FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2034453103> ?p ?o ?g. }

• W2034453103 endingPage "2925" @default.
• W2034453103 startingPage "2917" @default.
• W2034453103 abstract "A novel cDNA was partially isolated from a HepG2 cell expression library by screening with the promoter-linked coupling element (PCE), a site from the α-fetoprotein (AFP) gene promoter. The remainder of the cDNA was cloned from fetal liver RNA using random amplification of cDNA ends. The cDNA encodes a 239-amino acid peptide with domains closely related to the Drosophila factor nk-2. The new factor is the eighth vertebrate factor related to nk-2, hencenkx-2.8. Northern blot and reverse transcriptase polymerase chain reaction analysis demonstrated mRNA in HepG2, two other AFP-expressing human cell lines, and human fetal liver. Transcripts were not detected in adult liver. Cell-free translation produced DNA binding activity that gel shifted a PCE oligonucleotide. Cotransfection of nkx-2.8 expression and PCE reporter plasmids into HeLa cells demonstrated transcriptional activation; NH2-terminal deletion eliminated this activity. Cotransfection into AFP-producing hepatocytic cells repressed AFP reporter expression, suggesting that endogenous activity was already present in these cells. In contrast, cotransfection into an AFP-negative hepatocytic line produced moderate activation of the AFP gene. The cardiac developmental factornkx-2.5 could substitute for nkx-2.8 in all transfection assays, whereas another related factor, thyroid transcription factor 1, showed a more limited range of substitution. Although the studies have yet to establish definitively thatnkx-2.8 is the AFP gene regulator PCF, the two factors share a common DNA binding site, gel shift behavior, migration on SDS-acrylamide gels, and cellular distribution. Moreover, the nk-2-related genes are developmental regulators, and nkx-2.8 is the first such factor associated with liver development. A novel cDNA was partially isolated from a HepG2 cell expression library by screening with the promoter-linked coupling element (PCE), a site from the α-fetoprotein (AFP) gene promoter. The remainder of the cDNA was cloned from fetal liver RNA using random amplification of cDNA ends. The cDNA encodes a 239-amino acid peptide with domains closely related to the Drosophila factor nk-2. The new factor is the eighth vertebrate factor related to nk-2, hencenkx-2.8. Northern blot and reverse transcriptase polymerase chain reaction analysis demonstrated mRNA in HepG2, two other AFP-expressing human cell lines, and human fetal liver. Transcripts were not detected in adult liver. Cell-free translation produced DNA binding activity that gel shifted a PCE oligonucleotide. Cotransfection of nkx-2.8 expression and PCE reporter plasmids into HeLa cells demonstrated transcriptional activation; NH2-terminal deletion eliminated this activity. Cotransfection into AFP-producing hepatocytic cells repressed AFP reporter expression, suggesting that endogenous activity was already present in these cells. In contrast, cotransfection into an AFP-negative hepatocytic line produced moderate activation of the AFP gene. The cardiac developmental factornkx-2.5 could substitute for nkx-2.8 in all transfection assays, whereas another related factor, thyroid transcription factor 1, showed a more limited range of substitution. Although the studies have yet to establish definitively thatnkx-2.8 is the AFP gene regulator PCF, the two factors share a common DNA binding site, gel shift behavior, migration on SDS-acrylamide gels, and cellular distribution. Moreover, the nk-2-related genes are developmental regulators, and nkx-2.8 is the first such factor associated with liver development. Developmental processes are frequently associated with expression of specific homeobox transcription factors. Although all share a common form of DNA binding domain, the hundreds of known homeobox factors belong to many subfamilies with a wide variety of secondary domains (1Duboule D. Guidebook to the Homeobox Genes. Oxford University Press, Oxford1994Google Scholar). The Drosophila factor nk-2 is the prototype of a distinct family of homeobox factors. nk-2-related homeodomain factors have been characterized in Drosophila(nk-2, nk-3/bagpipe, and nk-4/tinman/msh2), planarians (Dth1 and Dth2), leeches (lox10), Caenorhabditis(Ceh22), and vertebrates (nkx-2.1 to2.7) (2Durocher D. Chen C.