FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2034640099> ?p ?o ?g. }

• W2034640099 endingPage "10869" @default.
• W2034640099 startingPage "10861" @default.
• W2034640099 abstract "Understanding the mechanism of smooth muscle cell (SMC) differentiation will provide the foundation for elucidating SMC-related diseases such as atherosclerosis, restenosis, and asthma. Recent studies have demonstrated that the interaction of SRF with the co-activator myocardin is a critical determinant of smooth muscle development. It has been proposed that the specific transcriptional activation of smooth muscle-restricted genes (as opposed to other SRF-dependent genes) by myocardin results from the presence of multiple CArG boxes in smooth muscle genes that facilitate myocardin homodimer formation. This proposal was further tested in the current study. Our results show that the SMC-specific telokin promoter, which contains only a single CArG box, is strongly activated by myocardin. Furthermore, myocardin and a dimerization defective mutant myocardin induce expression of endogenous telokin but not c-fos in 10T1/2 fibroblast cells. Knocking down myocardin by small interfering RNA decreased telokin promoter activity and expression in A10 SMCs. A series of telokin and c-fos promoter chimeric and mutant reporter genes was generated to determine the mechanisms responsible for the promoter-specific effects of myocardin. Data from these experiments demonstrated that the ets binding site in the c-fos promoter partially blocks the activation of this promoter by myocardin. However, the binding of ets factors alone was not sufficient to explain the promoter-specific effects of myocardin. Elements 3′ of the CArG box in the c-fos promoter act in concert with the ets binding site to block the ability of myocardin to activate the promoter. Conversely, elements 5′ and 3′ of the CArG box in the telokin promoter act in concert with the CArG box to facilitate myocardin stimulation of the promoter. Together these data suggest that the promoter specificity of myocardin is dependent on complex combinatorial interactions of multiple cis elements and their trans binding factors. Understanding the mechanism of smooth muscle cell (SMC) differentiation will provide the foundation for elucidating SMC-related diseases such as atherosclerosis, restenosis, and asthma. Recent studies have demonstrated that the interaction of SRF with the co-activator myocardin is a critical determinant of smooth muscle development. It has been proposed that the specific transcriptional activation of smooth muscle-restricted genes (as opposed to other SRF-dependent genes) by myocardin results from the presence of multiple CArG boxes in smooth muscle genes that facilitate myocardin homodimer formation. This proposal was further tested in the current study. Our results show that the SMC-specific telokin promoter, which contains only a single CArG box, is strongly activated by myocardin. Furthermore, myocardin and a dimerization defective mutant myocardin induce expression of endogenous telokin but not c-fos in 10T1/2 fibroblast cells. Knocking down myocardin by small interfering RNA decreased telokin promoter activity and expression in A10 SMCs. A series of telokin and c-fos promoter chimeric and mutant reporter genes was generated to determine the mechanisms responsible for the promoter-specific effects of myocardin. Data from these experiments demonstrated that the ets binding site in the c-fos promoter partially blocks the activation of this promoter by myocardin. However, the binding of ets factors alone was not sufficient to explain the promoter-specific effects of myocardin. Elements 3′ of the CArG box in the c-fos promoter act in concert with the ets binding site to block the ability of myocardin to activate the promoter. Conversely, elements 5′ and 3′ of the CArG box in the telokin promoter act in concert with the CArG box to facilitate myocardin stimulation of the promoter. Together these data suggest that the promoter specificity of myocardin is dependent on complex combinatorial interactions of multiple cis elements and their trans binding factors. There is extensive evidence showing that altered control of the differentiated state of smooth muscle cells contributes to the development and/or progression of a variety of diseases, including atherosclerosis, hypertension, and asthma. These diseases are all associated with decreased expression of proteins required for the differentiated function of smooth muscle cells. An understanding of the mechanisms that control smooth muscle cell differentiation is required before it will be possible to determine how these control processes are altered in pathological conditions.Recent studies have demonstrated that the interaction of SRF with the co-activator myocardin is a critical determinant of vascular smooth muscle development (1Li S. Wang D.Z. Wang Z. Richardson J.A. Olson E.N. