FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2034646933> ?p ?o ?g. }

• W2034646933 endingPage "18045" @default.
• W2034646933 startingPage "18040" @default.
• W2034646933 abstract "Neuropilin-1 (np-1) and neuropilin-2 (np-2) are receptors for axon guidance factors belonging to the class 3 semaphorins. np-1 also binds to the 165-amino acid heparin-binding form of VEGF (VEGF165) but not to the shorter VEGF121 form, which lacks a heparin binding ability. We report that human umbilical vein-derived endothelial cells express the a17 and a22 splice forms of the np-2 receptor. Both np-2 forms bind VEGF165 with high affinity in the presence of heparin (KD 1.3 × 10−10m) but not VEGF121. np-2 also binds the heparin-binding form of placenta growth factor. These binding characteristics resemble those of np-1. VEGF145 is a secreted heparin binding VEGF form that contains the peptide encoded by exon 6 of VEGF but not the peptide encoded by exon 7, which is present in VEGF165. VEGF145 binds to np-2 with high affinity (KD 7 × 10−10m). Surprisingly, VEGF145 did not bind to np-1. Indeed, VEGF145does not bind to MDA-MB-231 breast cancer cells, which predominantly express np-1. By contrast, VEGF145 binds to human umbilical vein-derived endothelial cells, which express both np-1 and np-2. The binding of VEGF165 to porcine aortic endothelial cells expressing recombinant np-2 did not affect the proliferation or migration of the cells. Nevertheless, it is possible that VEGF-induced np-2-mediated signaling will take place only in the presence of other VEGF receptors such as VEGF receptor-1 or VEGF receptor-2. Neuropilin-1 (np-1) and neuropilin-2 (np-2) are receptors for axon guidance factors belonging to the class 3 semaphorins. np-1 also binds to the 165-amino acid heparin-binding form of VEGF (VEGF165) but not to the shorter VEGF121 form, which lacks a heparin binding ability. We report that human umbilical vein-derived endothelial cells express the a17 and a22 splice forms of the np-2 receptor. Both np-2 forms bind VEGF165 with high affinity in the presence of heparin (KD 1.3 × 10−10m) but not VEGF121. np-2 also binds the heparin-binding form of placenta growth factor. These binding characteristics resemble those of np-1. VEGF145 is a secreted heparin binding VEGF form that contains the peptide encoded by exon 6 of VEGF but not the peptide encoded by exon 7, which is present in VEGF165. VEGF145 binds to np-2 with high affinity (KD 7 × 10−10m). Surprisingly, VEGF145 did not bind to np-1. Indeed, VEGF145does not bind to MDA-MB-231 breast cancer cells, which predominantly express np-1. By contrast, VEGF145 binds to human umbilical vein-derived endothelial cells, which express both np-1 and np-2. The binding of VEGF165 to porcine aortic endothelial cells expressing recombinant np-2 did not affect the proliferation or migration of the cells. Nevertheless, it is possible that VEGF-induced np-2-mediated signaling will take place only in the presence of other VEGF receptors such as VEGF receptor-1 or VEGF receptor-2. Neuropilin-2 is a receptor for the vascular endothelial growth factor (VEGF) forms VEGF-145 and VEGF-165.Journal of Biological ChemistryVol. 275Issue 38PreviewThe title was printed incorrectly and should read as shown above. Full-Text PDF Open Access vascular endothelial growth factor bis(sulfosuccinimidyl) suberate human umbilical vein-derived endothelial cell porcine aortic endothelial neuropilin-1 neuropilin-2 polyacrylamide gel electrophoresis 165-amino acid form of vascular endothelial growth factor 121-amino acid form of vascular endothelial growth factor 145-amino acid form of vascular endothelial growth factor tyrosine kinase vascular endothelial growth factor receptor-1 (flt-1) tyrosine-kinase vascular endothelial growth factor receptor-2 (KDR/flk-1) polymerase chain reaction placenta growth factor The various growth factors belonging to the VEGF1 family (VEGF, PlGF, VEGF-B, VEGF-C, and VEGF-D) act as modulators and inducers of angiogenesis in vivo (1.Neufeld G. Cohen T. Gengrinovitch S. Poltorak Z. FASEB J. 1999; 13: 9-22Crossref PubMed Scopus (3164) Google Scholar, 2.Eriksson U. Alitalo K. Curr. Top. Microbiol. Immunol. 