FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2034399368> ?p ?o ?g. }

• W2034399368 endingPage "37421" @default.
• W2034399368 startingPage "37414" @default.
• W2034399368 abstract "We have mutated a conserved residue of the death domain of the interleukin-1 (IL-1) receptor-associated kinase (IRAK), threonine 66. The substitution of Thr-66 with alanine or glutamate prevented spontaneous activation of NF-κB by overexpressed IRAK but enhanced IL-1-induced activation of the factor. Like the kinase-inactivating mutation, K239S, the T66A and T66E mutations interfered with the ability of IRAK to autophosphorylate and facilitated the interactions of IRAK with TRAF6 and with the IL-1 receptor accessory protein, AcP. Wild-type IRAK constructs tagged with fluorescent proteins formed complexes that adopted a punctate distribution in the cytoplasm. The Thr-66 mutations prevented the formation of these complexes. Measurements of fluorescence resonance energy transfer among fluorescent constructs showed that the Thr-66 mutations abolished the capacity of IRAK to dimerize. In contrast, the K239S mutation did not inhibit dimerization of IRAK as evidenced by fluorescence resonance energy transfer measurements, even though microscopy showed that it prevented the formation of punctate complexes. Our results show that Thr-66 plays a crucial role in the ability of IRAK to form homodimers and that its kinase activity regulates its ability to form high molecular weight complexes. These properties in turn determine key aspects of the signaling function of IRAK. We have mutated a conserved residue of the death domain of the interleukin-1 (IL-1) receptor-associated kinase (IRAK), threonine 66. The substitution of Thr-66 with alanine or glutamate prevented spontaneous activation of NF-κB by overexpressed IRAK but enhanced IL-1-induced activation of the factor. Like the kinase-inactivating mutation, K239S, the T66A and T66E mutations interfered with the ability of IRAK to autophosphorylate and facilitated the interactions of IRAK with TRAF6 and with the IL-1 receptor accessory protein, AcP. Wild-type IRAK constructs tagged with fluorescent proteins formed complexes that adopted a punctate distribution in the cytoplasm. The Thr-66 mutations prevented the formation of these complexes. Measurements of fluorescence resonance energy transfer among fluorescent constructs showed that the Thr-66 mutations abolished the capacity of IRAK to dimerize. In contrast, the K239S mutation did not inhibit dimerization of IRAK as evidenced by fluorescence resonance energy transfer measurements, even though microscopy showed that it prevented the formation of punctate complexes. Our results show that Thr-66 plays a crucial role in the ability of IRAK to form homodimers and that its kinase activity regulates its ability to form high molecular weight complexes. These properties in turn determine key aspects of the signaling function of IRAK. interleukin IL-1 receptor accessory protein type I IL-1 receptor IL-1RI-associated protein kinases fluorescence resonance energy transfer tumor necrosis factor TNF receptor-associated factor transforming growth factor β-activated kinase 1 enhanced green fluorescent protein cyan fluorescent protein yellow fluorescent protein All of the biological effects of interleukin 1 (IL-1)1 depend upon its binding to the type I IL-1 receptor, IL-1RI (1Dinarello C.A. Blood. 1996; 87: 2095-2147Crossref PubMed Google Scholar). The receptor is the prototypic member of a diverse family of conserved proteins generally involved in host defense (2O'Neill L.A. Greene C. J. Leukocyte Biol. 1998; 63: 650-657Crossref PubMed Scopus (499) Google Scholar). They include the DrosophilaToll protein (3Tauszig S. Jouanguy E. Hoffmann J.A. Imler J.L. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 10520-10525Crossref PubMed Scopus (315) Google Scholar), the mammalian Toll-like receptors, the IL-18 receptor and components of IL-1 signal transduction pathways such as the IL-1RI accessory protein (AcP), and the intracellular adapter protein MyD88 (2O'Neill L.A. Greene C. J. Leukocyte Biol. 1998; 63: 650-657Crossref PubMed Scopus (499) Google Scholar, 4Wesche H. Henzel W.J. Shillinglaw W., Li, S. Cao Z. Immunity. 