SemOpenAlex |

SemOpenAlex

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2034407986> ?p ?o ?g. }

Showing items 1 to 98 of 98 with 100 items per page.

W2034407986 endingPage "41986" @default.
W2034407986 startingPage "41978" @default.
W2034407986 abstract "The heat shock protein RrmJ (FtsJ), highly conserved from eubacteria to eukarya, is responsible for the 2′-O-ribose methylation of the universally conserved base U2552 in the A-loop of the 23 S rRNA. Absence of this methylation, which occurs late in the maturation process of the ribosome, appears to cause the destabilization and premature dissociation of the 50 S ribosomal subunit. To understand the mechanism of 2′-O-ribose methyltransfer reactions, we characterized the enzymatic parameters of RrmJ and conducted site-specific mutagenesis of RrmJ. A structure based sequence alignment with VP39, a structurally related 2′-O-methyltransferase from vaccinia virus, guided our mutagenesis studies. We analyzed the function of our RrmJ mutants in vivo and characterized the methyltransfer reaction of the purified proteins in vitro. The active site of RrmJ appears to be formed by a catalytic triad consisting of two lysine residues, Lys-38 and Lys-164, and the negatively charged residue Asp-124. Another highly conserved residue, Glu-199, that is present in the active site of RrmJ and VP39 appears to play only a minor role in the methyltransfer reaction in vivo. Based on these results, a reaction mechanism for the methyltransfer activity of RrmJ is proposed. The heat shock protein RrmJ (FtsJ), highly conserved from eubacteria to eukarya, is responsible for the 2′-O-ribose methylation of the universally conserved base U2552 in the A-loop of the 23 S rRNA. Absence of this methylation, which occurs late in the maturation process of the ribosome, appears to cause the destabilization and premature dissociation of the 50 S ribosomal subunit. To understand the mechanism of 2′-O-ribose methyltransfer reactions, we characterized the enzymatic parameters of RrmJ and conducted site-specific mutagenesis of RrmJ. A structure based sequence alignment with VP39, a structurally related 2′-O-methyltransferase from vaccinia virus, guided our mutagenesis studies. We analyzed the function of our RrmJ mutants in vivo and characterized the methyltransfer reaction of the purified proteins in vitro. The active site of RrmJ appears to be formed by a catalytic triad consisting of two lysine residues, Lys-38 and Lys-164, and the negatively charged residue Asp-124. Another highly conserved residue, Glu-199, that is present in the active site of RrmJ and VP39 appears to play only a minor role in the methyltransfer reaction in vivo. Based on these results, a reaction mechanism for the methyltransfer activity of RrmJ is proposed. aminoacyl S-adenosylmethionine catechol-O-methyltransferase wild type two-dimensional RrmJ (FtsJ) is a well conserved heat shock protein present in prokaryotes, archaea, and eukaryotes (1Bügl H. Fauman E.B. Staker B.L. Zheng F. Kushner S.R. Saper M.A. Bardwell J.C. Jakob U. Mol. Cell. 2000; 6: 349-360Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar). Functional studies revealed that RrmJ is responsible for methylating 23 S rRNA at position U2552 in the aminoacyl (A)1-site of the ribosome (1Bügl H. Fauman E.B. Staker B.L. Zheng F. Kushner S.R. Saper M.A. Bardwell J.C. Jakob U. Mol. Cell. 2000; 6: 349-360Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar, 2Caldas T. Binet E. Bouloc P. Costa A. Desgres J. Richarme G. J. Biol. Chem. 2000; 275: 16414-16419Abstract Full Text Full Text PDF PubMed Scopus (122) Google Scholar). U2552 is one of the five universally conserved A-loop residues and has been shown to be methylated at the ribose 2′-OH group in the majority of organisms investigated so far (3Hansen M.A. Kirpekar F. Ritterbusch W. Vester B. RNA. 2002; 8: 202-213Crossref PubMed Scopus (51) Google Scholar). This suggests that this modification plays an important role in the A-loop function. Analysis of rrmJ deletion mutants inEscherichia coli supports this view, because these cells show a severe growth disadvantage and ribosome defects (1Bügl H. Fauman E.B. Staker B.L. Zheng F. Kushner S.R. Saper M.A. Bardwell J.C. Jakob U. Mol. Cell. 2000; 6: 349-360Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar, 4Caldas T. Binet E. Bouloc P. Richarme G. Biochem. Biophys. Res. Commun. 