00556165_m1), and for hypoxanthine guanine phosphoribosyltransferase 1 (Mm00446968_m1) were pre-validated sets obtained from Applied Biosystems. CerS3 was custom ordered from Applied Biosystems and designed to span exon 2 and exon 3 (Locus DQ646881). Oligonucleotides used for generation of qPCR templates are given in Table 1.TABLE 1Primers used in the current studyGeneSequenceTmCycles°COligonucleotides used for generation of qPCR templatesaOligonucleotides were used to generate templates for calibration of the qPCR reactions (see supplemental Fig. S1) CerS1Sense-ACAGCCAAGCCCTGCAAA6035Anti-sense-TCCACCACCATGTCTTCGTA CerS2Sense-GGCGCTAGAAGTGGGAAAC6035Anti-sense-TCGAATGACGAGAAAGAGCA CerS3Sense-GCTACACCTCTAGCAAATGCAC6030Anti-sense-ATCTTTCAACCTGGCGCTCT CerS6Sense-TTAATCATCCACGGAACAAGGACCAGTG5530Anti-sense-TTAATCATCCACGGAACAAGGACCAGTGPrimers used to clone CerS2 and for site-directed mutagenesis of CerS2bPrimers A and D were used for amplification of the N terminus of the R230 construct and primers B and C for the C terminus. Primers A and F were used for amplification of the N terminus of the R325 construct and primers B and E for the C terminus. In the second step, the two fragments were annealed using an additional touch-up PCR step. Annealing temperatures of 54 °C were used for the first 5 cycles, and a temperature of 62 °C for the next 30 cycles CerS2-HAPrimer A, CCCAAGCTTATGCTCCAGACCTTGTAT (Hind3)4830Primer B, CCGGAATTCTCATCAAGCGTAATCTGGAACATCGTATGGGTAGTCATTCTTACGATGGTT (EcorI) CerS2 R230APrimer C, CAATTACATCGCAGCTGGGACTCTAATCATGGC54/625/30Primer D, AGTCCCAGCTGCGATGTAATTGGCAAACCAG CerS2 R325APrimer E, TCATTTTGGCCATGGCCCACAAGTTCATAA54/625/30Primer F, GCCATGGCCAAAATGAGGTAGGCCCAGPrimers used for mRNA expression analysis after siRNA treatment CerS25′–GCTGGAGATTCACATTTTAC50255′–GAAGACGATGAAGATGTTGT GAPDH5′–TTAGCACCCCTGGCCAAGG50255′–CTTACTCCTTGGAGGCCATGa Oligonucleotides were used to generate templates for calibration of the qPCR reactions (see supplemental Fig. S1)b Primers A and D were used for amplification of the N terminus of the R230 construct and primers B and C for the C terminus. Primers A and F were used for amplification of the N terminus of the R325 construct and primers B and E for the C terminus. In the second step, the two fragments were annealed using an additional touch-up PCR step. Annealing temperatures of 54 °C were used for the first 5 cycles, and a temperature of 62 °C for the next 30 cycles Open table in a new tab Short Interfering RNA (siRNA)—siRNAs were subcloned into the pSUPER vector according to the manufacturer's instructions (OligoEngine, Seattle, WA). Two siRNA targets were chosen for CerS2: siCerS2i, 5′-AAGCAGGTGGAAGTAGAGCTTTT-3′, and siCerS2ii, 5′-AAGCCAGCTGGAGATTCACATTT-3′. The sequences were chosen because they recognize all known CerS2 isoforms (9Pewzner-Jung Y. Ben-Dor S. Futerman A.H. J. Biol. Chem. 2006; 281: 25001-25005Abstract Full Text Full Text PDF PubMed Scopus (362) Google Scholar) and do not recognize other CerS genes. CerS2 knockdown was accomplished by transfecting Hek cells with the pSUPER vector using the calcium phosphate method. After various times of incubation, total RNA was extracted using the RNeasy Mini Kit (Qiagen). Reverse transcription was performed using the EZ-First strand cDNA synthesis kit (Biological Industries, Beit Haemek, Israel), and PCR was performed using the primers listed in Table 1. Cell Culture and Transfection—Human embryonic kidney cells (Hek 293) were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum, 100 IU/ml penicillin, and 100 μg/ml streptomycin. Hek 293 cells were transfected with human CerS genes using the calcium phosphate method (0.25 μg of plasmid per cm2 of culture dish), which gave ∼90% transfection efficiency. Human CerS genes (17Lahiri S. Lee H. Mesicek J. Fuks