1997; 7: 837-847Abstract Full Text Full Text PDF PubMed Scopus (922) Google Scholar). The family is characterized by a conserved intracellular motif (the Toll/interleukin-1 receptor domain), suggesting that all members couple to similar signaling pathways (2O'Neill L.A. Greene C. J. Leukocyte Biol. 1998; 63: 650-657Crossref PubMed Scopus (499) Google Scholar). The binding of IL-1 to IL-1RI initiates the formation of a complex that includes IL-1RI, AcP, the adapter protein MyD88, and the IL-1RI-associated protein kinases (IRAKs). They consist of IRAK, IRAK-2, IRAK-4, and in cells where it is expressed, IRAK-M (4Wesche H. Henzel W.J. Shillinglaw W., Li, S. Cao Z. Immunity. 1997; 7: 837-847Abstract Full Text Full Text PDF PubMed Scopus (922) Google Scholar, 5Korherr C. Hofmeister R. Wesche H. Falk W. Eur. J. Immunol. 1997; 27: 262-267Crossref PubMed Scopus (154) Google Scholar, 6Wesche H. Korherr C. Kracht M. Falk W. Resch K. Martin M.U. J. Biol. Chem. 1997; 272: 7727-7731Abstract Full Text Full Text PDF PubMed Scopus (269) Google Scholar, 7Cao Z. Henzel W.J. Gao X. Science. 1996; 271: 1128-1131Crossref PubMed Scopus (777) Google Scholar, 8Muzio M., Ni, J. Feng P. Dixit V.M. Science. 1997; 278: 1612-1615Crossref PubMed Scopus (988) Google Scholar, 9Li S. Strelow A. Fontana E.J. Wesche H. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 5567-5572Crossref PubMed Scopus (549) Google Scholar). Subsequent events involve the phosphorylation of IRAK by itself and by IRAK-4, its dissociation from the IL-1R1 complex, its ubiquitination, and its association with two membrane-bound proteins, the TGF-β-activated kinase (TAK1)-binding protein 2 (TAB2) and TRAF6, a member of the tumor necrosis factor (TNF) receptor-associated factor (TRAF) family of adapter proteins (8Muzio M., Ni, J. Feng P. Dixit V.M. Science. 1997; 278: 1612-1615Crossref PubMed Scopus (988) Google Scholar, 10Cao Z. Xiong J. Takeuchi M. Kurama T. Goeddel D.V. Nature. 1996; 383: 443-446Crossref PubMed Scopus (1123) Google Scholar, 11Yamin T.T. Miller D.K. J. Biol. Chem. 1997; 272: 21540-21547Abstract Full Text Full Text PDF PubMed Scopus (245) Google Scholar, 12Deng L. Wang C. Spencer E. Yang L. Braun A. You J. Slaughter C. Pickart C. Chen Z.J. Cell. 2000; 103: 351-361Abstract Full Text Full Text PDF PubMed Scopus (1524) Google Scholar, 13Qian Y. Commane M. Ninomiya-Tsuji J. Matsumoto K. Li X. J. Biol. Chem. 2001; 276: 41661-41667Abstract Full Text Full Text PDF PubMed Scopus (178) Google Scholar). The resulting IRAK·TRAF6·TAB2 (TAK1-binding protein 2) complex is then released into the cytoplasm and activates protein kinase cascades, which include TAK1, the IκB kinases, and the stress-activated protein kinases (13Qian Y. Commane M. Ninomiya-Tsuji J. Matsumoto K. Li X. J. Biol. Chem. 2001; 276: 41661-41667Abstract Full Text Full Text PDF PubMed Scopus (178) Google Scholar, 14Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1023) Google Scholar, 15Wang C. Deng L. Hong M. Akkaraju G.R. Inoue J. Chen Z.J. Nature. 2001; 412: 346-351Crossref PubMed Scopus (1651) Google Scholar, 16Holtmann H. Enninga J. Kalble S. Thiefes A. Dorrie A. Broemer M. Winzen R. Wilhelm A. Ninomiya-Tsuji J. Matsumoto K. Resch K. Kracht M. J. Biol. Chem. 2001; 276: 3508-3516Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar, 17Cooke E.L. Uings I.J. Xia C.L. Woo P. Ray K.P. Biochem. J. 2001; 359: 403-410Crossref PubMed Scopus (33) Google Scholar, 18Palsson McDermott E. O'Neill L.A. J. Biol. Chem. 2002; 277: 7808-7815Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar). The roles of the two IRAK homologues, IRAK-2 and IRAK-M, are less well understood than the roles of IRAK and IRAK-4. Like IRAK, they associate with the IL1-R1 complex (8Muzio M., Ni, J. Feng P. Dixit V.M. Science. 1997; 278: 1612-1615Crossref PubMed Scopus (988) Google Scholar, 19Wesche H. Gao X., Li, X. Kirschning C.J. Stark G.R. Cao Z. J. Biol. Chem. 1999; 274: 19403-19410Abstract Full Text Full Text PDF PubMed Scopus (346) Google Scholar). They have been shown to reconstitute the IL-1 response in a cell line lacking IRAK (8Muzio M., Ni, J. Feng P. Dixit V.M. Science. 