-Y. Ardati A. Schwartz R.J. Nemer M. Mol. Cell. Biol. 1996; 16: 4648-4655Crossref PubMed Scopus (133) Google Scholar). The nk-2-related factors contain a characteristic secondary domain, the “conserved peptide,” which has an unknown function and is unrelated to known protein domains. The three Drosophila homologues have important developmental functions. nk-2 is involved in early neurogenesis, nk-3 is required for visceral muscle formation, and nk-4 is essential for the formation of precardiac mesoderm. The vertebrate nk-2 factors also regulate development. nkx-2.1, or thyroid transcription factor 1 (TTF-1), 1The abbreviations used are: TTF-1, thyroid transcription factor 1; AFP, α-fetoprotein; PCE, AFP gene promoter-linked coupling element; PCF, HepG2 transcription factor that binds PCE; PCR, polymerase chain reaction; bp, base pair(s); PBDG, porphobilinogen deaminase; HIV, human immunodeficiency virus; CAT, chloramphenicol acetyltransferase; CMV, cytomegalovirus; kb, kilobase(s); FTF, fetal transcription factor. 1The abbreviations used are: TTF-1, thyroid transcription factor 1; AFP, α-fetoprotein; PCE, AFP gene promoter-linked coupling element; PCF, HepG2 transcription factor that binds PCE; PCR, polymerase chain reaction; bp, base pair(s); PBDG, porphobilinogen deaminase; HIV, human immunodeficiency virus; CAT, chloramphenicol acetyltransferase; CMV, cytomegalovirus; kb, kilobase(s); FTF, fetal transcription factor. is a regulator of thyroid-specific gene expression, thyroid development, thyroid cell differentiation, and thyroid cell proliferation (3Guazzi S. Price M. DeFelice M. Damante G. Mattei M.-G. DiLauro R. EMBO J. 1990; 9: 3631-3639Crossref PubMed Scopus (467) Google Scholar, 4De Felice M. Damante G. Zannini M. Francis-Lang H. Di Lauro R. J. Biol. Chem. 1995; 270: 26649-26656Abstract Full Text Full Text PDF PubMed Scopus (103) Google Scholar) and is first expressed several days before thyroid differentiation (5Guazzi S. Lonigro R. Pintonello L. Boncinelli E. DiLauro R. Mavilio F. EMBO J. 1994; 13: 3339-3341Crossref PubMed Scopus (64) Google Scholar). TTF-1/nkx-2.1 also regulates pulmonary development and gene expression (6Minoo P. Hamdan H. Bu D. Warburton D. Stepanik P. de Lemos R. Dev. Biol. 1995; 172: 694-698Crossref PubMed Scopus (137) Google Scholar, 7Yan C. Sever Z. Whitsett J.A. J. Biol. Chem. 1995; 270: 24852-24857Abstract Full Text Full Text PDF PubMed Scopus (113) Google Scholar). nkx-2.5/Csx and nkx-2.3 are both expressed in early cardiac primordia and thus replicate the function of tinman (8Evans S.M. Yan W. Murillo M.P. Ponce J. Papalopulu N. Development. 1995; 121: 3889-3899Crossref PubMed Google Scholar). nkx-2.6 is also expressed in heart. In Drosophila, ablation of tinman blocks cardiac development, whereas knockout of mouse nkx-2.5 arrests heart development at the looping stage (8Evans S.M. Yan W. Murillo M.P. Ponce J. Papalopulu N. Development. 1995; 121: 3889-3899Crossref PubMed Google Scholar). This is a less severe phenotype than the Drosophila knockout and probably reflects functional redundance with nkx-2.3 and nkx-2.6(9Lyons I. Parsons L.M. Hartley L. Li R. Andrews J.E. Robb L. Harvey R.P. Genes Dev. 1995; 9: 1654-1666Crossref PubMed Scopus (944) Google Scholar). nkx-2.7, another tinman homologue related to cardiac development, has recently been described in zebrafish (10Lee K.-H. Xu Q. Breitbart R.E. Dev. Biol. 1996; 180: 722-731Crossref PubMed Scopus (147) Google Scholar). nkx-2.2 is expressed in developing mouse brain, with an onset of expression at about 9 days gestation. The transcripts are found in localized regions that correspond to anatomic boundaries in the developing forebrain. The localization suggests thatnkx-2.2 specifies differentiation of the developing diencephalon into its anatomically and functionally defined subregions (11Price M. Lazzaro D. Pohl T. Mattei M.G. Ruther U. Olivo J.C. Duboule D. DiLauro R. Neuron. 1992; 8: 241-255Abstract Full Text PDF PubMed Scopus (247) Google Scholar). In mice the cardiac mesenchyme forms from the ventral wall of the foregut at 8.5 days gestation, and the hepatic primordium buds from an adjacent area of the foregut at 8.5–9 days gestation (12Zaret K.S. Annu. Rev. Physiol. 