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 9366-9370Crossref PubMed Scopus (297) Google Scholar). Myocardin is expressed in visceral and vascular SMCs, 1The abbreviations used are: SMC, smooth muscle cell; LZ, leucine zipper; siRNA, small interfering RNA; EBS, ets binding site; TK, thymidine kinase; RT, reverse transcription; GFP, green fluorescent protein; MLCK, myosin light chain kinase.1The abbreviations used are: SMC, smooth muscle cell; LZ, leucine zipper; siRNA, small interfering RNA; EBS, ets binding site; TK, thymidine kinase; RT, reverse transcription; GFP, green fluorescent protein; MLCK, myosin light chain kinase. physically associates with SRF, and greatly potentiates SRF-dependent transcription of multiple SMC marker genes (2Yoshida T. Sinha S. Dandre F. Wamhoff B.R. Hoofnagle M.H. Kremer B.E. Wang D.Z. Olson E.N. Owens G.K. Circ. Res. 2003; 92: 856-864Crossref PubMed Scopus (309) Google Scholar, 3Du K.L. Ip H.S. Li J. Chen M. Dandre F. Yu W. Lu M.M. Owens G.K. Parmacek M.S. Mol. Cell. Biol. 2003; 23: 2425-2437Crossref PubMed Scopus (307) Google Scholar, 4Wang D. Chang P.S. Wang Z. Sutherland L. Richardson J.A. Small E. Krieg P.A. Olson E.N. Cell. 2001; 105: 851-862Abstract Full Text Full Text PDF PubMed Scopus (736) Google Scholar, 5Chen J. Kitchen C.M. Streb J.W. Miano J.M. J. Mol. Cell. Cardiol. 2002; 34: 1345-1356Abstract Full Text PDF PubMed Google Scholar). The activity of myocardin is, however, selective to cardiac and smooth muscle-specific genes as other SRF-dependent genes such as c-fos are not strongly activated by myocardin (6Wang Z. Wang D.Z. Pipes G.C. Olson E.N. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 7129-7134Crossref PubMed Scopus (422) Google Scholar). A model has been developed to explain this promoter specificity of myocardin (6Wang Z. Wang D.Z. Pipes G.C. Olson E.N. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 7129-7134Crossref PubMed Scopus (422) Google Scholar). According to this model, transcriptional activation of smooth muscle cell-specific genes by myocardin requires at least two CArG boxes to allow formation of myocardin homodimers. In contrast, ubiquitously expressed genes, such as c-fos, that contain a single CArG box close to the transcription initiation site are not activated by myocardin because of their inability to promote myocardin homodimer formation. However, this model does not explain why other growth factor regulated genes such as Egr-1, which contains five CArG boxes, are not activated by myocardin-related transcription factor A or by myocardin (current study) (7Du K.L. Chen M. Li J. Lepore J.J. Mericko P. Parmacek M.S. J. Biol. Chem. 2004; 279: 17578-17586Abstract Full Text Full Text PDF PubMed Scopus (132) Google Scholar, 8Cen B. Selvaraj A. Burgess R.C. Hitzler J.K. Ma Z. Morris S.W. Prywes R. Mol. Cell. Biol. 2003; 23: 6597-6608Crossref PubMed Scopus (243) Google Scholar). In addition, fragments of the smooth muscle-specific α-actin and myosin proximal promoters that contain two CArG boxes are not sufficient to direct expression of transgenes specifically to smooth muscle cells (9Mack C.P. Owens G.K. Circ. Res. 1999; 84: 852-861Crossref PubMed Scopus (203) Google Scholar, 10Manabe I. Owens G.K. J. Clin. Investig. 2001; 107: 823-834Crossref PubMed Scopus (125) Google Scholar). In contrast, the smooth muscle-restricted telokin promoter that contains only a single CArG box has been shown to be sufficient to mediate smooth muscle-specific expression of a transgene in vivo (11Smith A.F. Bigsby R.M. Word R.A. Herring B.P. Am. J. Physiol. 