2000; 271: 714-718Crossref PubMed Scopus (67) Google Scholar). Polysome profiles of rrmJ deletion strains prepared under non-stringent salt conditions reveal the accumulation of 30 S and 50 S ribosomal subunits at the expense of functional 70 S ribosomes (1Bügl H. Fauman E.B. Staker B.L. Zheng F. Kushner S.R. Saper M.A. Bardwell J.C. Jakob U. Mol. Cell. 2000; 6: 349-360Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar, 4Caldas T. Binet E. Bouloc P. Richarme G. Biochem. Biophys. Res. Commun. 2000; 271: 714-718Crossref PubMed Scopus (67) Google Scholar). In addition, lower MgCl2 concentrations in the lysate buffer cause the accumulation of 40 S ribosomal particles and a concomitant reduction in 50 S ribosomal subunits (1Bügl H. Fauman E.B. Staker B.L. Zheng F. Kushner S.R. Saper M.A. Bardwell J.C. Jakob U. Mol. Cell. 2000; 6: 349-360Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar). This ribosomal defect is also reflected in the significantly decreased translational efficiency of S30 extracts prepared from rrmJdeletion strains (4Caldas T. Binet E. Bouloc P. Richarme G. Biochem. Biophys. Res. Commun. 2000; 271: 714-718Crossref PubMed Scopus (67) Google Scholar). Interestingly, the absence of Mrm2p, the mitochondrial RrmJ homologue that has recently been identified to modify the corresponding U2791 in 21 S rRNA does not cause a mitochondrial ribosome assembly or stability defect (5Pintard L. Bujnicki J.M. Lapeyre B. Bonnerot C. EMBO J. 2002; 21: 1139-1147Crossref PubMed Scopus (58) Google Scholar). Yeast mitochondria in the absence of Mrm2p do, however, reveal instability of their genome, a feature that is often associated with defects in mitochondrial translation (5Pintard L. Bujnicki J.M. Lapeyre B. Bonnerot C. EMBO J. 2002; 21: 1139-1147Crossref PubMed Scopus (58) Google Scholar). All these observations point to an important role of RrmJ in ribosome biology, and the simplest interpretation of these results is that the ribosome defect that is observed in rrmJ deletion strains is directly caused by the absence of the Um2552 modification in 23 S rRNA. It also is possible, however, that RrmJ has a second methyltransferase-independent function. Such dual function modes for methyltransferases have been observed in the past. For instance, Pet56p, the methyltransferase that is responsible for methylating the other universally conserved residue in mitochondrial 21 S rRNA, has been shown to be essential for thein vivo maturation of the large ribosomal subunit in mitochondria (3Hansen M.A. Kirpekar F. Ritterbusch W. Vester B. RNA. 2002; 8: 202-213Crossref PubMed Scopus (51) Google Scholar). This phenotype, however, seems to be independent of the methylation activity of Pet56p, becauseS-adenosylmethionine (AdoMet) binding mutants of Pet56p, which completely eliminate methyltransferase activity, still support ribosome assembly in vivo (6Lovgren J.M. Wikstrom P.M. J Bacteriol. 2001; 183: 6957-6960Crossref PubMed Scopus (56) Google Scholar). In vitro methylation assays have revealed that RrmJ recognizes its methylation target only when the 23 S rRNA is present in 50 S ribosomal subunits (1Bügl H. Fauman E.B. Staker B.L. Zheng F. Kushner S.R. Saper M.A. Bardwell J.C. Jakob U. Mol. Cell. 2000; 6: 349-360Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar, 2Caldas T. Binet E. Bouloc P. Costa A. Desgres J. Richarme G. J. Biol. Chem. 2000; 275: 16414-16419Abstract Full Text Full Text PDF PubMed Scopus (122) Google Scholar). This has been confirmed in studies revealing that Mrm2p modifies mitochondrial 21 S rRNA only when assembled with proteins of the large subunit (5Pintard L. Bujnicki J.M. Lapeyre B. Bonnerot C. EMBO J. 2002; 21: 1139-1147Crossref PubMed Scopus (58) Google Scholar). This suggests that the RrmJ-mediated methylation must occur late in the maturation process of the ribosome (1Bügl H. Fauman E.B. Staker B.L. Zheng F. Kushner S.R. Saper M.A. Bardwell J.C. Jakob U. Mol. Cell. 2000; 6: 349-360Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar). This is in contrast to other known 23 S rRNA modifications that occur in earlier maturation steps (7Bjoerk G.R. Neidhardt F.C. E. coli and Salmonella. Cellular and Molecular Biology. ASM Press, Washington, D. C.1996: 