1997; 278: 1612-1615Crossref PubMed Scopus (988) Google Scholar, 19Wesche H. Gao X., Li, X. Kirschning C.J. Stark G.R. Cao Z. J. Biol. Chem. 1999; 274: 19403-19410Abstract Full Text Full Text PDF PubMed Scopus (346) Google Scholar). IRAK undergoes autophosphorylation shortly after stimulation of cells by IL-1, indicating that its catalytic activity is modulated during IL-1 signal transduction (11Yamin T.T. Miller D.K. J. Biol. Chem. 1997; 272: 21540-21547Abstract Full Text Full Text PDF PubMed Scopus (245) Google Scholar). However, a point mutation of lysine 239 that completely abolished its catalytic activity did not interfere with its ability to activate NF-κB when expressed at high levels in transfected cells, suggesting that the protein kinase activity may not play an important role in signaling (4Wesche H. Henzel W.J. Shillinglaw W., Li, S. Cao Z. Immunity. 1997; 7: 837-847Abstract Full Text Full Text PDF PubMed Scopus (922) Google Scholar, 9Li S. Strelow A. Fontana E.J. Wesche H. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 5567-5572Crossref PubMed Scopus (549) Google Scholar, 19Wesche H. Gao X., Li, X. Kirschning C.J. Stark G.R. Cao Z. J. Biol. Chem. 1999; 274: 19403-19410Abstract Full Text Full Text PDF PubMed Scopus (346) Google Scholar, 20Knop J. Martin M.U. FEBS Lett. 1999; 448: 81-85Crossref PubMed Scopus (90) Google Scholar, 21Maschera B. Ray K. Burns K. Volpe F. Biochem. J. 1999; 339: 227-231Crossref PubMed Scopus (79) Google Scholar, 22Li X. Commane M. Burns C. Vithalani K. Cao Z. Stark G.R. Mol. Cell. Biol. 1999; 19: 4643-4652Crossref PubMed Scopus (187) Google Scholar, 23Li X. Commane M. Jiang Z. Stark G.R. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 4461-4465Crossref PubMed Scopus (144) Google Scholar). The four human IRAKs and their Drosophila homologue, Pelle, all contain an NH2-terminal death domain. The death domain is a protein interaction domain, first defined as a conserved motif in the cytoplasmic domains of Fas and the type I TNF receptor (24Itoh N. Nagata S. J. Biol. Chem. 1993; 268: 10932-10937Abstract Full Text PDF PubMed Google Scholar), and has since been found in proteins of diverse cellular functions including MyD88 (25Hofmann K. Tschopp J. FEBS Lett. 1995; 371: 321-323Crossref PubMed Scopus (103) Google Scholar, 26Feinstein E. Kimchi A. Wallach D. Boldin M. Varfolomeev E. Trends Biochem. Sci. 1995; 20: 342-344Abstract Full Text PDF PubMed Scopus (271) Google Scholar). The death domains of IRAKs mediate their recruitment to the IL-1R1 complex by associating with the death domain of MyD88 (4Wesche H. Henzel W.J. Shillinglaw W., Li, S. Cao Z. Immunity. 1997; 7: 837-847Abstract Full Text Full Text PDF PubMed Scopus (922) Google Scholar, 8Muzio M., Ni, J. Feng P. Dixit V.M. Science. 1997; 278: 1612-1615Crossref PubMed Scopus (988) Google Scholar). They may also be involved in associations between IRAK molecules. This may be the reason why deletion of its death domain prevents overexpressed IRAK from spontaneously autophosphorylating, associating with TRAF6, and activating NF-κB (13Qian Y. Commane M. Ninomiya-Tsuji J. Matsumoto K. Li X. J. Biol. Chem. 2001; 276: 41661-41667Abstract Full Text Full Text PDF PubMed Scopus (178) Google Scholar, 17Cooke E.L. Uings I.J. Xia C.L. Woo P. Ray K.P. Biochem. J. 2001; 359: 403-410Crossref PubMed Scopus (33) Google Scholar, 23Li X. Commane M. Jiang Z. Stark G.R. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 4461-4465Crossref PubMed Scopus (144) Google Scholar). We have investigated the functional roles of two conserved residues in the death domain of IRAK, Thr-66 and Trp-73. We have found that threonine 66 played a crucial role in the ability of IRAK to form homo-oligomeric complexes, a property that appears to regulate many aspects of IRAK function. Our results support a model in which the signaling activity of IRAK is regulated by both autophosphorylation and self-assembly. Cells lines (COS-1 and NIH 3T3) were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum, 100 units/ml penicillin, and 100 μg/ml streptomycin. Cells were transfected using Superfect (Qiagen). The FLAG-tagged TRAF6 and AcP cDNA constructs, the IRAK expression construct, and the NF-κB-responsive luciferase reporter plasmid (pNF-κBluc) have been described elsewhere (27Burns K. Martinon F. Esslinger C. Pahl H. Schneider P. Bodmer J.L., Di Marco F. French L. Tschopp J. J. Biol. Chem. 1998; 273: 12203-12209Abstract Full Text Full Text PDF PubMed Scopus (521) Google Scholar, 28Volpe F. Clatworthy J. Kaptein A. Maschera B. Griffin A.M. Ray K. FEBS Lett. 1997; 419: 41-44Crossref PubMed Scopus (42) Google Scholar). IRAK mutants were generated by site-directed mutagenesis of the IRAK expression construct with the QuikChange kit (Stratagene). The