1996; 58: 231-251Crossref PubMed Scopus (95) Google Scholar). There is a strong association between this early phase of cardiac differentiation and nk-2-related factors, but no homeodomain factors of any sort have been associated with initial differentiation of the liver, later differentiation of bile ducts, or regulation of hepatic stem cells. Two homeobox factors, HNF-1 (13Tronche F. Yaniv M. BioEssays. 1992; 14: 579-587Crossref PubMed Scopus (193) Google Scholar, 14Pontoglio M. Barra J. Hadchouel M. Doyen A. Kress C. Bach J.P. Babinet C. Yaniv M. Cell. 1996; 84: 575-585Abstract Full Text Full Text PDF PubMed Scopus (506) Google Scholar) and HNF-6 (15Lemaigre F.P. Durviaux S.M. Truong O. Hsuan J.J. Rousseau G.G. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 9460-9464Crossref PubMed Scopus (128) Google Scholar), are associated with the liver, but they regulate only the postdevelopmental phenotype. Another homeobox gene, hlx, has a limited effect on liver development. However, hlx is expressed in hematopoietic cells of fetal liver, not hepatocytes. Mice with targeted disruption of this gene undergo normal early hepatic differentiation, but the failure of hematopoietic cells to colonize the fetal liver results in a small but normally formed liver (16Hentsch B. Lyons I. Hartley L. Lints T.J. Adams J.M. Harvey R.P. Genes Dev. 1996; 10: 70-79Crossref PubMed Scopus (151) Google Scholar). Our research has focused on the α-fetoprotein (AFP) gene, characteristically expressed from the earliest stages of liver development, but silent after birth. A site near the AFP promoter, the promoter-linked coupling element (PCE), appears to interact with the main developmental regulators of AFP expression. In HepG2 cells, the PCE binding activity has been characterized as a distinct transcription factor, PCF (17Wen P. Crawford N. Locker J. Nucleic Acids Res. 1993; 21: 1911-1918Crossref PubMed Scopus (24) Google Scholar, 18Wen P. Locker J. Mol. Cell. Biol. 1994; 14: 6616-6626Crossref PubMed Google Scholar). To characterize PCF further, we used a PCE-containing oligonucleotide for expression cloning, leading to the isolation of nkx-2.8, which shares numerous properties with PCF. This is the first demonstration of an association between annk-2 homeobox factor and liver gene expression. A λgt11 library of oligo(dT)-primed cDNA from HepG2 cells (CLONTECH) was screened for plaques that bound the PCE in the AFP gene promoter (−166 to −155, TGTTCAAGGACA; Ref. 18Wen P. Locker J. Mol. Cell. Biol. 1994; 14: 6616-6626Crossref PubMed Google Scholar). This sequence and its complement were included in a double-stranded oligonucleotide with added TCGA sticky ends. Probe preparation and screening were modified from previously described methods (19Vinson C.R. LaMarco K.L. Johnson P.F. Landschulz W.H. McKnight S.L. Genes Dev. 1988; 2: 801-806Crossref PubMed Scopus (343) Google Scholar, 20Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989: 12.1-12.44Google Scholar). The oligonucleotide was labeled with polynucleotide kinase and [γ-32P]ATP and concatenated with DNA ligase to an average size of 5–10 repeats with a specific activity of 5 × 108 d/min/μg. Bacteriophage were plated using Escherichia coli strain Y1090. Plaques were lifted onto Millipore HATF membranes, air dried, incubated in blocking buffer (5% nonfat dry milk, 25 mm HEPES, pH 7.9, 5 mm MgCl2, 40 mm KCl, 1 mm dithiothreitol) for 30 min and then probe mix (0.25% nonfat dry milk, 25 mm HEPES, pH 7.9, 5 mmMgCl2, 40 mm KCl, 0.1 mmdithiothreitol, 10 μg/ml sonicated denatured DNA, and 10 ng/ml labeled concatenated probe) for 12 h. DNA from Micrococcus lysodeiktikus was chosen for this mixture for its high G+C content (70%) and provided a very effective background competition that greatly enhanced the sensitivity of the screen. A screen of 1,000,000 phage plaques produced a single clone with appropriate binding specificity. A second screen of 2,000,000 plaques from another HepG2 library in λZAP (Stratagene, La Jolla, CA) provided no additional positives. Upon sequencing, the positive clone was found to be truncated at the 5′-end by an in-frame deletion that also removed part of the β-galactosidase gene. PCR assays (see below) were used to screen pooled DNA isolated from both libraries but detected only the single partially deleted clone. The cloned insert was subcloned in pBluescript KS+ (Stratagene). Because clonal instability was