1998; 274: C1188-C1195Crossref PubMed Google Scholar). Telokin expression has also been shown to be up-regulated following myocardin infection of rat aortic smooth muscle cells (12Yoshida T. Kawai-Kowase K. Owens G.K. Arterioscler. Thromb. Vasc. Biol. 2004; 24: 1596-1601Crossref PubMed Scopus (83) Google Scholar). To further investigate the mechanisms underlying the promoter-specific effects of myocardin we have compared the ability of myocardin to activate two single CArG box containing genes, the smooth muscle-specific telokin gene, and the widely expressed c-fos gene.Results demonstrate that myocardin and its dimerization-deficient leucine zipper (LZ) mutant is capable of strongly trans-activating single CArG box containing, smooth muscle-specific, telokin promoter and to induce telokin expression in 10T1/2 cells although the myocardin LZ mutant is less effective than the wild type myocardin. In contrast, myocardin had no effect on c-fos promoter activity or c-fos gene expression in 10T1/2 cells. Knocking down endogenous myocardin in SMC cells by siRNA decreased telokin promoter activity and endogenous telokin expression. Analysis of a series of chimeric and mutant telokin and c-fos reporter genes demonstrated that in the c-fos promoter the ets binding site (EBS), which binds ets factors, partially blocks the activation of this promoter by myocardin; however, an additional region between -300 and +39 is required to prevent myocardin activation of the c-fos promoter. Conversely, multiple cis elements in the telokin promoter are required for maximal myocardin activation. We propose that the gene specificity of myocardin is dependent on combinations of multiple positive and negative cis elements and their trans binding factors.MATERIALS AND METHODSMammalian Expression and Reporter Gene Assays—The mouse myocardin pcDNA3.1-myc/his vector was kindly provided by Dr. Eric N. Olson (Southwestern Medical Center, Dallas, TX). The myocardin LZ mutant was developed by the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA) (6Wang Z. Wang D.Z. Pipes G.C. Olson E.N. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 7129-7134Crossref PubMed Scopus (422) Google Scholar). All promoter reporter genes were constructed by cloning fragments of promoters into the pGL2B luciferase vector (Promega, Madison, WI). The mouse and rabbit telokin promoter-luciferase reporter gene used includes nucleotides -190 to +181 (T370) and -256 to +147 (T400), respectively, of the telokin gene as described previously (13Herring B.P. Smith A.F. Am. J. Physiol. 1996; 270: C1656-C1665Crossref PubMed Google Scholar). The SM22α-luciferase reporter gene includes nucleotides -475 to +61 of mouse SM22α (14Kim S. Ip H.S. Lu M.M. Clendenin C. Parmacek M.S. Mol. Cell. Biol. 1997; 17: 2266-2278Crossref PubMed Scopus (190) Google Scholar, 15Li L. Miano J.M. Mercer B. Olson E.N. J. Cell Biol. 1996; 132: 849-859Crossref PubMed Scopus (284) Google Scholar). The SM α-actin promoter fragment extended from nucleotide -2,555 to +2,813 (9Mack C.P. Owens G.K. Circ. Res. 1999; 84: 852-861Crossref PubMed Scopus (203) Google Scholar), and the SM-myosin heavy chain promoter extended from -4,200 to +11,600 (16Madsen C.S. Regan C.P. Hungerford J.E. White S.L. Manabe I. Owens G.K. Circ. Res. 1998; 82: 908-917Crossref PubMed Scopus (118) Google Scholar). The Egr-1 and c-fos luciferase reporter genes spanned from -637 to +79 and -605 to +39, respectively. The minimal thymidine kinase (TK) promoter used comprised nucleotides -113 to +20 of the thymidine kinase gene. All mutant reporter gene constructs were initially generated in pCR pBlunt vector (Invitrogen) the by QuikChange site-directed mutagenesis kit (Stratagene) and then transferred to pGL2b vector. The resultant plasmids were sequenced to verify the integrity of the insert. Transfection was carried out as described previously (17Zhou J. Hoggatt A.M. Herring B.P. J. Biol. Chem. 2004; 279: 15929-15937Abstract Full Text Full Text PDF PubMed Scopus (15) Google Scholar). The level of promoter activity was evaluated by measurement of the firefly luciferase relative to the internal control Renilla luciferase using the dual luciferase assay system essentially as described by the manufacturer (Promega). A minimum of six independent transfections was performed and all assays were replicated at least twice. Results are reported as the mean ± S.E.Reverse Transcription Coupled to PCR—Total RNA was isolated with TRIzol reagent (Invitrogen). A pair of unique primers for telokin was designed as sense 5′-GACACCGCCTGAGTCCAACCTCCG-3′ and antisense 5′-GACCCTGTTGAAGATTTCCTGCCACTG-3′, yielding a 127-bp product. Other sequences of PCR primers are available upon request. 