wild-type IRAK sequence was excised from a pBluescript construct (28Volpe F. Clatworthy J. Kaptein A. Maschera B. Griffin A.M. Ray K. FEBS Lett. 1997; 419: 41-44Crossref PubMed Scopus (42) Google Scholar) withSalI and SacII restriction sites. It was ligated into the same sites of the expression vectors pEGFP-C1, pEYFP-C1, or pECFP-C1 (CLONTECH) downstream of sequences encoding the enhanced green (EGFP), yellow (YFP), or cyan (CFP) variants of Aequorea victoria green fluorescent protein, respectively. The mutant IRAK cDNAs were transferred into pBluescript using EcoRI and BamHI restriction sites and then excised from it with the flanking SalI andSacII sites and ligated into pEYFP-C1 or pECFP-C1 similar to wild-type IRAK. Sequencing of the constructs confirmed that they encoded in-frame fusions of wild-type or mutant IRAK to the carboxyl termini of EGFP, YFP, or CFP. The full-length IRAK-2 coding sequence was amplified using primers of sequences GAATTCGTCGACATGGCCTGCTACATCTACCAGC and CTCGAGCCGCGGTTATGTAACATCCTGGGGAGGC, designed to introduceSalI and SacII restriction sites at the 5′ and 3′ ends, respectively. These restriction sites were used in cloning IRAK-2 into pEGFP-C1 and pECFP-C1. IRAK-M cDNA was amplified from human peripheral blood monocyte mRNA using oligonucleotides of sequences, 5′-GGAATTCGGCGCACACGCTGCTGTTCGACCTGC-3′ and 5′-CCGCTCGAGTCATCCCAGGAAAAATTTGGAGGAACAGCAGG-3′, and cloned into the VSV-pCRIII vector (29Burns K. Clatworthy J. Martin L. Martinon F. Plumpton C. Maschera B. Lewis A. Ray K. Tschopp J. Volpe F. Nat. Cell Biol. 2000; 2: 346-351Crossref PubMed Scopus (453) Google Scholar). The CFP-IRAK-M construct was then made by excision of the IRAK-M coding sequence using flankingXhoI sites and cloning it into the XhoI site of pECFP-C1. Sequencing showed that the insert was in the sense orientation in the clone used experimentally. This construct encodes a fusion protein consisting of YFP joined to carboxyl end of CFP by a 15-residue linker of sequence SGLRSRAQADPPVAT. It was given to us by Dr. F. Carlotti. COS-1 cells were seeded at 3 × 105 cells/well in six-well plates and transfected the next day with 1 μg of pNF-κBluc, 0.2 μg of pCMV-β-galactosidase (27Burns K. Martinon F. Esslinger C. Pahl H. Schneider P. Bodmer J.L., Di Marco F. French L. Tschopp J. J. Biol. Chem. 1998; 273: 12203-12209Abstract Full Text Full Text PDF PubMed Scopus (521) Google Scholar), and varying amounts of expression constructs. Total DNA was kept constant by the addition of empty vector. The cells were harvested and lysed 2 days later (7Cao Z. Henzel W.J. Gao X. Science. 1996; 271: 1128-1131Crossref PubMed Scopus (777) Google Scholar). Luciferase and β-galactosidase activities were assayed as described previously (27Burns K. Martinon F. Esslinger C. Pahl H. Schneider P. Bodmer J.L., Di Marco F. French L. Tschopp J. J. Biol. Chem. 1998; 273: 12203-12209Abstract Full Text Full Text PDF PubMed Scopus (521) Google Scholar). Luciferase readings were normalized to β-galactosidase values. COS-1 cells were seeded (5 × 104/well) in four-well chambered coverglass (NalgeNunc) and transfected the following day with 2 μg of plasmid. Images were acquired with a Molecular Dynamics confocal scanning microscope equipped with a krypton/argon ion laser and controlled by a Silicon Graphics work station. Fluorescence excitation was performed with the 488-nm line of the laser. Fluorescence was collected through a 530 ± 15-nm bandpass filter. Images were obtained with a ×100 Plan Apo Immersion lens fitted on a Nikon Diaphot microscope. NIH 3T3 cells were seeded in chambered coverglass as above and transfected the next day with expression plasmids for CFP- and YFP-labeled proteins (0.5 μg each). Images were recorded 24 h later with a Nikon Diaphot 300 microscope equipped with a mercury arc lamp and a 10-bit digital CCD camera (Hamamatsu). Control of the camera and quantitative analysis of images were performed with OpenLab software (Image Processing and Vision Co. Ltd). Images of CFP and YFP fluorescence were acquired using the XF114 (excitation 440 nm, emission = 480 nm) and XF104 (excitation 500 nm, emission 545 nm) filter sets, respectively (Omega Optical, Brattleboro, VT). FRET was detected with a custom-made filter set (excitation 440 nm, emission 535 nm), also from Omega Optical. Emission intensities were measured on the cytoplasms of individual cells. Each measurement was corrected by subtraction of background fluorescence determined from an extracellular region of the same image. FRET measurements were then corrected by subtraction of the direct emissions from donor and acceptor. These were calculated from the CFP and YFP measurements using correction factors determined in calibration tests done on cells expressing CFP and YFP (individually and in co-transfections) as well as the CFP-YFP construct. The FRET intensity measurements were normalized to CFP fluorescence (30Miyawaki A. Llopis J. Heim R. McCaffery J.M. Adams J.A. Ikura M. Tsien R.Y. Nature. 