observed, this and all further subclones were propagated in a DNA repair and recombination-deficient E. coli host (SURE, Stratagene). From the sequence of the new clone, direct and reverse transcriptase PCR assays (below) were used to screen a variety of RNA sources. A positive detection was obtained from a commercial cDNA prepared from human fetal liver (Marathon-Ready cDNA, CLONTECH) which was synthesized using random amplification of cDNA ends cloning adaptor annealed to the 5′-end. Amplification was carried out with primers AP1 and R5A and Tth DNA polymerase (denaturation at 95 °C for 2 min; 40 cycles of 95 °C for 40 s, 68 °C for 4 min). A weak PCR product was then reamplified with two combinations of nested primers, using the same temperature-cycling protocol. Primers AP2 and R13A gave products of 160 and 340 bp; primers AP2 and R7A gave products of 410 and 590 bp. The PCR products were subcloned in pCR-Script SK+ (Stratagene), and multiple clones were sequenced. All represented the same region, with predicted size differences based on primer position. The shorter PCR products were terminated at a high G+C region within the longer one. Thus all clones represented a single mRNA. Two allelic variants were recognized. For PCR studies, except where otherwise specified, enzymes were used with buffers and conditions supplied by the manufacturers. The primers are listed in Table I.Table IPCR primersPrimer1-aPrimers AP1 and AP2 are complementary to the 5′-RACE (random amplification of cDNA ends) adaptor (Clontech); primers designated F are forward primers on the sense strand; those designated R are on the reverse strand. Primers named with an A have higherTm value for Tth polymerase and touchdown PCR protocols.Position1-bPrimer positions for the nkx-2.8 gene are numbered as in the sequence of Fig. 1.SequenceAP15′-AdaptorCCATCCTAATACGACTCACTATAGGGCAP25′-AdaptorACTCACTATAGGGCTCGAGCGGCF5A601–628TCATCGCTACAAGCTGAAGCGTGCTCGCGF7320–340GCCGCCTGGCTGGATTCGGAF9542–562GAGCAGCTGGCGAGCCTGCTF10346–370CCACTACCCTTCCTCGGACGAGAGF125–25AGACCCGGACCTCGGCTTTCR5626–602AGCACGCTTCAGCTTGTAGCGATGR5A628–597CGAGCACGCTTCAGCTTGTAGCGATGATTCTR7A568–544AGGCGAAGCAGGCTCGCCAGCTGCTR10A593–567CCAGATCTTGACCTGCGTGGGCGTGAR12A376–346AGGCTGCTCTCGTCCGAGGAAGGGTAGTGGR13A342–320GCTCCGAATCCAGCCAGGCGGCR161168–1141AAGGCCCAAGCATAAAATCTAACTCTGPBDG-ATGTCTGGTAACGGCAATGCGGPBDG-BCAGGCCAGCTGTTGCTAGGAT1-a Primers AP1 and AP2 are complementary to the 5′-RACE (random amplification of cDNA ends) adaptor (Clontech); primers designated F are forward primers on the sense strand; those designated R are on the reverse strand. Primers named with an A have higherTm value for Tth polymerase and touchdown PCR protocols.1-b Primer positions for the nkx-2.8 gene are numbered as in the sequence of Fig. 1. Open table in a new tab Because the high G+C content caused many compression artifacts, all DNA sequencing was verified by sequencing with a thermostable DNA polymerase system (SequiTherm EXCEL, Epicentre Technologies, Madison, WI). The original clone and four plasmid clones from the PCR amplification of the 5′-end were sequenced fully on both strands. A 241-bp region of overlap between the bacteriophage and PCR-generated clones was identical in all clones. All sequences were subjected to BLAST analysis (National Center for Biotechnology, http://www.ncbi.nih.gov/BLAST/). Related sequences were downloaded and compared by FASTA alignment routines (21Pearson W.R. Methods Enzymol. 1990; 183: 63-98Crossref PubMed Scopus (1638) Google Scholar). For additional mapping and to rule out splicing variants the fetal liver cDNA and the gene were analyzed by direct PCR, using Tth DNA polymerase and a “touchdown” amplification protocol (denaturation at 95 °C for 2 min; 7 cycles of 95 °C for 40 s, 72 °C for 4 min; 40 cycles of 95 °C for 40 s, 68 °C for 4 min). RNA isolation from cell lines and tissues, agarose-urea gel electrophoresis, and Northern blot hybridization were carried out as described previously (22Muglia L. Locker J. Nucleic Acids Res. 1984; 12: 6751-6762Crossref PubMed Scopus (46) Google Scholar, 23Schulz W.A. Crawford N. Locker J. Exp. Cell Res. 1988; 174: 433-447Crossref PubMed Scopus (32) Google Scholar). Poly(A) RNA was purified using a magnetic bead system (Poly(A)Tract, Promega, Madison, WI). For each gel lane, 100 μg of total RNA was processed, 50 μg of E. coli tRNA