861-880Google Scholar). The reaction mechanism of 2′-O-ribose methyltransferases such as RrmJ has not been analyzed experimentally. We have crystallized RrmJ in the presence of its AdoMet cofactor and have solved the structure of the RrmJ·AdoMet complex to a 1.5-Å resolution (1Bügl H. Fauman E.B. Staker B.L. Zheng F. Kushner S.R. Saper M.A. Bardwell J.C. Jakob U. Mol. Cell. 2000; 6: 349-360Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar). Comparison of the structure of RrmJ with structures of other methyltransferases revealed homology to 1FBN, the fibrillarin homologue from Methanococcus jannaschii (8Wang H. Boisvert D. Kim K.K. Kim R. Kim S.H. EMBO J. 2000; 19: 317-323Crossref PubMed Scopus (143) Google Scholar), catechol-O-methyltransferase (COMT) (9Vidgren J. Svensson L.A. Liljas A. Nature. 1994; 368: 354-358Crossref PubMed Scopus (390) Google Scholar), and vaccinia mRNA 2′-O-methyltransferase VP39 (10Hodel A.E. Gershon P.D. Shi X. Quiocho F.A. Cell. 1996; 85: 247-256Abstract Full Text Full Text PDF PubMed Scopus (151) Google Scholar). VP39, in particular, shows a highly homologous core domain and an RNA binding groove that shares numerous features with RrmJ (1Bügl H. Fauman E.B. Staker B.L. Zheng F. Kushner S.R. Saper M.A. Bardwell J.C. Jakob U. Mol. Cell. 2000; 6: 349-360Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar). These structural and sequence comparisons have allowed us and others (11Bujnicki J.M. Blumenthal R.M. Rychlewski L. J. Mol. Microbiol. Biotechnol. 2002; 4: 93-99PubMed Google Scholar) to predict which residues in RrmJ might be directly involved in the methyltransfer reaction and to postulate a reaction mechanism. Here, we have prepared a number of site-specific mutants of RrmJ to investigate which residues participate in catalysis. We have conducted phenotypical studies and enzymatic analyzes to characterize the activity of our mutants in vivo and in vitro. We have identified two lysine and one aspartate residues that are important for catalyzing the methyltransfer reaction; RrmJ mutants at these positions show a significant decrease in methyltransferase activity. These mutants allowed us to demonstrate that both the ribosome and growth defects observed in rrmJ deletion mutants are dependent on the methyltransfer activity of RrmJ. Site-directed mutagenesis was performed according to the QuickChange protocol (Stratagene, La Jolla, CA). Wild type rrmJ cloned into pET11a (pHB1) (1Bügl H. Fauman E.B. Staker B.L. Zheng F. Kushner S.R. Saper M.A. Bardwell J.C. Jakob U. Mol. Cell. 2000; 6: 349-360Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar) was used as template DNA to generate the mutations. The primers used in this study were as follows: K38A, CGTTCCCGTGCCTGGTTTGCACTTGATGAAATACAGCAAAG; D83A, CCGCATCATCGCTTGCGCTCTTCTACCTATGGATCC; D124A, CAGGTTGTCATGTCCGCTATGGCCCCAAACATGAGCGG; K164A, GGTGGCAGTTTTGTAGTGGCGGTGTTCCAGGGCG; E199A, GACTCTTCTCGTGCACGTTCCCGGGCAGTGTATATTGTAGCG; Y201A, CGTGCACGTTCCCGGGAAGTGGCTATTGTAGCGACCGGG. All introduced mutations were confirmed by DNA sequencing. The plasmids that were generated and the strains that were used in this study are listed in TableI. For overexpression and purification of the mutant proteins, the plasmids that contained the mutatedrrmJ genes were introduced into JUH47. This strain contained a deletion of the rrmJ gene to prevent the contamination of our purified mutant proteins by small amounts of WT protein. JUH47 was constructed by P1 transduction. The TcR of the Tn10 marker that is 90% linked to rrmΔJ567 (1Bügl H. Fauman E.B. Staker B.L. Zheng F. Kushner S.R. Saper M.A. Bardwell J.C. Jakob U. Mol. Cell. 2000; 6: 349-360Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar) was used to transfer the rrmJΔ567 allele into BL21. We then selected for tetR and screened for the slow growth phenotype observed inrrmJ deletion strains (1Bügl H. Fauman E.B. Staker B.L. Zheng F. Kushner S.R. Saper M.A. Bardwell J.C. Jakob U. Mol. Cell. 2000; 6: 349-360Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar).Table IStrains and plasmids used in this studyStrainsGenotypeSourceMG1655rph-1Lab collectionHB24MG1655;zgi-203::Tn10,-TCR(1Bügl H. Fauman E.B. Staker B.L. Zheng F. Kushner S.R. Saper M.A. Bardwell J.C. Jakob U. Mol. Cell. 2000; 6: 349-360Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar)HB23MG1655,zgi-203::Tn10,TCR,rrmJΔ567(1Bügl