1997; 388: 882-887Crossref PubMed Scopus (2650) Google Scholar). COS-1 cells were seeded at 3 × 106 cells/10-cm dish and transfected on the following day. At 24 h post-transfection, cells were lysed and immunoprecipitations were performed as described previously (28Volpe F. Clatworthy J. Kaptein A. Maschera B. Griffin A.M. Ray K. FEBS Lett. 1997; 419: 41-44Crossref PubMed Scopus (42) Google Scholar, 29Burns K. Clatworthy J. Martin L. Martinon F. Plumpton C. Maschera B. Lewis A. Ray K. Tschopp J. Volpe F. Nat. Cell Biol. 2000; 2: 346-351Crossref PubMed Scopus (453) Google Scholar) with 4.4 μg of anti-FLAG M2 antibody (Sigma) and protein G conjugated to Sepharose beads (Amersham Pharmacia Biotech). The beads were then washed three times in lysis buffer without glycerol, resuspended in 50 μl of 2× SDS-PAGE sample buffer, and heated at 100 °C for 1 min. A 20-μl aliquot was separated on SDS Tris-HCl gels containing a gradient of 4–20% polyacrylamide (Bio-Rad) and transferred to polyvinylidene difluoride membranes. The membranes were probed with anti-IRAK (28Volpe F. Clatworthy J. Kaptein A. Maschera B. Griffin A.M. Ray K. FEBS Lett. 1997; 419: 41-44Crossref PubMed Scopus (42) Google Scholar) at a 1:5000 dilution or anti-FLAG antibodies (1 μg/ml). HRP-conjugated secondary antibodies were from Transduction Laboratories, and chemiluminescent reagents were from Pierce Warriner. Death domains consist of six α-helices packed into a cylindrical structure (31Huang B. Eberstadt M. Olejniczak E.T. Meadows R.P. Fesik S.W. Nature. 1996; 384: 638-641Crossref PubMed Scopus (322) Google Scholar, 32Xiao T. Towb P. Wasserman S.A. Sprang S.R. Cell. 1999; 99: 545-555Abstract Full Text Full Text PDF PubMed Scopus (157) Google Scholar). By analyzing the sequences of several death domains and the crystal structures of the death domains of theDrosophila proteins Pelle and Tube (32Xiao T. Towb P. Wasserman S.A. Sprang S.R. Cell. 1999; 99: 545-555Abstract Full Text Full Text PDF PubMed Scopus (157) Google Scholar), we identified two conserved residues that may play important roles in IRAK function (Fig.1). The most conserved residue is a tryptophan located near the carboxyl end of the fourth α-helix of most death domains, at position 73 of the IRAK sequence (Fig. 1). In the type I TNF receptor, the tryptophan is essential for cytotoxic signaling (33Tartaglia L.A. Ayres T.M. Wong G.H. Goeddel D.V. Cell. 1993; 74: 845-853Abstract Full Text PDF PubMed Scopus (1169) Google Scholar). The crystal structures indicate that it is part of the hydrophobic core of the domain (26Feinstein E. Kimchi A. Wallach D. Boldin M. Varfolomeev E. Trends Biochem. Sci. 1995; 20: 342-344Abstract Full Text PDF PubMed Scopus (271) Google Scholar,32Xiao T. Towb P. Wasserman S.A. Sprang S.R. Cell. 1999; 99: 545-555Abstract Full Text Full Text PDF PubMed Scopus (157) Google Scholar). Also of interest is a threonine or serine that is specifically conserved in the IRAK family and in several other proteins such as Tube, MyD88, and the NF-κB family members, p100 and p105. It is located at the amino-terminal end of the fourth helix and corresponds to Thr-66 of IRAK, Ser-83 of Pelle, or Ser-110 of Tube (Fig. 1). An analysis of the crystallographic data with RasMol (34Sayle R.A. Milner-White E.J. Trends Biochem. Sci. 1995; 20: 374Abstract Full Text PDF PubMed Scopus (2323) Google Scholar) shows that Ser-83 and Ser-110 are not exposed at the surface of the Pelle and Tube death domains. Instead, they are hydrogen-bonded to a conserved residue of the first α-helix, Asp-50 of Pelle and Asp-49 of Tube. This finding strongly suggests that the homologous residue of IRAK, Asp-35, is hydrogen-bonded to Thr-66 and that this links together the fourth and first helices. In view of the