was added, and the entire sample was ethanol precipitated and redissolved for electrophoresis. For a hybridization probe, the F9:R5 PCR product was cloned in pCR-Script SK+. A riboprobe was generated with T7 RNA polymerase following plasmid linearization with PvuII. For PCRs, 1 μg total RNA was incubated in a single tube with primers R5 and PBDG-B and Superscript II reverse transcriptase (Life Technologies) at 45 °C for 1 h. Amplification of nkx-2.8 transcripts was then carried out on an aliquot using primers F7 and R10A and KlenTaq DNA polymerase (CLONTECH). The sample was denatured at 95 °C for 2 min followed by 7 cycles of 95 °C for 40 s, 72 °C for 4 min; and 40 cycles of 95 °C for 40 s, 68 °C for 4 min. A control PCR for a housekeeping mRNA, porphobilinogen deaminase (PBDG; Ref. 24Finke J. Fritzen R. Ternes P. Lange W. Dolken G. BioTechniques. 1993; 14: 448-453PubMed Google Scholar), was carried out with primers PBDG-A and PBDG-B and Taq DNA polymerase. The sample was denatured at 94 °C for 2 min followed by 40 cycles of 94 °C for 30 s, 55 °C for 20 s, and 72 °C for 30 s. Products were visualized on an ethidium bromide-stained agarose gel or transferred to nitrocellulose and detected by hybridization to a specific probe, the product of an F10:R7 PCR. Human cell lines HepG2, HuH7, and HuH1-clone 2 (Clone 2) are derived from hepatocellular carcinomas (25Knowles B.B. Howe C.C. Aden D.P. Science. 1980; 209: 497-499Crossref PubMed Scopus (1491) Google Scholar, 26Nakabayashi H. Hashimoto T. Miyao Y. Tjong K.-K. Chan J. Tamaoki T. Mol. Cell. Biol. 1991; 11: 5885-5893Crossref PubMed Google Scholar, 27Morinaga T. Yasuda H. Hashimoto T. Higashio K. Tamaoki T. Mol. Cell. Biol. 1991; 11: 6041-6049Crossref PubMed Scopus (121) Google Scholar); and RPMI 7451 is from a cholangiocarcinoma (28Storto P.D. Saidman S.L. Demetris A.J. Letessier E. Whiteside T.L. Gollin S.M. Genes Chromosomes Cancer. 1990; 2: 300-310Crossref PubMed Scopus (50) Google Scholar). H4C3 is a rat hepatocellular carcinoma cell line that expresses high levels of albumin and low levels of AFP (23Schulz W.A. Crawford N. Locker J. Exp. Cell Res. 1988; 174: 433-447Crossref PubMed Scopus (32) Google Scholar). Human lung carcinoma cell line H441 was used as a source of TTF-1 for gel shifts (29Ikeda K. Clark J.C. Shaw-White J.R. Stahlman M.T. Boutell C.J. Whitsett J.A. J. Biol. Chem. 1995; 270: 8108-8114Abstract Full Text Full Text PDF PubMed Scopus (172) Google Scholar). All were propagated in Williams E medium containing 1–5% fetal calf serum, penicillin-streptomycin, and glutamine. Specimens of human fetal and adult liver were provided by Dr. Stephen Strom (University of Pittsburgh). CaPO4 transfection of cell lines HepG2, Clone 2, and HeLa was carried out as described previously (30Wen P. Groupp E.R. Buzard G. Crawford N. Locker J. DNA Cell Biol. 1991; 10: 525-536Crossref PubMed Scopus (39) Google Scholar). H4C3 cells were transfected with LipofectAMINE (Life Technologies, Inc.); 10-cm culture plates were inoculated with 1 × 106 cells and transfected after 2 days, using 10 μg of DNA and 60 μl of LipofectAMINE/plate, according to the supplier's protocols. Individual transfection experiments always consisted of a series of identical plates transfected simultaneously under identical conditions. Each determination was the average of two transfections. All described results were reproducible in at least two separate experiments. A PCF reporter plasmid, pPCE4-HIV-CAT, was constructed from plasmid pAPF1-HIV-CAT (31Sladek F. Zhong W. Lai E. Darnell J. Genes Dev. 1990; 4: 2353-2365Crossref PubMed Scopus (845) Google Scholar) by cutting with SalI and PstI to remove the HNF4 binding sites and substituting an 80-bp oligonucleotide array consisting of four copies of the PCE from the AFP promoter. The oligonucleotide contained PCF binding sites in the same orientation spaced at 20-bp intervals. A control plasmid containing no binding sites, pHIV-CAT, was produced by blunt ligating anSalI-PstI-digested plasmid. AFP and albumin gene expression plasmids have been described previously (18Wen P. Locker J. Mol. Cell. Biol. 1994; 14: 6616-6626Crossref PubMed Google Scholar, 30Wen P. Groupp E.R. Buzard G. Crawford N. Locker J. DNA Cell Biol. 1991; 10: 525-536Crossref PubMed Scopus (39) Google Scholar, 32Jin J.R. Wen P. Locker J. DNA Cell Biol. 1995; 14: 267-272Crossref