H. Fauman E.B. Staker B.L. Zheng F. Kushner S.R. Saper M.A. Bardwell J.C. Jakob U. Mol. Cell. 2000; 6: 349-360Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar)HB25HB23, pHB1(1Bügl H. Fauman E.B. Staker B.L. Zheng F. Kushner S.R. Saper M.A. Bardwell J.C. Jakob U. Mol. Cell. 2000; 6: 349-360Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar)HB1BL21 (DE3), pHB1(1Bügl H. Fauman E.B. Staker B.L. Zheng F. Kushner S.R. Saper M.A. Bardwell J.C. Jakob U. Mol. Cell. 2000; 6: 349-360Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar)BL21 (DE3)F− ompT hsdS B−(rB−mB−) gal dcm (DE3)NovageneJUH47BL21 (DE3),rrmJΔ567; TcRBL21 × P1 (HB23)PlasmidsRelevant featuresSourcepET11apBR322-derivedNovagenepHB1pET11a/rrmJ(1Bügl H. Fauman E.B. Staker B.L. Zheng F. Kushner S.R. Saper M.A. Bardwell J.C. Jakob U. Mol. Cell. 2000; 6: 349-360Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar)pJUH12pET11a/rrmJ K38AThis studypJUH18pET11a/rrmJ D83AThis studypJUH8pET11a/rrmJ D124AThis studypJUH21pET11a/rrmJ K164AThis studypJUH13pET11a/rrmJ E199AThis studypJUH11pET11a/rrmJ Y201AThis study Open table in a new tab To investigate the expression level of wild type RrmJ in HB24 and of the mutant proteins in the transformed HB23 (rrmΔJ567) strains, Western blot analysis using polyclonal antibodies against RrmJ was performed. The transformed strains were grown in LB medium supplemented with 100 μg/ml ampicillin until an A 600 of 0.5 was reached. Then, a 2-ml aliquot of cells was taken, resuspended in 85 μl of 2× SDS-Laemmli buffer, and boiled for 20 min. The proteins were separated on a 14% Tris-glycine PAGE (NOVEX), and RrmJ was visualized using Western blot analysis. To investigate whether the RrmJ mutant proteins are expressed in a soluble form in HB23 cells, cell lysates were prepared (see below), and the presence of RrmJ in the soluble supernatant was determined with Western blot analysis. 2D gel analysis of the protein composition of 50 S ribosomal subunits of HB24 (WT) and of 50 S and 40 S ribosomal particles of HB23 (rrmΔJ567) was performed according to Geyl et al. (12Geyl D. Bock A. Isono K. Mol. Gen. Genet. 1981; 181: 309-312Crossref PubMed Scopus (162) Google Scholar). The 40 S and 50 S ribosomal subunits were prepared as described previously (1Bügl H. Fauman E.B. Staker B.L. Zheng F. Kushner S.R. Saper M.A. Bardwell J.C. Jakob U. Mol. Cell. 2000; 6: 349-360Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar). Analytical polysome profiles of the wild type strain HB24, the rrmJ deletion strain HB23, and HB23 expressing the individual rrmJ mutants were obtained by sucrose gradient centrifugation of the lysates under dissociating salt conditions (50 mm HEPES/KOH, pH 7.5, 200 mm NH4Cl, 1 mmMgCl2, 2 mm β-mercaptoethanol). The profiles were analyzed as described (1Bügl H. Fauman E.B. Staker B.L. Zheng F. Kushner S.R. Saper M.A. Bardwell J.C. Jakob U. Mol. Cell. 2000; 6: 349-360Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar). The purification of the RrmJ mutants was performed according to Bügl et al.(1Bügl H. Fauman E.B. Staker B.L. Zheng F. Kushner S.R. Saper M.A. Bardwell J.C. Jakob U. Mol. Cell. 2000; 6: 349-360Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar). Slight modifications were applied to optimize the purification protocol. JUH47 strains containing the rrmJ mutant plasmids were grown in 1 liter of LB medium containing 100 μg/ml ampicillin to an A 600 = 0.7 at 37 °C. Induction of protein expression and cell lysis was performed as described (1Bügl H. Fauman E.B. Staker B.L. Zheng F. Kushner S.R. Saper M.A. Bardwell J.C. Jakob U. Mol. Cell. 2000; 6: 349-360Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar). The lysis buffer was 40 mm HEPES/KOH, 150 mmKCl, pH 8.0, 1 mm dithiothreitol, 2% (v/v) glycerol. To purify the RrmJ mutant proteins, a tandem 5-ml HiTrapTM Q-SepharoseTM (AmershamBiosciences) connected to a 5-ml HiTrapTMSP-SepharoseTM (Amersham Biosciences) column was used. The cell lysate was applied (flow rate of 4 ml/min), and after washing the column with lysis buffer the proteins were eluted by applying a linear 300-ml gradient from 150 to 600 mm KCl in lysis buffer. The fractions were analyzed by SDS-PAGE, and the RrmJ-containing fractions were pooled and concentrated. The purity