locations of Trp-73 and Thr-66 at opposite ends of the fourth α-helix, we reasoned that mutating each residue would enable us to destabilize independently the packing of α-helices at either end of the death domain of IRAK and produce qualitatively distinct structural effects. In particular, replacing Thr-66 by a negatively charged residue should have a strong effect by creating electrostatic repulsion between Glu-66 and Asp-35. To investigate the role of death domain-mediated interactions in IRAK function, we mutated Trp-73 to alanine and Thr-66 to either alanine or glutamate. We assessed the effects of the mutations on several parameters of IRAK function and compared them to those of the kinase-inactivating mutation, K239S. The activation of NF-κB is a key component of cellular responses to IL-1. Thus, we monitored the effects of the mutations on the NF-κB-stimulating activity of IRAK in cells transfected with the promoter/reporter construct, pNF-κBluc (Fig.2 A). As previously reported (19Wesche H. Gao X., Li, X. Kirschning C.J. Stark G.R. Cao Z. J. Biol. Chem. 1999; 274: 19403-19410Abstract Full Text Full Text PDF PubMed Scopus (346) Google Scholar), wild-type IRAK stimulated NF-κB in a dose-dependent manner in the absence of IL-1. Cells transfected with 0.5 μg of an IRAK expression construct produced ∼20 times more luciferase than control cells (Fig. 2 A). In agreement with published results (4Wesche H. Henzel W.J. Shillinglaw W., Li, S. Cao Z. Immunity. 1997; 7: 837-847Abstract Full Text Full Text PDF PubMed Scopus (922) Google Scholar, 9Li S. Strelow A. Fontana E.J. Wesche H. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 5567-5572Crossref PubMed Scopus (549) Google Scholar, 19Wesche H. Gao X., Li, X. Kirschning C.J. Stark G.R. Cao Z. J. Biol. Chem. 1999; 274: 19403-19410Abstract Full Text Full Text PDF PubMed Scopus (346) Google Scholar, 20Knop J. Martin M.U. FEBS Lett. 1999; 448: 81-85Crossref PubMed Scopus (90) Google Scholar, 21Maschera B. Ray K. Burns K. Volpe F. Biochem. J. 1999; 339: 227-231Crossref PubMed Scopus (79) Google Scholar, 22Li X. Commane M. Burns C. Vithalani K. Cao Z. Stark G.R. Mol. Cell. Biol. 1999; 19: 4643-4652Crossref PubMed Scopus (187) Google Scholar, 23Li X. Commane M. Jiang Z. Stark G.R. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 4461-4465Crossref PubMed Scopus (144) Google Scholar), we also found that the kinase-suppressing mutation, K239S, did not interfere with this effect of IRAK (data not shown). In contrast, both of the T66A and W73A mutations strongly reduced the ability of IRAK to spontaneously activate NF-κB. In cells transfected with 0.5 μg of each mutant construct, the increase in reporter expression relative to controls was ∼5-fold (Fig. 2 A). Immunobloting of the cell lysates with the anti-IRAK antibody (28Volpe F. Clatworthy J. Kaptein A. Maschera B. Griffin A.M. Ray K. FEBS Lett. 1997; 419: 41-44Crossref PubMed Scopus (42) Google Scholar) showed that the wild-type and mutants proteins were present at similar levels and migrated as intact proteins (data not shown). Thus, the failure of the mutants to spontaneously activate NF-κB was not caused by an enhanced rate of proteolysis. The effect of the mutations on responses to IL-1 was then examined. In the absence of any expression construct, IL-1 caused a 1.9-fold increase in reporter activity (Fig. 2, B–D). In cells expressing large amounts of IRAK, IL-1 caused only a very small increase in reporter activity, presumably because the NF-κB pool had already been almost completely activated by IRAK alone (Fig.2 B). In contrast, IL-1 increased reporter activity more effectively in cells expressing IRAK-(T66A) than in control cells (Fig. 2 C). The cytokine-induced increase in reporter activity was 3.4-fold for cells transfected with 0.05 μg of IRAK-(T66A), significantly higher than the 1.9-fold increase observed in its absence (p = 0.009). Unlike T66A, the T66E mutation did not increase the basal expression of the reporter in the absence of IL-1 (Fig. 2 D). Nonetheless, like IRAK-(T66A), IRAK-(T66E) amplified the response to IL-1 (Fig.2 D). The strongest amplification was observed with cells transfected with 0.25 μg of construct, which responded to IL-1 by a 3.0-fold increase in luciferase expression (p = 0.03). The IRAK-(W73A) mutant also appeared to amplify the response to IL-1 in some experiments, but the effect