Z. Haimovitz-Friedman A. Kolesnick R.N. Futerman A.H. FEBS Lett. 2007; 581: 5289-5294Crossref PubMed Scopus (64) Google Scholar) in a pCMV vector, with an N terminus FLAG tag, were obtained from Dr. Richard Kolesnick (Sloan Kettering Institute). CerS2 was subsequently subcloned into a pcDNA3 vector containing an HA tag, which was located at the C terminus (CerS2-HA). Site-directed mutagenesis of CerS2-HA was performed using 2-Step PCR and Touch-up cycling conditions. ESI-MS/MS—SL analyses by ESI-MS/MS were conducted using a PE-Sciex API 3000 triple quadrupole mass spectrometer and an ABI 4000 quadrupole-linear ion trap mass spectrometer as described previously (10Venkataraman K. Riebeling C. Bodennec J. Riezman H. Allegood J.C. Sullards M.C. Merrill Jr., A.H. Futerman A.H. J. Biol. Chem. 2002; 277: 35642-35649Abstract Full Text Full Text PDF PubMed Scopus (234) Google Scholar, 11Riebeling C. Allegood J.C. Wang E. Merrill Jr., A.H. Futerman A.H. J. Biol. Chem. 2003; 278: 43452-43459Abstract Full Text Full Text PDF PubMed Scopus (246) Google Scholar, 18Sullards M.C. Merrill Jr., A.H. Science's STKE. 2001http://stke.sciencemag.org/cgi/content/full/OC_sigtrans;2001/67/pl1Google Scholar, 19Merrill Jr., A.H. Sullards M.C. Allegood J.C. Kelly S. Wang E. Methods. 2005; 36: 207-224Crossref PubMed Scopus (465) Google Scholar). Hek 293 cells were transfected with pcDNA, human CerS2, or siRNA and after 36 h, harvested by trypsinization, collected by centrifugation, washed twice with ice-cold phosphate-buffered saline, and lyophilized. The samples were spiked with an SL internal standard mixture (Avanti Polar Lipids) then extracted and analyzed by LC ESI-MS/MS (10Venkataraman K. Riebeling C. Bodennec J. Riezman H. Allegood J.C. Sullards M.C. Merrill Jr., A.H. Futerman A.H. J. Biol. Chem. 2002; 277: 35642-35649Abstract Full Text Full Text PDF PubMed Scopus (234) Google Scholar, 11Riebeling C. Allegood J.C. Wang E. Merrill Jr., A.H. Futerman A.H. J. Biol. Chem. 2003; 278: 43452-43459Abstract Full Text Full Text PDF PubMed Scopus (246) Google Scholar, 18Sullards M.C. Merrill Jr., A.H. Science's STKE. 2001http://stke.sciencemag.org/cgi/content/full/OC_sigtrans;2001/67/pl1Google Scholar, 19Merrill Jr., A.H. Sullards M.C. Allegood J.C. Kelly S. Wang E. Methods. 2005; 36: 207-224Crossref PubMed Scopus (465) Google Scholar). For tissue analyses, the tissues were obtained from C57BL/6 mice at 7 weeks of age, homogenized as described above, and aliquots were lyophilized. Samples corresponding to 1 mg of lyophilized tissue were spiked with the SL internal standard mixture, extracted, and analyzed by LC ESI MS/MS. CerS Assay—CerS activity was assayed as described previously (10Venkataraman K. Riebeling C. Bodennec J. Riezman H. Allegood J.C. Sullards M.C. Merrill Jr., A.H. Futerman A.H. J. Biol. Chem. 2002; 277: 35642-35649Abstract Full Text Full Text PDF PubMed Scopus (234) Google Scholar, 11Riebeling C. Allegood J.C. Wang E. Merrill Jr., A.H. Futerman A.H. J. Biol. Chem. 2003; 278: 43452-43459Abstract Full Text Full Text PDF PubMed Scopus (246) Google Scholar, 14Lahiri S. Futerman A.H. J. Biol. Chem. 2005; 280: 33735-33738Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar) using Hek 293 cell homogenates and 0.25 μCi of [4,5-3H]sphinganine/15 μm sphinganine/20 μm defatted-bovine serum albumin/50 μm fatty acyl-CoA for 20 min at 37 °C (17Lahiri S. Lee H. Mesicek J. Fuks Z. Haimovitz-Friedman A. Kolesnick R.N. Futerman A.H. FEBS Lett. 2007; 581: 5289-5294Crossref PubMed Scopus (64) Google Scholar). Different amounts of protein were used for homogenates obtained from cells transfected with different CerS protein in order that the time of the reaction was linear with respect to protein (17Lahiri S. Lee H. Mesicek J. Fuks Z. Haimovitz-Friedman A. Kolesnick R.N. Futerman A.H. FEBS Lett. 2007; 