200 ng of RNA was utilized as a template for reverse transcription (RT) and PCR with respective specific primers using SuperScript One-step RT-PCR system (Invitrogen).siRNA—A plasmid-based system for production of siRNA was generated by inserting oligonucleotides specific to myocardin AATGCAACTGCAGAAGCAGAA (3Du K.L. Ip H.S. Li J. Chen M. Dandre F. Yu W. Lu M.M. Owens G.K. Parmacek M.S. Mol. Cell. Biol. 2003; 23: 2425-2437Crossref PubMed Scopus (307) Google Scholar) downstream of an H1 promoter in the adenovirus shuttle vector pRNAT-H1.1/Shuttle (GenScript, Piscataway, NJ) that is compatible with the adeno-X system (Clontech, Palo Alto, CA). The shuttle vector contains the H1 promoter driving the siRNA cassette together with a cytomegalovirus-driven coral GFP cDNA.Adenovirus Construction and Cell Infection—Adenovirus constructs were made using the Adeno-X vectors essentially as the manufacturer (BD Biosciences) instructed and as described previously (17Zhou J. Hoggatt A.M. Herring B.P. J. Biol. Chem. 2004; 279: 15929-15937Abstract Full Text Full Text PDF PubMed Scopus (15) Google Scholar). The recombinant adenovirus was packaged in HEK293 cells and amplified to obtain high titer stocks. For adenoviral infection A10 cells or 10T1/2 cells were seeded in 6-well plates at a density of 2× 105 cells/well and grown overnight to near confluence. These cells were washed with phosphate-buffered saline to remove serum and infected with adenovirus encoding LacZ, myocardin, myocardin LZ mutant, or myocardin siRNA in phosphate-buffered saline for 4 h at 37 °C. These conditions resulted in close to 100% infection of cells. 72 h following infection cell protein extracts were prepared using radioimmune precipitation assay buffer, and protein concentrations were determined using the BCA protein assay kit (Pierce).Western Blotting—Western blotting analysis was carried out essentially as described previously (18Gallagher P.J. Herring B.P. Griffin S.A. Stull J.T. J. Biol. Chem. 1991; 266: 23936-23944Abstract Full Text PDF PubMed Google Scholar). Fifteen micrograms of protein were fractionated on 7.5 or 15% SDS-polyacrylamide gels. The protein sample was electrophoretically transferred to a polyvinylidene difluoride membrane and verified by Ponceau S staining. The membrane was then probed with a series of antibodies. Antibodies used in this study were anti-β-actin (Sigma, 1:10,000), anti-calponin (Sigma, clone hCP, 1:10,000), anti-GFP (Clontech, 1:400), anti-hemagglutinin tag (BabCO, 1:1000), anti-MLCK (Sigma, clone K36, 1:10,000), anti-SM22α (a gift from Dr. Len Adam, 1:6000), anti-SM α-actin (Sigma, clone 3A1, 1:10,000), anti-SRF (Santa Cruz Biotechnology, 1:10,000), and antitelokin (1:6,000) (18Gallagher P.J. Herring B.P. Griffin S.A. Stull J.T. J. Biol. Chem. 1991; 266: 23936-23944Abstract Full Text PDF PubMed Google Scholar).RESULTSMyocardin Trans Activates the Telokin Promoter—In contrast to many smooth muscle restricted promoters, the telokin promoter contains only a single CArG box. The effects of myocardin on reporter genes driven by the mouse minimal telokin promoter (-190 to +171, T370), the SM α-actin promoter, SM22α promoter, or the SM myosin heavy chain promoter were examined in 10T1/2 cells. Results from these luciferase assays revealed that the telokin promoter was strongly activated by myocardin, which was similar to other SMC-specific promoters in 10T1/2 cells. In contrast, myocardin only activated the Egr-1 and c-fos promoters 4-fold (Fig. 1, upper panel). Similar activation by myocardin was observed in COS cells; however, myocardin activated the smooth muscle-specific promoters to a far lesser extent in A10 SMCs as compared with 10T1/2 cells or COS cells (Fig. 1, middle and lower panels).Overexpression of Wild Type and LZ Mutant Myocardin Induces Endogenous Telokin but Not c-Fos Expression in 10T1/2 Fibroblast Cells—Wild type and LZ mutant myocardin expression plasmids were transfected into 10T1/2 cells and RT-PCR was carried out on RNA isolated from the transfected cells to