PubMed Scopus (14) Google Scholar). nkx-2.8 expression plasmids were constructed in pCI (Promega), which contains a CMV early enhancer/promoter and SV40 splicing and polyadenylation signals. The vector also contains a multicloning site with an adjacent T7 RNA polymerase promoter. Full-length pCMV-Nkx2.8 and 5′-deleted pCMV-Nkx2.8Δ were cloned as follows. A KpnI-DraI segment of nkx-2.8 (bp 531–1180) was cloned into KpnI and HpaI sites of linker plasmid pSL1180 (Pharmacia Biotech Inc.) and subsequently excised as a KpnI-MluI segment. To construct pCMV-Nkx2.8Δ, a double-stranded synthetic oligonucleotide containing an NheI site, a consensus ribosome binding site, an ATG start codon, and nkx-2.8 bp from 299 to 332 (a TfiI site) was cleaved withNheI and TfiI and annealed toTfiI-KpnI (bp 332–531) and KpnI-MluI segments. The three-segment combination was cloned into the NheI and MluI sites of pCI. pCMV-Nkx2.8Δ expresses a peptide shortened at the NH2terminus by 31 amino acids, corresponding to the original deleted λgt11 clone. To construct the full-length expression plasmid pCMV-Nkx2.8, a segment containing the region from the initiation codon to the KpnI site (bp 532) was amplified by PCR using a 5′-primer that added an NheI site and a consensus ribosome binding sequence. The amplimer was digested withNheI-KpnI and substituted into pCMV-Nkx2.8Δ at the same restriction sites. Expression plasmids pCMV-TTF1 (4De Felice M. Damante G. Zannini M. Francis-Lang H. Di Lauro R. J. Biol. Chem. 1995; 270: 26649-26656Abstract Full Text Full Text PDF PubMed Scopus (103) Google Scholar) and pCGN-Nkx2.5 (33Chen C.Y. Schwartz R.J. J. Biol. Chem. 1995; 270: 15628-15633Crossref PubMed Scopus (268) Google Scholar) were provided by R. DiLauro and R. J. Schwartz, respectively. pCMV-Nkx2.8 and pCMV-Nkx2.8Δ DNAs were linearized with BamHI, transcribed with T7 RNA polymerase, and translated using a TnT® Coupled Wheat Germ Extract System (Promega) according to the supplier's protocols. Labeling with [14C]leucine was also described in these protocols. Cell extracts and gel shift procedures were previously described (18Wen P. Locker J. Mol. Cell. Biol. 1994; 14: 6616-6626Crossref PubMed Google Scholar). Using a combination of approaches, overlapping products have been cloned which encode a novel transcription factor (Fig. 1). BLAST analysis of translated sequences showed two characteristic domains, a homeobox (Fig. 2 A) and a conserved peptide (Fig. 2 B). Both domains established a relationship to the Drosophila factor nk-2. These comparisons also demonstrated that the encoded factor is new, the shortest member of the family described so far. The new factor is the eighth vertebrate nk-2-related factor, hencenkx-2.8.Figure 2Comparison of nkx-2.8 with othernk-2-related factors. Panel A, homeodomains. Related homeodomains were aligned and listed above nkx-2.8in order of decreasing similarity. A consensus sequence was derived fornk-2-related factors, and a second consensus was derived from 100 HOX genes closely related to the Drosophila Antennapedia gene. The nkx-2.8 sequence is inbold type; amino acids that deviate from the consensus are shown in light type. The column labeled Δ shows the number of differences from the nk-2 consensus for each sequence. Predicted DNA base (:) and backbone (.) contacts are also marked (34Pabo C.O. Sauer R.T. Annu. Rev. Biochem. 1992; 61: 1053-1095Crossref PubMed Scopus (1218) Google Scholar). Panel B, conserved peptides. This nkx-2.8 domain (bold type) is closely related to a consensus derived from other nk-2 factors. The domain consists of a nonhelical hydrophobic loop surrounded by highly charged, predominantly basic amino acids. The column labeled Δ shows the number of differences from the consensus. Panel C, 5′-peptides. Conserved peptides found in many nk-2-related factors near the 5′-end are aligned. Position denotes the amino residue where each 5′-peptide is located. Conservative amino acid substitutions areunderlined; nonconservative substitutions are shown inlowercase. Panel D, comparison of nkx-2 proteins. nkx-2.8 is shorter than the related factors but aligns at the 5′-ends of nkx-2.2, nkx-2.5, and murine TTF-1, and with amino acid 30 of human TTF-1, the longest protein in the family. All align at the 3′-end. Studies of protein functional regions, reported for murinenkx-2.5 (33Chen