581: 5289-5294Crossref PubMed Scopus (64) Google Scholar), and different acyl-CoAs were used in accordance with the substrate specificity of each CerS (10Venkataraman K. Riebeling C. Bodennec J. Riezman H. Allegood J.C. Sullards M.C. Merrill Jr., A.H. Futerman A.H. J. Biol. Chem. 2002; 277: 35642-35649Abstract Full Text Full Text PDF PubMed Scopus (234) Google Scholar, 11Riebeling C. Allegood J.C. Wang E. Merrill Jr., A.H. Futerman A.H. J. Biol. Chem. 2003; 278: 43452-43459Abstract Full Text Full Text PDF PubMed Scopus (246) Google Scholar, 12Mizutani Y. Kihara A. Igarashi Y. Biochem. J. 2005; 390: 263-271Crossref PubMed Scopus (303) Google Scholar, 14Lahiri S. Futerman A.H. J. Biol. Chem. 2005; 280: 33735-33738Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar, 15Mizutani Y. Kihara A. Igarashi Y. Biochem. J. 2006; 398: 531-538Crossref PubMed Scopus (138) Google Scholar) (CerS1, 100 μg of protein, C18-CoA; CerS2, 150 μg of protein, C22-CoA; CerS3, 200 μg of protein, C24-CoA; CerS4, 200 μg of protein, C20-CoA; CerS5 and CerS6, 50 μg of protein, C16-CoA). For inhibition assays, S1P, dissolved in methanol, was added to the reaction mix prior to addition of substrates. Immunofluorescence—The intracellular localization of human CerS2-HA was performed by confocal laser scanning microscopy as described for CerS4 and -5 (11Riebeling C. Allegood J.C. Wang E. Merrill Jr., A.H. Futerman A.H. J. Biol. Chem. 2003; 278: 43452-43459Abstract Full Text Full Text PDF PubMed Scopus (246) Google Scholar), using MitoTracker Deep Red as a mitochondrial marker and protein disulfide isomerase as an endoplasmic reticulum marker. CerS Expression in Mouse Tissues—An early study examining the tissue distribution of CerS mRNA by semi-quantitative reverse transcription-PCR suggested that each CerS has a somewhat unique tissue distribution, with CerS2 (trh3) mRNA the most ubiquitously expressed (11Riebeling C. Allegood J.C. Wang E. Merrill Jr., A.H. Futerman A.H. J. Biol. Chem. 2003; 278: 43452-43459Abstract Full Text Full Text PDF PubMed Scopus (246) Google Scholar). We have now established robust reaction conditions for real-time quantitative PCR (qPCR), in which the reactions are linear over 8 to 10 orders of magnitude and are >99% efficient (supplemental Fig. S2). Using these conditions, we analyzed CerS mRNA levels in 14 mouse tissues. In agreement with the earlier study (11Riebeling C. Allegood J.C. Wang E. Merrill Jr., A.H. Futerman A.H. J. Biol. Chem. 2003; 278: 43452-43459Abstract Full Text Full Text PDF PubMed Scopus (246) Google Scholar), CerS2 is ubiquitously expressed. However, due to the linearity and sensitivity of qPCR, we now demonstrate that CerS2 mRNA expression levels are significantly higher than those of the other five CerS genes, in some cases as much as an order of magnitude higher (Fig. 1). Highest CerS2 expression (30–40 molecules RNA/pg of total RNA) was detected in liver and kidney (Fig. 1), with lower levels (∼5 molecules RNA/pg of total RNA) in most other tissues. In contrast, CerS1 and -3 were expressed mainly in brain and skeletal muscle, and in skin and testis (15Mizutani Y. Kihara A. Igarashi Y. Biochem. J. 2006; 398: 531-538Crossref PubMed Scopus (138) Google Scholar), respectively, and were virtually undetectable in other tissues. CerS4 was expressed at the highest levels in skin, leukocytes, heart, and liver and, in the other tissues, was expressed at levels of 1–2 molecules/pg of total RNA (Fig. 1). CerS5 and -6 were expressed in most tissues, with expression levels of 1–3 molecules/pg of total RNA (Fig. 1). CerS2 expression tended to be low in tissues expressing highest levels of CerS1 or CerS3. Acyl-CoA Specificity and Intracellular Localization of CerS2—We next examined the specificity of CerS2 toward acyl-CoAs. Phylogenetically, CerS2 is most