of the proteins was greater than 95%. The buffer was exchanged to RrmJ storage buffer (40 mm HEPES/KOH, pH 7.5, 150 mm KCl, 2% (v/v) glycerol, 1 mm dithiothreitol). The protein concentration was determined by UV absorbance using an extinction coefficient of 1.00 for a 1 mg/ml solution at A 280 (1Bügl H. Fauman E.B. Staker B.L. Zheng F. Kushner S.R. Saper M.A. Bardwell J.C. Jakob U. Mol. Cell. 2000; 6: 349-360Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar). Protein concentration determination was not significantly influenced by the presence of the absorbing cofactor AdoMet in the preparation. This was confirmed by performing a Bradford assay, using the AdoMet-free D83A mutant RrmJ protein as a standard protein (data not shown). To determine the amount of AdoMet present in the various RrmJ mutant preparations, we first generated an AdoMet titration curve. A 23 μm solution of our AdoMet-free D83A mutant RrmJ protein was prepared, and 1 μm AdoMet (ε257 = 15,400 M−1 cm−1) was added per titration step. After each AdoMet addition, theA 280/A 260 ratio of the protein/AdoMet mixture was determined. After volume correction, this ratio was plotted against the amount of titrated AdoMet. Then, theA 280/A 260 ratio of the purified RrmJ mutants was determined, and the amount of bound AdoMet was calculated. 50 S ribosomal subunits of HB23 (rrmΔJ567) were prepared as described previously (1Bügl H. Fauman E.B. Staker B.L. Zheng F. Kushner S.R. Saper M.A. Bardwell J.C. Jakob U. Mol. Cell. 2000; 6: 349-360Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar). Re-analysis of purified 50 S subunits on sucrose gradients revealed that the preparation is >98% pure. These subunits served as in vitro substrates for wild type RrmJ and the mutant proteins in the methylation assay (1Bügl H. Fauman E.B. Staker B.L. Zheng F. Kushner S.R. Saper M.A. Bardwell J.C. Jakob U. Mol. Cell. 2000; 6: 349-360Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar). The RrmJ concentrations used in this assay were 20, 100, or 200 nmin 50 mm HEPES/KOH, pH 7.5, 85 mmNH4Cl, 3 mm MgCl2, 2 mmβ-mercaptoethanol. The initial rate for methylation was measured in the presence of 5 μm 50 S ribosomal subunits and increasing amounts of radioactive [3H]S-adenosyl-l-methionine (85.0 Ci/mmol; Amersham Biosciences). To determine the apparentK m for 50 S ribosomal subunits, the methylation assay was performed in the presence of 50 μm AdoMet and varying concentrations of 50 S ribosomal subunits. To determine the specific activity of wild type RrmJ and the mutant proteins, the assay was carried out using 100 and 200 nm RrmJ mutant protein, 50 μm AdoMet, and either 5 or 8 μm 50 S ribosomal subunits, depending on the RrmJ mutant. The methylation reaction was performed at 37 °C. At defined time points (2.5, 5, 7.5, and 10 min) after initiating the methylation reaction, 8-μl aliquots were taken, and the [3H]methyl incorporation into 23 S rRNA was determined as described (1Bügl H. Fauman E.B. Staker B.L. Zheng F. Kushner S.R. Saper M.A. Bardwell J.C. Jakob U. Mol. Cell. 2000; 6: 349-360Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar). The slopes of the methyl incorporation versus time plots were calculated, and the initial velocities obtained were plotted against the respective substrate concentration. The curve was then fitted using a single rectangular hyperbola. To analyze the influence of our amino acid substitutions on the methyltransfer activity of RrmJ, we first needed to characterize the enzymatic properties of wild type RrmJ. The apparent V max of the methyltransfer reaction, as well as the apparent K m values for 50 S ribosomal subunits and AdoMet, were determined by in vitromethylation assays using purified RrmJ and radioactively labeled AdoMet. 