C.Y. Schwartz R.J. J. Biol. Chem. 1995; 270: 15628-15633Crossref PubMed Scopus (268) Google Scholar) and human TTF-1 (4De Felice M. Damante G. Zannini M. Francis-Lang H. Di Lauro R. J. Biol. Chem. 1995; 270: 26649-26656Abstract Full Text Full Text PDF PubMed Scopus (103) Google Scholar), are also summarized.View Large Image Figure ViewerDownload (PPT) Despite its shorter length, the nkx-2.8 open reading frame defines a full-length factor. The 239-amino acid peptide of 25,810 Da is a basic protein with a predicted pI of 9.57. The cDNA also has an unusually high G+C content, 65.8% over its full length and 71.0% in the open reading frame. Other regions of the nkx-2.8 did not show significant relationships on BLAST analysis. However, FASTA alignment demonstrated significant homology to other nk-2-related factors. nkx-2.8 has an NH2-terminal region comparable tonk-2-related factors, which have an 11-amino acid “5′-peptide” near the NH2 terminus (Fig. 2 C). This peptide lies in a similar position in other family members except for human TTF-1, which has a unique 30-residue extension at the 5′-end. Although the 5′-peptide is not conserved innkx-2.8, the nine residues beginning at amino acid 9 (TVRSLLGLP) show 44% identity to the 5′-peptide consensus. Four residues are identical, and the other five represent conservative substitutions. Other alignments (not illustrated) indicate that the NH2-terminal segment of nkx-2.8 is shortened in the middle and near the junction with the homeobox compared with other members of the family. The NH2-terminal segment of nkx-2.5 is a weak transcription activation domain, rich in proline, alanine, acid, and basic amino acid residues (33Chen C.Y. Schwartz R.J. J. Biol. Chem. 1995; 270: 15628-15633Crossref PubMed Scopus (268) Google Scholar). The NH2-terminal segment of nkx-2.8 has a similar composition but with a lower proportion of basic residues. At the COOH terminus, sequences of several factors align directly withnkx-2.8. Thus the major difference from the other factors is shortening of the NH2-terminal segment. Because comparisons establish homology directly at the NH2 and COOH termini, nkx-2.8 appears to be a full-length factor. nkx-2.8, like most nk-2-related factors, has a conserved peptide domain between the homeobox and the COOH terminus. The domain has a hydrophobic center, VAVPVLV, with a central proline that prevents helix formation. This center is surrounded by charged, mostly basic, residues. This suggests a single loop reminiscent of the nonhelical loops in known DNA binding domains and might therefore represent an accessory DNA binding domain. The paired class homeodomain factors have a second DNA binding domain and thus provide a precedent for homeodomain factors with two distinctive DNA binding domains. Alternatively, the domain might function to associate proteins. nkx-2.8 is most closely related to TTF-1 and nkx-2.2. TTF-1, however, has a longer, more complex structure, with redundant domains. Even the untranslated region shows a relationship to TTF-1 because the short open reading frames in the 5′-untranslated region of the nkx-2.8 cDNA region can be aligned with the NH2-terminal region of human TTF-1 with about 30% identity. In addition, both TTF-1 and nkx-2.8have polyglycine regions, although in slightly different locations. TTF-1 has a stretch of eight glycines between the homeobox and conserved peptides, whereas nkx-2.8 has six consecutive glycines just downstream of the conserved peptide. The predicted cDNA structure was confirmed with a series of PCR studies of fetal liver cDNA, and parallel studies were carried out on genomic DNA. This analysis verified the unique cDNA and also locali" @default.
• W2034453103 created "2016-06-24" @default.
• W2034453103 creator A5016356752 @default.
• W2034453103 creator A5022624878 @default.
• W2034453103 creator A5023572003 @default.
• W2034453103 creator A5034905902 @default.
• W2034453103 creator A5035176830 @default.
• W2034453103 creator A5040178560 @default.
• W2034453103 creator A5059102572 @default.
• W2034453103 date "1998-01-01" @default.
• W2034453103 modified "2023-10-16" @default.
• W2034453103 title "A Novel nk-2-related Transcription Factor Associated with Human Fetal Liver and Hepatocellular Carcinoma" @default.
• W2034453103 cites W106000010 @default.
• W2034453103 cites W1468112427 @default.