closely related to CerS3 (9Pewzner-Jung Y. Ben-Dor S. Futerman A.H. J. Biol. Chem. 2006; 281: 25001-25005Abstract Full Text Full Text PDF PubMed Scopus (362) Google Scholar), which was suggested to synthesize ceramides containing mainly C16:0 and C24:0 fatty acids (15Mizutani Y. Kihara A. Igarashi Y. Biochem. J. 2006; 398: 531-538Crossref PubMed Scopus (138) Google Scholar). ESI-MS/MS demonstrated, in contrast, that CerS2 uses a wider range of acyl-CoAs, synthesizing ceramides containing C20:0, C22:0, C24:1, C24:0, C26:1, and C26:0 fatty acids (Fig. 2A), but notably, does not synthesize ceramides containing C16:0 fatty acids and synthesizes only low, and statistically insignificant levels of C18:0-ceramide. In vitro analysis of CerS2 activity using a range of acyl-CoAs (Fig. 2B) was entirely consistent with ESI-MS/MS analysis. To confirm the acyl-CoA specificity of CerS2, cells were transfected with two different siRNAs in a pSUPER vector, and compared with cells incubated with the pSUPER vector alone. CerS2 mRNA levels were significantly reduced 24 h after transfection with siCerS2ii and 72 h after transfection with siCerS2i (Fig. 3A). CerS activity, using C22:0-acyl-CoA as substrate, revealed a more rapid loss of activity after transfection with siCerS2ii compared with siCerS2i. Examination of levels of ceramides by ESI-MS/MS after transfection with siCerS2ii (Fig. 3C) was consistent with ESI-MS/MS data obtained after overexpression of CerS2 (Fig. 2A). Thus, CerS2 has a completely different profile of use of acyl-CoAs than the other CerS, using mainly medium- to long-chain CoAs, but is unable to synthesize C16:0- and C18:0-ceramides. Similar to other CerS for which the intracellular localization has been examined by immunofluorescence after overexpression (10Venkataraman K. Riebeling C. Bodennec J. Riezman H. Allegood J.C. Sullards M.C. Merrill Jr., A.H. Futerman A.H. J. Biol. Chem. 2002; 277: 35642-35649Abstract Full Text Full Text PDF PubMed Scopus (234) Google Scholar, 11Riebeling C. Allegood J.C. Wang E. Merrill Jr., A.H. Futerman A.H. J. Biol. Chem. 2003; 278: 43452-43459Abstract Full Text Full Text PDF PubMed Scopus (246) Google Scholar), rather than by biochemical isolation of mitochondrial fractions (20Yu J. Novgorodov S.A. Chudakova D. Zhu H. Bielawska A. Bielawski J. Obeid L.M. Kindy M.S. Gudz T.I. J. Biol. Chem. 2007; 282: 25940-25949Abstract Full Text Full Text PDF PubMed Scopus (123) Google Scholar), CerS2 is localized to the endoplasmic reticulum (Fig. 4), with no co-localization with a mitochondrial marker (21Futerman A.H. Biochim. Biophys. Acta. 2006; 1758: 1885-1892Crossref PubMed Scopus (55) Google Scholar). Relationship between CerS mRNA Expression and Ceramide N-Acyl Chain Composition—Although CerS2 mRNA is widely distributed and found at high levels in various tissues (Fig. 1), nothing is known about how this is related to levels of expression of the CerS2 protein or of the relative proportions of ceramides containing C20:0-C26:0-fatty acids, the subspecies synthesized by CerS2 (Figs. 2 and 3). Because there are no antibodies currently available to mouse CerS2, 3A commercial antibody is available for human CerS2 but unfortunately shows no cross-reactivity to mouse CerS2. we examined the ceramide subspecies distribution by LC ESI-MS/MS to determine if tissues that display high levels of CerS2 mRNA are enriched in the corresponding ceramide subspecies in ceramides, sphingomyelin (SM), and monohexosylceramide (HexCer) (Fig. 5). Comparison of the ceramide N-acyl chain distribution with that of the relative levels of expression of CerS mRNA (Fig. 5) reveals that the two tissues with highest CerS2 mRNA levels, kidney and liver, also have the highest proportions of C22- to C24-ceramides. Kidney also has high proportions of C22–C24 acyl chains