determine whether forced expression of wild type and LZ mutant myocardin can induce expression of endogenous telokin. This experiment demonstrated that both myocardin and myocardin LZ mutant were sufficient to drive telokin and SM22α mRNA expression without altering expression of c-fos in 10T1/2 cells. Consistent with these results, adenoviral-mediated expression of wild type or LZ mutant myocardin was also sufficient to induce expression of several smooth muscle proteins including telokin, SM22α, SM α-actin and MLCK in 10T1/2 cells (Fig. 2, B and C). A direct side by side comparison of the effects of the wild type and LZ mutant myocardin demonstrated that much higher levels of expression of the mutant molecule are required to induce smooth muscle-specific gene expression as compared with the wild type myocardin (Fig. 2C). Similarly promoter activation by the LZ mutant myocardin was only ∼20% of that observed with the wild type myocardin (Fig. 2D). Together these data show that although the dimerization deficient myocardin can activate smooth muscle-specific genes its activity is impaired as compared with the wild type myocardin.Fig. 2Effects of wild type and LZ mutant myocardin overexpression on endogenous telokin expression in 10T1/2 cells.A, mouse wild type or LZ mutant myocardin expression vector or empty plasmid pcDNA3.1 was transiently transfected into 10T1/2 cells. 24 h post-transfection total RNA was harvested from cells using TRIzol reagent, and RT-PCR was performed to detect endogenous telokin, SM22α, and c-Fos expression with the SuperScript One-step RT-PCR system (Invitrogen). The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) housekeeping gene served as an internal control showing the equal RNA input and RT-PCR reaction efficiency. B, 10T1/2 cells were seeded in 6-well plates overnight and then transduced with adenovirus encoding LacZ or myocardin as indicated for 4 h. 72 h following infection protein extracts were prepared from infected cells and analyzed by Western blotting to detect expression of endogenous proteins. C, wild type myocardin, myocardin LZ mutant, or control LacZ adenovirus were used to transduce 10T1/2 cells and Western blotting analysis was carried out as described in B. D, myocardin (empty bars), myocardin LZ mutant (hatched bars), or an empty expression vector plasmid were co-transfected together with promoter-luciferase reporter genes containing either the mouse telokin promoter, SM22α, myosin heavy chain, SM α-actin promoter, or a TK promoter-driven Renilla luciferase internal control plasmid into 10T1/2 fibroblast cells. The level of promoter activity was determined by measurement of the firefly luciferase activity relative to the control Renilla luciferase. An arbitrary value of 100 was assigned to the activation of the promoters by myocardin alone. Data presented are mean ± S.E. of six samples.View Large Image Figure ViewerDownload Hi-res image Download (PPT)siRNA-mediated Knockdown of Myocardin Decreases Telokin Promoter Activity and Endogenous Telokin Expression in A10 SMCs—To determine the role of endogenous myocardin in regulating SM-specific gene expression endogenous myocardin level was decreased using siRNA. To demonstrate the efficacy of the myocardin siRNA constructs COS cells were co-transfected with myocardin expression plasmids and either control or myocardin siRNA plasmids. Analysis of myocardin levels in extracts from these cells demonstrated that the myocardin siRNA but not control siRNA decreased the exogenous myocardin expression (Fig. 3A). To determine whether down-regulation of myocardin decreased endogenous SMC marker gene expression in SM A10 cells, myocardin siRNA was expressed using an adenovirus in A10 cells and endogenous SMC mRNA and proteins examined by RT-PCR and Western blotting, respectively (Fig. 3, B and C). These data demonstrated that endogenous myocardin and telokin but not glyceraldehyde-3-phosphate dehydrogenase mRNA were significantly down-regulated as compared with siRNA control infected and non-infected cells (Fig. 3B). At the protein expression level, 72 h following transduction with myocardin siRNA, telokin, SM22α, and calponin were significantly decreased 20–40%, however, there were no significant changes in the levels of expression of SM α-actin, β-actin, or the 130-kDa