• W2034453103 cites W1558365920 @default.
• W2034453103 cites W1899233404 @default.
• W2034453103 cites W1965051773 @default.
• W2034453103 cites W1971851530 @default.
• W2034453103 cites W1990781807 @default.
• W2034453103 cites W1997057600 @default.
• W2034453103 cites W1999737243 @default.
• W2034453103 cites W2020672859 @default.
• W2034453103 cites W2023176914 @default.
• W2034453103 cites W2028545666 @default.
• W2034453103 cites W2030182530 @default.
• W2034453103 cites W2036452487 @default.
• W2034453103 cites W2039307052 @default.
• W2034453103 cites W2042490889 @default.
• W2034453103 cites W2044905785 @default.
• W2034453103 cites W2045042588 @default.
• W2034453103 cites W2046478451 @default.
• W2034453103 cites W2048536916 @default.
• W2034453103 cites W2056847316 @default.
• W2034453103 cites W2058877341 @default.
• W2034453103 cites W2064127422 @default.
• W2034453103 cites W2066092773 @default.
• W2034453103 cites W2069368388 @default.
• W2034453103 cites W2069471099 @default.
• W2034453103 cites W2072276788 @default.
• W2034453103 cites W2072585523 @default.
• W2034453103 cites W2074728647 @default.
• W2034453103 cites W2076600697 @default.
• W2034453103 cites W2092281396 @default.
• W2034453103 cites W2097355152 @default.
• W2034453103 cites W2106000284 @default.
• W2034453103 cites W2109170983 @default.
• W2034453103 cites W2122185025 @default.
• W2034453103 cites W2133335149 @default.
• W2034453103 cites W2140828381 @default.
• W2034453103 doi "https://doi.org/10.1074/jbc.273.5.2917" @default.
• W2034453103 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9446603" @default.
• W2034453103 hasPublicationYear "1998" @default.
• W2034453103 type Work @default.
• W2034453103 sameAs 2034453103 @default.
• W2034453103 citedByCount "53" @default.
• W2034453103 countsByYear W20344531032012 @default.
• W2034453103 countsByYear W20344531032013 @default.
• W2034453103 countsByYear W20344531032014 @default.
• W2034453103 countsByYear W20344531032015 @default.
• W2034453103 countsByYear W20344531032016 @default.
• W2034453103 countsByYear W20344531032018 @default.
• W2034453103 countsByYear W20344531032019 @default.
• W2034453103 countsByYear W20344531032021 @default.
• W2034453103 countsByYear W20344531032022 @default.
• W2034453103 countsByYear W20344531032023 @default.
• W2034453103 crossrefType "journal-article" @default.
• W2034453103 hasAuthorship W2034453103A5016356752 @default.
• W2034453103 hasAuthorship W2034453103A5022624878 @default.
• W2034453103 hasAuthorship W2034453103A5023572003 @default.
• W2034453103 hasAuthorship W2034453103A5034905902 @default.
• W2034453103 hasAuthorship W2034453103A5035176830 @default.
• W2034453103 hasAuthorship W2034453103A5040178560 @default.
• W2034453103 hasAuthorship W2034453103A5059102572 @default.
• W2034453103 hasBestOaLocation W20344531031 @default.
• W2034453103 hasConcept C104317684 @default.
• W2034453103 hasConcept C126322002 @default.
• W2034453103 hasConcept C143998085 @default.
• W2034453103 hasConcept C172680121 @default.
• W2034453103 hasConcept C2778019345 @default.
• W2034453103 hasConcept C2779234561 @default.
• W2034453103 hasConcept C502942594 @default.
• W2034453103 hasConcept C54355233 @default.
• W2034453103 hasConcept C71924100 @default.
• W2034453103 hasConcept C86339819 @default.
• W2034453103 hasConcept C86803240 @default.
• W2034453103 hasConceptScore W2034453103C104317684 @default.
• W2034453103 hasConceptScore W2034453103C126322002 @default.
• W2034453103 hasConceptScore W2034453103C143998085 @default.
• W2034453103 hasConceptScore W2034453103C172680121 @default.
• W2034453103 hasConceptScore W2034453103C2778019345 @default.
• W2034453103 hasConceptScore W2034453103C2779234561 @default.
• W2034453103 hasConceptScore W2034453103C502942594 @default.
• W2034453103 hasConceptScore W2034453103C54355233 @default.
• W2034453103 hasConceptScore W2034453103C71924100 @default.
• W2034453103 hasConceptScore W2034453103C86339819 @default.
• W2034453103 hasConceptScore W2034453103C86803240 @default.
• W2034453103 hasIssue "5" @default.
• W2034453103 hasLocation W20344531031 @default.

• next