was weaker than that of the Thr-66 mutations and was not statistically significant (p = 0.10, data not shown). These results indicated that unlike wild-type IRAK, IRAK-(T66A) and IRAK-(T66E) were regulated by the activated IL-1 receptor in transfected cells. Because the IRAK death domain mediates the association of IRAK with itself or with other proteins, we analyzed the effects of Trp-73 and Thr-66 mutants on the localization and oligomerization of IRAK. To do this in living cells, we made constructs in which the amino end of IRAK or of its mutants was fused to EGFP, YFP, or CFP variants of A. victoria green fluorescent protein. To ascertain whether or not the fluorescent moieties interfered with the activity of IRAK, we compared the ability of the fluorescent constructs and of the corresponding unlabeled proteins to activate NF-κB. The level of activation induced by the fluorescent and non-fluorescent versions were not significantly different, indicating that fusion of the amino-terminal end of IRAK to a fluorescent protein did not alter its signaling function (data not shown). Confocal fluorescence microscopy of live COS-1 cells expressing low amounts of EGFP-IRAK showed that it adopted a punctate distribution throughout the cytoplasm and was excluded from the nucleus (Fig.3 A). This indicated that most or all of the fluorescent IRAK existed in discrete high molecular weight complexes. Higher levels of expression resulted in the accumulation of IRAK particles in very large patches (Fig.3 B). Low intensity imaging showed the patches to be composed of multiple copies of the complexes observed at low expression levels (data not shown). An analysis of high resolution images of cells expressing EGFP-IRAK with the Sobel edge detection algorithm showed that the fluorescent particles had an elongated shape (Fig. 3 C). Their widths were smaller than the optical resolution (0.2 μm), whereas their lengths appeared to vary between 0.2 and 1 μm (Fig. 3 C). This variation may result from random orientation of the particles relative to the image plane, rather than from true heterogeneity. A quantitative analysis of the fluorescence intensities of the particles in cells covering a 10-fold range in expression level showed that the average number of fluorescent molecules that they contained increased with expression once a threshold had been reached, suggesting that there is a concentration-driven assembly process within the cell (Fig.3 D). The YFP-IRAK-(W73A) fusion protein adopted the same punctate distribution as EGFP-IRAK (Fig.4 A). In contrast, YFP-IRAK-(T66A), YFP-IRAK-(T66E), and YFP-IRAK-(K239S) were all uniformly distributed throughout the cytoplasm (Fig. 4,B–D). This indicated that the formation of the high molecular weight IRAK complexes required both the presence of Thr-66 in the death domain and the catalytic activity of IRAK. We then examined the ability of mutant IRAK proteins to self-associate in live transfected cells by measuring FRET between pairs of wild-type or mutant IRAK proteins labeled with CFP and YFP. The technique provides a sensitive way of detecting direct interactions between fluorescent fusion proteins (30Miyawaki A. Llopis J. Heim R. McCaffery J.M. Adams J.A. Ikura M. Tsien R.Y. Nature. 1997; 388: 882-887Crossref PubMed Scopus (2650) Google Scholar). Co-expression of CFP-IRAK and YFP-IRAK constructs resulted in a FRET signal, indicating that the technique could detect the self-association of IRAK. The signal was significantly reduced in control experiments in which a non-fluorescent IRAK protein was co-expressed with the CFP- and YFP-tagged versions (data not shown). This finding confirmed that the FRET signal was the result of specific and saturable interactions. Co-expre" @default.
• W2034399368 created "2016-06-24" @default.
• W2034399368 creator A5009580916 @default.
• W2034399368 creator A5042017214 @default.
• W2034399368 creator A5045003426 @default.
• W2034399368 creator A5048822214 @default.
• W2034399368 creator A5072689224 @default.
• W2034399368 date "2002-10-01" @default.
• W2034399368 modified "2023-10-17" @default.
• W2034399368 title "Identification of Threonine 66 as a Functionally Critical Residue of the Interleukin-1 Receptor-associated Kinase" @default.
• W2034399368 cites W1501181174 @default.
• W2034399368 cites W1515994079 @default.
• W2034399368 cites W1542263802 @default.