50 S ribosomal subunits were prepared from the rrmJdeletion strain HB23, because their 23 S rRNA lacks the U2552 methylation catalyzed by RrmJ. We first established assay conditions (see “Experimental Procedures”) in which the rate of [3H]methyl incorporation from [3H]AdoMet into 23 S rRNA was proportional to the RrmJ concentration and linear over more than 150 min (data not shown). Thus, the initial rate measurements represented true initial velocities, and the dependence of the rate on substrate concentration could be measured. Initial velocity data were first obtained with a fixed high concentration of AdoMet (50 μm) and varying concentrations of 50 S ribosomal subunits. The apparent K m value for 23 S rRNA within 50 S ribosomal subunits was determined to be 0.8 + 0.1 μmwith an apparent K cat of 0.064 min−1 at 37 °C (Fig.1 A). This is a significantly higher K m value than the one determined for the mRNA in VP39 (K m = 5 nm) (13Barbosa E. Moss B. J. Biol. Chem. 1978; 253: 7698-7702Abstract Full Text PDF PubMed Google Scholar) but very similar to the K m value determined for the 23 S rRNA methyltransferase ErmC′ from Bacillus subtilis. ErmC′ has been shown to dimethylate adenine 2058 (E. colinumbering) in naked 23 S rRNA, early in the ribosomal maturation process (13Barbosa E. Moss B. J. Biol. Chem. 1978; 253: 7698-7702Abstract Full Text PDF PubMed Google Scholar, 14Denoya C.D. Dubnau D. J. Bacteriol. 1987; 169: 3857-3860Crossref PubMed Google Scholar). To determine the apparent K m value for AdoMet, the 50 S ribosomal subunits were kept at saturating concentrations (5 μm), and AdoMet was varied (Fig.1 A, inset). The initial velocity experiments revealed an apparent K m for AdoMet of 3.7 + 0.3 μm and the same K cat of 0.064 min−1. From these results it became clear that RrmJ and the 2′-O-ribose methyltransferase VP39 do not only share a very similar K m for AdoMet, which is 2 μm for VP39 (13Barbosa E. Moss B. J. Biol. Chem. 1978; 253: 7698-7702Abstract Full Text PDF PubMed Google Scholar), but also a similarly low turnover number. The K cat for VP39 has only very recently been determined to be 0.13 min−1 (15Hu G. Oguro A., Li, C. Gershon P.D. Quiocho F.A. Biochemistry. 2002; 41: 7677-7687Crossref PubMed Scopus (32) Google Scholar). As is the case for VP39, the RrmJ catalyzed reaction was linear over more than 150 min and, therefore, through more than 10 turnovers (data not shown). This excluded the possibility that the low K catobserved for RrmJ is because of problems to multiple turnovers but may be because of slow chemical steps (15Hu G. Oguro A., Li, C. Gershon P.D. Quiocho F.A. Biochemistry. 2002; 41: 7677-7687Crossref PubMed Scopus (32) Google Scholar) or because of accessibility problems of the methylation site in the intact 50 S ribosomal subunits that are used in our in vitro studies (see below). Because of this low turnover number, however, our initial rate measurements that were followed over a 10-min time period need to be considered pre-steady state measurements rather than steady-state measurements. We considered that one possible reason for the heat shock induction of RrmJ could be a possible temperature lability of the enzyme. This would require the overexpression of RrmJ at heat shock temperatures to compensate for the potential loss of function. For this reason, we measured the activity of RrmJ under saturating substrate concentrations over a variety of temperatures (Fig. 1 B). We found that the temperature optimum of the methyltransferase activity of RrmJ was at 55 °C. The decreased activity at temperatures beyond 55 °C is either because of instability of the 50 S ribosomal subunits or because of thermal inactivation of RrmJ. In either case, these results excluded the possibility that the heat shock regulation of RrmJ is based on thermal lability of the enzyme. RrmJ is able to methylate 23 S rRNA in isolated 50 S ribosomal subunits, as well as in 70 S ribosomes (1Bügl H. Fauman E.B. Staker B.L. Zheng F. Kushner S.R. Saper M.A. Bardwell J.C. Jakob U. Mol. Cell. 2000; 6: 349-360Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar, 2Caldas T. Binet E. Bouloc P. Costa A. Desgres J. Richarme G. J. Biol. Chem. 2000; 275: 16414-16419Abstract Full Text Full Text PDF PubMed Scopus (122) Google Scholar), but is unable to methylate naked 23 S rRNA or 23 S rRNA that is present in 40 S ribosomal particles that have been shown to accumulate in cell lysates of rrmJ deletion strains under dissociating salt conditions (1Bügl H. Fauman E.B. Staker B.L. Zheng F. Kushner S.R. Saper M.A. Bardwell J.C. Jakob U. Mol. Cell. 2000; 6: 349-360Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar). To analyze the substrate requirements of RrmJ in more detail, we performed 2D gel analysis to compare the protein composition of the 50 S ribosomal subunits of the rrmJ deletion strain with that of wild type