in SM and HexCer (Fig. 5) as does liver, although the N-acyl chain composition of HexCer differs from that of ceramides and SM. For the other three tissues (brain, testis, and skeletal muscle), CerS2 is less prevalent than the mRNAs of the other CerS, and the proportions of C22-, C24-, and C24:1-ceramides and -SMs are correspondingly lower. Interestingly, for two of these tissues (brain and skeletal muscle), HexCer contains surprisingly high proportions of C22–C24-ceramides, suggesting that there are factors other than the relative amounts of the CerS mRNA that affect the subspecies distribution, particularly in downstream complex SLs and glyco-SLs. Inhibition of CerS2 Activity by S1P—A number of studies have proposed that S1P and/or SK may negatively regulate ceramide synthesis, and this interaction may be one of the potential mechanisms by which S1P mediates its pro-survival effects (22Maceyka M. Sankala H. Hait N.C. Le Stunff H. Liu H. Toman R. Collier C. Zhang M. Satin L.S. Merrill Jr., A.H. Milstien S. Spiegel S. J. Biol. Chem. 2005; 280: 37118-37129Abstract Full Text Full Text PDF PubMed Scopus (487) Google Scholar, 23Mandala S.M. Thornton R. Galve-Roperh I. Poulton S. Peterson C. Olivera A. Bergstrom J. Kurtz M.B. Spiegel S. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 7859-7864Crossref PubMed Scopus (174) Google Scholar, 24Johnson K.R. Johnson K.Y. Becker K.P. Bielawski J. Mao C. Obeid L.M. J. Biol. Chem. 2003; 278: 34541-34547Abstract Full Text Full Text PDF PubMed Scopus (132) Google Scholar); however, there is no evidence showing direct modulation of ceramide synthesis by S1P. We therefore examined whether S1P can affect the activity of CerS proteins in vitro. S1P, at concentrations up to 25 μm, had no effect on ceramide synthesis by CerS1, -3, -4, -5, and -6, but surprisingly, inhibited CerS2 activity (Fig. 6A) by a non-competitive mode of inhibition (Fig. 6, B and C). The non-competitive inhibition suggested that S1P was not directly binding to the active site of CerS2 but rather at a regulatory site. Using blocks analysis (Block Searcher, version 8/22/03.1) 4Blocks are multiply aligned ungapped segments corresponding to the most highly conserved regions of proteins. for all CerS protein sequences (with the default parameters of the program) we found that a region of CerS2 has limited homology to two of seven blocks of the S1P receptors (Fig. 7) (25Zondag G.C. Postma F.R. Etten I.V. Verlaan I. Moolenaar W.H. Biochem. J. 1998; 330: 605-609Crossref PubMed Scopus (237) Google Scholar). The combined e-value of the two blocks was 0.86 (Fig. 7). No significant homology to S1P receptors was identified by blocks analysis in any other CerS proteins. Within these regions, two residues were identified as essential for S1P binding to the S1P1 receptor (26Parrill A.L. Wang D. Bautista D.L. Van Brocklyn J.R. Lorincz Z. Fischer D.J. Baker D.L. Liliom K. Spiegel S. Tig" @default.
• W2034385545 created "2016-06-24" @default.
• W2034385545 creator A5000703027 @default.
• W2034385545 creator A5002672605 @default.
• W2034385545 creator A5021016915 @default.
• W2034385545 creator A5021535678 @default.
• W2034385545 creator A5030084923 @default.
• W2034385545 creator A5048423819 @default.
• W2034385545 creator A5058946495 @default.
• W2034385545 date "2008-02-01" @default.
• W2034385545 modified "2023-10-10" @default.
• W2034385545 title "Characterization of Ceramide Synthase 2" @default.
• W2034385545 cites W1552069588 @default.
• W2034385545 cites W1815261168 @default.
• W2034385545 cites W1822814854 @default.
• W2034385545 cites W1977644244 @default.
• W2034385545 cites W1982533264 @default.
• W2034385545 cites W1990115856 @default.
• W2034385545 cites W1998796501 @default.
• W2034385545 cites W2000673878 @default.
• W2034385545 cites W2001956269 @default.