MLCK (Fig. 3C). To confirm that telokin promoter activity is myocardin-dependent in SMCs, plasmid-based myocardin siRNA or a scrambled siRNA control pshuttle plasmid was transiently co-transfected into A10 SMCs together with telokin promoter reporter genes, and luciferase activity was determined. As shown in Fig. 3D, the activity of the rabbit telokin promoter but not the thymidine kinase promoter was significantly reduced to ∼40% of control levels in A10 cells transfected with either 300 or 600 ng of myocardin siRNA plasmid.Fig. 3Effects of myocardin siRNA on telokin promoter activity and expression in A10 cells.A, COS cells were co-transfected with plasmid encoding myocardin, myocardin siRNA, or a scrambled siRNA control as indicated. 24 h following transfection protein extracts were prepared from transient transfected cells and analyzed by Western blotting. The level of myocardin siRNA or control siRNA transfection is indicated by GFP expression, which is encoded on the same plasmid construct. B, A10 cells were transduced with adenovirus encoding scrambled siRNA control or myocardin siRNA as indicated. 72 h following infection total RNA was prepared from non-infected or infected cells and analyzed by RT-PCR. The level of siRNA expression is indicated by the expression of GFP, which is encoded on the same virus. C, A10 cells were transduced with adenoviruses as described in B, and then total protein was harvested and analyzed by Western blotting. Protein expression was quantitated by densitometric analysis of the blots and telokin, SM22α and calponin expression were found to be significantly decreased by myocardin siRNA-treated cells (p < 0.05, Student's nonpaired t test). D, rabbit telokin promoter (T400) and minimal thymidine kinase promoter-luciferase constructs were transiently transfected into A10 cells, together with either 300 or 600 ng of myocardin siRNA pshuttle or scramble siRNA control pshuttle plasmids or vector alone, as indicated. 24 h later extracts were prepared for luciferase assays. Luciferase activity was normalized to empty vector transfections. Values presented are the mean ± S.E., and samples that were statistically different from controls are indicated by an asterisk (p < 0.001). GAPDH, glyceraldehyde-3-phosphate dehydrogenase.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Maximal Myocardin Activity on the Telokin Promoter Requires Multiple Cis Elements—Because both telokin and c-fos promoters contain single CArG boxes we determined whether the specific sequences of the CArG box within the telokin promoter contribute to the ability of myocardin to activate the promoter. Reporter genes were generated in which the telokin promoter CArG box was mutated to the c-fos gene CArG box sequence or the SM22α gene CArG near sequence or to a sequence no longer able to bind SRF. These mutant reporter genes were co-transfected together with myocardin, and luciferase activity was determined (Fig. 4A). Mutant telokin promoter reporter genes containing either a c-fos or SM22α CArG box were activated by myocardin similar to the wild type telokin promoter. As expected a mutant telokin promoter that was unable to bind SRF showed no activation by myocardin, showing that the intact CArG is critical for the myocardin activation (Fig. 4A). These data demonstrated that SRF binding to the CArG box is necessary for myocardin activation of the telokin promoter, but the sequence of the CArG box does not explain the ability of myocardin to activate the telokin promoter as opposed to the c-fos promoter.Fig. 4Multiple cis elements in the telokin promoter are involved in the activation by myocardin.A, the mouse telokin promoter CArG box (CCTTTTATGG) was mutated such that it could not bind SRF (CCTTTTCTAG), to c-fos promoter CArG box sequence (CCATATTAGG), or near CArG (CCAAATATGG) from the SM22α gene using the QuikChange site-Directed mutagenesis kit (Stratagene). Reporter genes constructed using these mutant promoters were co-transfected with mouse myocardin or empty expression vector into 10T1/2 cells. The -fold change in promoter activity relative to vector control transfections is presented as mean ± S.E. of six samples. B, truncation mutants of telokin promoter reporter genes together with myocardin or empty vector as a control were transfected