strains. As shown in Fig.2, all 30 ribosomal proteins were detectable at similar levels in the two strains (Fig. 2, Aand B). These data reveal that the absence of methylation of the highly conserved U2552 does not affect the folding of the 23 S rRNA to an extent that impairs the correct assembly of the 50 S ribosomal subunit. To get some idea how accessible U2552 is in the intact 50 S ribosomal subunit, we performed modeling studies using the crystal structure of the Deinococcus radiodurans 50 S ribosomal subunit (16Harms J. Schluenzen F. Zarivach R. Bashan A. Gat S. Agmon I. Bartels H. Franceschi F. Yonath A. Cell. 2001; 107: 679-688Abstract Full Text Full Text PDF PubMed Scopus (772) Google Scholar) and RrmJ. Although solvent-accessible, U2552 (E. coli nomenclature) is positioned at the bottom of a deep cleft. Assuming that this conserved residue has the same position in theE. coli 50 S ribosomal subunits, this would make it rather inaccessible for RrmJ methylation and might require the 23 S rRNA to loop out so that RrmJ can gain access. This could certainly be a rate-limiting step that might occur in vitro but might not happen in vivo where RrmJ could methylate precursors whose A-loop is more accessible. This may explain the low turnover numbers we observe in our in vitro methylation reactions where completely assembled 50 S ribosomal subunits are used as substrates. The 40 S ribosomal particles that accumulate under dissociating salt conditions in lysates prepared from rrmJ deletion strains are not in vitro substrates of RrmJ (1Bügl H. Fauman E.B. Staker B.L. Zheng F. Kushner S.R. Saper M.A. Bardwell J.C. Jakob U. Mol. Cell. 2000; 6: 349-360Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar). 2D gel analysis of the 40 S peak reveals that at least seven different ribosomal proteins (L5, L16, L18, L25, L27, L28, L30) are present in significantly diminished amounts compared with 50 S ribosomal subunits (Fig. 2,B and C). All of these proteins belong to the group of late assembly proteins (17Nierhaus K.H. Biochimie (Paris). 1991; 73: 739-755Crossref PubMed Scopus (179) Google Scholar). While true ribosome precursors are also detectable under non-stringent, associating salt conditions, these 40 S particles only develop when the salt conditions become stringent. It is therefore more likely that they represent a mixture of destabilized 50 S particles that are lacking various late assembly proteins. Thus, the absence of Um2552 in the A-site of the ribosome appears to destabilize the 50 S ribosomal subunit and leads to premature dissociation of a number of ribosomal proteins probably causing structural changes in the 23 S rRNA that prevents RrmJ from recognizing it as a substrate. Surprisingly little is known about the catalytic mechanism of any 2′-O-ribose methyltransferase. Although a reaction mechanism has been postulated for VP39 on the basis of its crystal structure (18Hodel A.E. Quiocho F.A. Gershon P.D. Cheng X. Blumenthal R.M. S-Adenosylmethionine-dependent Methyltransferases: Structures and Functions. World Scientific, Riveredge, NJ1999: 255-282Crossref Google Scholar), experimental data has not been obtained to support this hypothesis. We have, therefore, decided to combine structural analysis and site-specific mutagenesis to investigate the methyltransfer reaction of RrmJ. The first step in this analysis was to determine which residues are essential for catalysis. Of all the methyltransferases that have been crystallized so far, VP39 and fibrillarin are the two enzymes whose structures resemble that of RrmJ the most (1Bügl H. Fauman E.B. Staker B.L. Zheng F. Kushner S.R. Saper M.A. Bardwell J.C. Jakob U. Mol. Cell. 2000; 6: 349-360Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar). VP39 methylates the first transcribed nucleotide" @default.
W2034407986 created "2016-06-24" @default.
W2034407986 creator A5010918012 @default.
W2034407986 creator A5019538811 @default.
W2034407986 creator A5046177432 @default.
W2034407986 creator A5051588174 @default.
W2034407986 date "2002-11-01" @default.
W2034407986 modified "2023-09-30" @default.
W2034407986 title "Active Site in RrmJ, a Heat Shock-induced Methyltransferase" @default.
W2034407986 cites W1509176726 @default.
W2034407986 cites W1556223086 @default.
W2034407986 cites W1570397481 @default.