• W2034399368 cites W1574840635 @default.
• W2034399368 cites W1575383081 @default.
• W2034399368 cites W1577393853 @default.
• W2034399368 cites W1600472471 @default.
• W2034399368 cites W1925157258 @default.
• W2034399368 cites W1965971815 @default.
• W2034399368 cites W1969501356 @default.
• W2034399368 cites W1977835740 @default.
• W2034399368 cites W1988217385 @default.
• W2034399368 cites W1998160288 @default.
• W2034399368 cites W1998541740 @default.
• W2034399368 cites W1998585620 @default.
• W2034399368 cites W2004986546 @default.
• W2034399368 cites W2005482741 @default.
• W2034399368 cites W2013052118 @default.
• W2034399368 cites W2016297504 @default.
• W2034399368 cites W2026258231 @default.
• W2034399368 cites W2037454778 @default.
• W2034399368 cites W2043981380 @default.
• W2034399368 cites W2064558057 @default.
• W2034399368 cites W2068031486 @default.
• W2034399368 cites W2071503299 @default.
• W2034399368 cites W2080315587 @default.
• W2034399368 cites W2087229971 @default.
• W2034399368 cites W2089938437 @default.
• W2034399368 cites W2094982088 @default.
• W2034399368 cites W2107804596 @default.
• W2034399368 cites W2114269227 @default.
• W2034399368 cites W2116063836 @default.
• W2034399368 cites W2138474497 @default.
• W2034399368 cites W2141150979 @default.
• W2034399368 cites W2188779778 @default.
• W2034399368 cites W4230642790 @default.
• W2034399368 cites W4297590147 @default.
• W2034399368 doi "https://doi.org/10.1074/jbc.m205160200" @default.
• W2034399368 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12138165" @default.
• W2034399368 hasPublicationYear "2002" @default.
• W2034399368 type Work @default.
• W2034399368 sameAs 2034399368 @default.
• W2034399368 citedByCount "25" @default.
• W2034399368 countsByYear W20343993682012 @default.
• W2034399368 countsByYear W20343993682014 @default.
• W2034399368 countsByYear W20343993682016 @default.
• W2034399368 countsByYear W20343993682018 @default.
• W2034399368 countsByYear W20343993682021 @default.
• W2034399368 crossrefType "journal-article" @default.
• W2034399368 hasAuthorship W2034399368A5009580916 @default.
• W2034399368 hasAuthorship W2034399368A5042017214 @default.
• W2034399368 hasAuthorship W2034399368A5045003426 @default.
• W2034399368 hasAuthorship W2034399368A5048822214 @default.
• W2034399368 hasAuthorship W2034399368A5072689224 @default.
• W2034399368 hasBestOaLocation W20343993681 @default.
• W2034399368 hasConcept C11960822 @default.
• W2034399368 hasConcept C170493617 @default.
• W2034399368 hasConcept C185592680 @default.
• W2034399368 hasConcept C2775880066 @default.
• W2034399368 hasConcept C2776414213 @default.
• W2034399368 hasConcept C2777977768 @default.
• W2034399368 hasConcept C2778690821 @default.
• W2034399368 hasConcept C2781338088 @default.
• W2034399368 hasConcept C54355233 @default.
• W2034399368 hasConcept C55493867 @default.
• W2034399368 hasConcept C74172505 @default.
• W2034399368 hasConcept C86803240 @default.
• W2034399368 hasConceptScore W2034399368C11960822 @default.
• W2034399368 hasConceptScore W2034399368C170493617 @default.
• W2034399368 hasConceptScore W2034399368C185592680 @default.
• W2034399368 hasConceptScore W2034399368C2775880066 @default.
• W2034399368 hasConceptScore W2034399368C2776414213 @default.
• W2034399368 hasConceptScore W2034399368C2777977768 @default.
• W2034399368 hasConceptScore W2034399368C2778690821 @default.
• W2034399368 hasConceptScore W2034399368C2781338088 @default.
• W2034399368 hasConceptScore W2034399368C54355233 @default.
• W2034399368 hasConceptScore W2034399368C55493867 @default.
• W2034399368 hasConceptScore W2034399368C74172505 @default.
• W2034399368 hasConceptScore W2034399368C86803240 @default.
• W2034399368 hasIssue "40" @default.
• W2034399368 hasLocation W20343993681 @default.
• W2034399368 hasOpenAccess W2034399368 @default.
• W2034399368 hasPrimaryLocation W20343993681 @default.
• W2034399368 hasRelatedWork W1527496708 @default.
• W2034399368 hasRelatedWork W1535521630 @default.
• W2034399368 hasRelatedWork W1821660085 @default.
• W2034399368 hasRelatedWork W1975265374 @default.
• W2034399368 hasRelatedWork W1977482452 @default.

• next