into 10T1/2 cells, and luciferase activity was measured 24 h later. The -fold change in promoter activity relative to vector control transfections is presented as mean ± S.E. of six samples. C, the -80 to -66 AT-rich region, -66 to -56 CArG box (CArG), or +36 to +82 regions of the telokin promoter were fused individually or in combination to a minimal TK promoter as indicated. Promoter-luciferase reporter genes were transfected into 10T1/2 cells together with or without myocardin expression vector, and then luciferase activity was determined. The -fold change in promoter activity relative to vector control transfections is presented as mean ± S.E. of six samples.View Large Image Figure ViewerDownload Hi-res image Download (PPT)To define the minimal regions of the telokin promoter required for myocardin activation, the ability of myocardin to activate a series of deletion constructs was determined (Fig. 4B). Results from this analysis suggest that the regions between -80 and -66 (an AT-rich region) and between +36 to +82 are important for myocardin activation. In contrast, deletion of residues -190 to -80 or +82 to +171 did not alter the ability of myocardin to activate the promoter, suggesting that these regions are not important for this effect. Deletion of the region from +36 to +82 or from -80 to -66 decreased the ability of myocardin to activate the promoter over 10- and 20-fold, respectively. These data demonstrated that the CArG box together with regions from +36 to +82 and -80 to -66 are necessary for myocardin activation of the telokin promoter. To determine whether these regions are sufficient to confer myocardin activation, the telokin CArG box, -66 to -80 region (AT-rich region), and +36 to +82 region were fused to a minimal TK promoter alone or in combination. Each of these regions alone was not sufficient to confer a large amount of myocardin activation (Fig. 4C). Although the CArG element alone increased activation to 11-fold, when all three elements were present the ability of myocardin to activate the minimal TK promoter was increased to 50-fold. These data suggest that multiple cis elements of telokin promoter are necessary and largely sufficient to confer maximal activation by myocardin.The EBS in c-fos Promoter Partially Blocks Myocardin Activation—It has been reported that the SRF binding affinity of the c-fos CArG box is higher than the SM22α CArG boxes, and the variations among CArG boxes of c-fos and SM22α influence cell type specificity of expression (19Chang P.S. Li L. McAnally J. Olson E.N. J. Biol. Chem. 2001; 276: 17206-17212Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar). To determine whether the specific sequence of the c-fos CArG box is important for the lack of response of this promoter to myocardin, the CArG box was mutated to the telokin CArG box sequence or to a sequence unable to bind SRF. Analysis of these mutant reporter genes demonstrated that c-fos promoters containing either the native or telokin CArG box sequence were poorly activated by myocardin (Fig. 5B), and as expected a mutant c-fos promoter that was unable to bind SRF showed no activation by myocardin. These data together with those obtained from the mutant telokin promoters described in Fig. 4A suggest that the precise sequence of the CArG boxes in the c-fos and telokin promoters does not account for the promoter-specific effects of myocardin.Fig. 5Mapping the elements in telokin and c-fos promoters responsible for myocardin selectivity.A, schematic diagram showing the sequences of the CArG box and adjacent 5′-sequence from c-fos and telokin promoters. The c-fos promoter (open bar) EBS binding site within the c-fos 5′ flanking re" @default.
• W2034640099 created "2016-06-24" @default.
• W2034640099 creator A5012096156 @default.
• W2034640099 creator A5026793153 @default.
• W2034640099 date "2005-03-01" @default.
• W2034640099 modified "2023-10-11" @default.
• W2034640099 title "Mechanisms Responsible for the Promoter-specific Effects of Myocardin" @default.
• W2034640099 cites W1500463915 @default.
• W2034640099 cites W1890134050 @default.
• W2034640099 cites W1961224765 @default.
• W2034640099 cites W1979466814 @default.
• W2034640099 cites W2000592199 @default.
• W2034640099 cites W2007662459 @default.
• W2034640099 cites W2016270174 @default.