• W2034385545 cites W2008083733 @default.
• W2034385545 cites W2011767107 @default.
• W2034385545 cites W2013392094 @default.
• W2034385545 cites W2014923090 @default.
• W2034385545 cites W2015963944 @default.
• W2034385545 cites W2022770236 @default.
• W2034385545 cites W2028378028 @default.
• W2034385545 cites W2029641949 @default.
• W2034385545 cites W2030639205 @default.
• W2034385545 cites W2031449170 @default.
• W2034385545 cites W2032315776 @default.
• W2034385545 cites W2032620622 @default.
• W2034385545 cites W2048608770 @default.
• W2034385545 cites W2049621872 @default.
• W2034385545 cites W2051159732 @default.
• W2034385545 cites W2063564139 @default.
• W2034385545 cites W2069386104 @default.
• W2034385545 cites W2079048898 @default.
• W2034385545 cites W2090977730 @default.
• W2034385545 cites W2093504182 @default.
• W2034385545 cites W2106244437 @default.
• W2034385545 cites W2108091182 @default.
• W2034385545 cites W2112583319 @default.
• W2034385545 cites W2131811820 @default.
• W2034385545 doi "https://doi.org/10.1074/jbc.m707386200" @default.
• W2034385545 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/18165233" @default.
• W2034385545 hasPublicationYear "2008" @default.
• W2034385545 type Work @default.
• W2034385545 sameAs 2034385545 @default.
• W2034385545 citedByCount "389" @default.
• W2034385545 countsByYear W20343855452012 @default.
• W2034385545 countsByYear W20343855452013 @default.
• W2034385545 countsByYear W20343855452014 @default.
• W2034385545 countsByYear W20343855452015 @default.
• W2034385545 countsByYear W20343855452016 @default.
• W2034385545 countsByYear W20343855452017 @default.
• W2034385545 countsByYear W20343855452018 @default.
• W2034385545 countsByYear W20343855452019 @default.
• W2034385545 countsByYear W20343855452020 @default.
• W2034385545 countsByYear W20343855452021 @default.
• W2034385545 countsByYear W20343855452022 @default.
• W2034385545 countsByYear W20343855452023 @default.
• W2034385545 crossrefType "journal-article" @default.
• W2034385545 hasAuthorship W2034385545A5000703027 @default.
• W2034385545 hasAuthorship W2034385545A5002672605 @default.
• W2034385545 hasAuthorship W2034385545A5021016915 @default.
• W2034385545 hasAuthorship W2034385545A5021535678 @default.
• W2034385545 hasAuthorship W2034385545A5030084923 @default.
• W2034385545 hasAuthorship W2034385545A5048423819 @default.
• W2034385545 hasAuthorship W2034385545A5058946495 @default.
• W2034385545 hasBestOaLocation W20343855451 @default.
• W2034385545 hasConcept C112243037 @default.
• W2034385545 hasConcept C181199279 @default.
• W2034385545 hasConcept C185592680 @default.
• W2034385545 hasConcept C190283241 @default.
• W2034385545 hasConcept C2777851122 @default.
• W2034385545 hasConcept C2779237115 @default.
• W2034385545 hasConcept C55493867 @default.
• W2034385545 hasConceptScore W2034385545C112243037 @default.
• W2034385545 hasConceptScore W2034385545C181199279 @default.
• W2034385545 hasConceptScore W2034385545C185592680 @default.
• W2034385545 hasConceptScore W2034385545C190283241 @default.
• W2034385545 hasConceptScore W2034385545C2777851122 @default.
• W2034385545 hasConceptScore W2034385545C2779237115 @default.
• W2034385545 hasConceptScore W2034385545C55493867 @default.
• W2034385545 hasIssue "9" @default.
• W2034385545 hasLocation W20343855451 @default.
• W2034385545 hasOpenAccess W2034385545 @default.
• W2034385545 hasPrimaryLocation W20343855451 @default.
• W2034385545 hasRelatedWork W104784336 @default.
• W2034385545 hasRelatedWork W1590322197 @default.
• W2034385545 hasRelatedWork W1993207934 @default.
• W2034385545 hasRelatedWork W2017859854 @default.
• W2034385545 hasRelatedWork W2026063366 @default.
• W2034385545 hasRelatedWork W2078520816 @default.
• W2034385545 hasRelatedWork W2118726183 @default.
• W2034385545 hasRelatedWork W2146193904 @default.

• next