W2034407986 cites W1884985693 @default.
W2034407986 cites W1995226057 @default.
W2034407986 cites W2008288225 @default.
W2034407986 cites W2031765531 @default.
W2034407986 cites W2036787271 @default.
W2034407986 cites W2037129989 @default.
W2034407986 cites W2042366522 @default.
W2034407986 cites W2059346861 @default.
W2034407986 cites W2066971343 @default.
W2034407986 cites W2069006508 @default.
W2034407986 cites W2087416703 @default.
W2034407986 cites W2087679230 @default.
W2034407986 cites W2088759292 @default.
W2034407986 cites W2095563102 @default.
W2034407986 cites W2105431696 @default.
W2034407986 cites W2132740573 @default.
W2034407986 cites W2157353874 @default.
W2034407986 cites W2169351558 @default.
W2034407986 cites W2170507799 @default.
W2034407986 doi "https://doi.org/10.1074/jbc.m205423200" @default.
W2034407986 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12181314" @default.
W2034407986 hasPublicationYear "2002" @default.
W2034407986 type Work @default.
W2034407986 sameAs 2034407986 @default.
W2034407986 citedByCount "85" @default.
W2034407986 countsByYear W20344079862012 @default.
W2034407986 countsByYear W20344079862013 @default.
W2034407986 countsByYear W20344079862014 @default.
W2034407986 countsByYear W20344079862015 @default.
W2034407986 countsByYear W20344079862018 @default.
W2034407986 countsByYear W20344079862019 @default.
W2034407986 countsByYear W20344079862020 @default.
W2034407986 countsByYear W20344079862021 @default.
W2034407986 countsByYear W20344079862022 @default.
W2034407986 countsByYear W20344079862023 @default.
W2034407986 crossrefType "journal-article" @default.
W2034407986 hasAuthorship W2034407986A5010918012 @default.
W2034407986 hasAuthorship W2034407986A5019538811 @default.
W2034407986 hasAuthorship W2034407986A5046177432 @default.
W2034407986 hasAuthorship W2034407986A5051588174 @default.
W2034407986 hasBestOaLocation W20344079861 @default.
W2034407986 hasConcept C12554922 @default.
W2034407986 hasConcept C126322002 @default.
W2034407986 hasConcept C181199279 @default.
W2034407986 hasConcept C185592680 @default.
W2034407986 hasConcept C2781300812 @default.
W2034407986 hasConcept C33288867 @default.
W2034407986 hasConcept C41183919 @default.
W2034407986 hasConcept C552990157 @default.
W2034407986 hasConcept C55493867 @default.
W2034407986 hasConcept C71924100 @default.
W2034407986 hasConcept C86803240 @default.
W2034407986 hasConcept C91965660 @default.
W2034407986 hasConceptScore W2034407986C12554922 @default.
W2034407986 hasConceptScore W2034407986C126322002 @default.
W2034407986 hasConceptScore W2034407986C181199279 @default.
W2034407986 hasConceptScore W2034407986C185592680 @default.
W2034407986 hasConceptScore W2034407986C2781300812 @default.
W2034407986 hasConceptScore W2034407986C33288867 @default.
W2034407986 hasConceptScore W2034407986C41183919 @default.
W2034407986 hasConceptScore W2034407986C552990157 @default.
W2034407986 hasConceptScore W2034407986C55493867 @default.
W2034407986 hasConceptScore W2034407986C71924100 @default.
W2034407986 hasConceptScore W2034407986C86803240 @default.
W2034407986 hasConceptScore W2034407986C91965660 @default.
W2034407986 hasIssue "44" @default.
W2034407986 hasLocation W20344079861 @default.
W2034407986 hasOpenAccess W2034407986 @default.
W2034407986 hasPrimaryLocation W20344079861 @default.
W2034407986 hasRelatedWork W1847536157 @default.
W2034407986 hasRelatedWork W1884111881 @default.
W2034407986 hasRelatedWork W1997325767 @default.
W2034407986 hasRelatedWork W2009655002 @default.
W2034407986 hasRelatedWork W2049704889 @default.
W2034407986 hasRelatedWork W2087850900 @default.
W2034407986 hasRelatedWork W2160460628 @default.
W2034407986 hasRelatedWork W2161293327 @default.
W2034407986 hasRelatedWork W2165507632 @default.
W2034407986 hasRelatedWork W2804640336 @default.
W2034407986 hasVolume "277" @default.
W2034407986 isParatext "false" @default.
W2034407986 isRetracted "false" @default.
W2034407986 magId "2034407986" @default.
W2034407986 workType "article" @default.