• W2034640099 cites W2019222060 @default.
• W2034640099 cites W2057307695 @default.
• W2034640099 cites W2063679739 @default.
• W2034640099 cites W2064323791 @default.
• W2034640099 cites W2064923918 @default.
• W2034640099 cites W2071486154 @default.
• W2034640099 cites W2083129294 @default.
• W2034640099 cites W2096628719 @default.
• W2034640099 cites W2099685153 @default.
• W2034640099 cites W2103680698 @default.
• W2034640099 cites W2109778315 @default.
• W2034640099 cites W2110743056 @default.
• W2034640099 cites W2124219264 @default.
• W2034640099 cites W2132705463 @default.
• W2034640099 cites W2138569805 @default.
• W2034640099 cites W2150581509 @default.
• W2034640099 cites W2253989424 @default.
• W2034640099 cites W2339849938 @default.
• W2034640099 cites W2398889230 @default.
• W2034640099 doi "https://doi.org/10.1074/jbc.m411586200" @default.
• W2034640099 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15657056" @default.
• W2034640099 hasPublicationYear "2005" @default.
• W2034640099 type Work @default.
• W2034640099 sameAs 2034640099 @default.
• W2034640099 citedByCount "44" @default.
• W2034640099 countsByYear W20346400992012 @default.
• W2034640099 countsByYear W20346400992013 @default.
• W2034640099 countsByYear W20346400992014 @default.
• W2034640099 countsByYear W20346400992015 @default.
• W2034640099 countsByYear W20346400992016 @default.
• W2034640099 countsByYear W20346400992017 @default.
• W2034640099 countsByYear W20346400992018 @default.
• W2034640099 countsByYear W20346400992021 @default.
• W2034640099 countsByYear W20346400992022 @default.
• W2034640099 countsByYear W20346400992023 @default.
• W2034640099 crossrefType "journal-article" @default.
• W2034640099 hasAuthorship W2034640099A5012096156 @default.
• W2034640099 hasAuthorship W2034640099A5026793153 @default.
• W2034640099 hasBestOaLocation W20346400991 @default.
• W2034640099 hasConcept C104317684 @default.
• W2034640099 hasConcept C185592680 @default.
• W2034640099 hasConcept C2780286377 @default.
• W2034640099 hasConcept C54355233 @default.
• W2034640099 hasConcept C69053785 @default.
• W2034640099 hasConcept C86339819 @default.
• W2034640099 hasConcept C86803240 @default.
• W2034640099 hasConcept C95444343 @default.
• W2034640099 hasConceptScore W2034640099C104317684 @default.
• W2034640099 hasConceptScore W2034640099C185592680 @default.
• W2034640099 hasConceptScore W2034640099C2780286377 @default.
• W2034640099 hasConceptScore W2034640099C54355233 @default.
• W2034640099 hasConceptScore W2034640099C69053785 @default.
• W2034640099 hasConceptScore W2034640099C86339819 @default.
• W2034640099 hasConceptScore W2034640099C86803240 @default.
• W2034640099 hasConceptScore W2034640099C95444343 @default.
• W2034640099 hasIssue "11" @default.
• W2034640099 hasLocation W20346400991 @default.
• W2034640099 hasOpenAccess W2034640099 @default.
• W2034640099 hasPrimaryLocation W20346400991 @default.
• W2034640099 hasRelatedWork W1531601525 @default.
• W2034640099 hasRelatedWork W2057307695 @default.
• W2034640099 hasRelatedWork W2110743056 @default.
• W2034640099 hasRelatedWork W2130456561 @default.
• W2034640099 hasRelatedWork W2368302378 @default.
• W2034640099 hasRelatedWork W2557281767 @default.
• W2034640099 hasRelatedWork W2748952813 @default.
• W2034640099 hasRelatedWork W2899084033 @default.
• W2034640099 hasRelatedWork W2948807893 @default.
• W2034640099 hasRelatedWork W2778153218 @default.
• W2034640099 hasVolume "280" @default.
• W2034640099 isParatext "false" @default.
• W2034640099 isRetracted "false" @default.
• W2034640099 magId "2034640099" @default.
• W2034640099 workType "article" @default.