1999; 237: 41-57Crossref PubMed Scopus (152) Google Scholar, 3.Persico M.G. Vincenti V. Dipalma T. Curr. Top. Microbiol. Immunol. 1999; 237: 31-40Crossref PubMed Scopus (149) Google Scholar). The active forms of VEGF are synthesized as homodimers (4.Leung D.W. Cachianes G. Kuang W.J. Goeddel D.V. Ferrara N. Science. 1989; 246: 1306-1309Crossref PubMed Scopus (4466) Google Scholar, 5.Keck P.J. Hauser S.D. Krivi G. Sanzo K. Warren T. Feder J. Connolly D.T. Science. 1989; 246: 1309-1312Crossref PubMed Scopus (1811) Google Scholar) or as heterodimers with other VEGF family members such as PlGF (6.DiSalvo J. Bayne M.L. Conn G. Kwok P.W. Trivedi P.G. Soderman D.D. Palisi T.M. Sullivan K.A. Thomas K.A. J. Biol. Chem. 1995; 270: 7717-7723Abstract Full Text Full Text PDF PubMed Scopus (245) Google Scholar). Targeted disruption of the VEGF gene has shown that even in animals containing a single allele of the VEGF gene angiogenesis is severely disrupted, indicating that the maintenance of exact VEGF levels in vivo is critical for the correct development of the cardiovascular system (7.Ferrara N. Carvermoore K. Chen H. Dowd M. Lu L. Oshea K.S. Powellbraxton L. Hillan K.J. Moore M.W. Nature. 1996; 380: 439-442Crossref PubMed Scopus (3062) Google Scholar, 8.Carmeliet P. Ferreira V. Breier G. Pollefeyt S. Kieckens L. Gertsenstein M. Fahrig M. Vandenhoeck A. Harpal K. Eberhardt C. Declercq C. Pawling J. Moons L. Collen D. Risau W. Nagy A. Nature. 1996; 380: 435-439Crossref PubMed Scopus (3475) Google Scholar). Five splice forms of human VEGF ranging in length from 121 to 206 amino acids (VEGF121–VEGF206) have been characterized (4.Leung D.W. Cachianes G. Kuang W.J. Goeddel D.V. Ferrara N. Science. 1989; 246: 1306-1309Crossref PubMed Scopus (4466) Google Scholar,5.Keck P.J. Hauser S.D. Krivi G. Sanzo K. Warren T. Feder J. Connolly D.T. Science. 1989; 246: 1309-1312Crossref PubMed Scopus (1811) Google Scholar, 9.Poltorak Z. Cohen T. Sivan R. Kandelis Y. Spira G. Vlodavsky I. Keshet E. Neufeld G. J. Biol. Chem. 1997; 272: 7151-7158Abstract Full Text Full Text PDF PubMed Scopus (455) Google Scholar, 10.Houck K.A. Ferrara N. Winer J. Cachianes G. Li B. Leung D.W. Mol. Endocrinol. 1991; 5: 1806-1814Crossref PubMed Scopus (1241) Google Scholar). These forms differ primarily in the presence or absence of the heparin binding domains encoded by exons 6 and 7, giving rise to forms that differ in their heparin and heparan-sulfate binding ability (11.Neufeld G. Cohen T. Gitay-Goren H. Poltorak Z. Tessler S. Gengrinovitch S. Levi B. Cancer Metastasis Rev. 1996; 15: 153-158Crossref PubMed Scopus (146) Google Scholar). The VEGF121, VEGF165, and VEGF189 forms appear to be abundant and are usually produced simultaneously by VEGF-producing cells (1.Neufeld G. Cohen T. Gengrinovitch S. Poltorak Z. FASEB J. 1999; 13: 9-22Crossref PubMed Scopus (3164) Google Scholar). VEGF145 is a rarer and much less studied VEGF form, which was reported to be expressed by cells derived from the female reproductive system (9.Poltorak Z. Cohen T. Sivan R. Kandelis Y. Spira G. Vlodavsky I. Keshet E. Neufeld G. J. Biol. Chem. 1997; 272: 7151-7158Abstract Full Text Full Text PDF PubMed Scopus (455) Google Scholar) as well in other organs such as the skin, penis, and kidney (12.Burchardt M. Burchardt T. Chen M.W. Shabsigh A. De la Taille A. Buttyan R. Shabsigh R. Biol. Reprod. 1999; 60: 398-404Crossref PubMed Scopus (73) Google Scholar, 13.Whittle C. Gillespie K. Harrison R. Mathieson P.W. Harper S.J. Clin. Sci. 1999; 97: 303-312Crossref PubMed Scopus (86) Google Scholar, 14.Tober K.L. Cannon R.E. Spalding J.W. Oberyszyn T.M. Parrett M.L. Rackoff A.I. Oberyszyn A.S. Tennant R.W. Robertson F.M. Biochem. Biophys. Res. Commun. 1998; 247: 644-653Crossref PubMed Scopus (33) Google Scholar). It contains the heparin binding domain encoded by exon 6 and binds tightly to the extracellular matrix (9.Poltorak Z. Cohen T. Sivan R. Kandelis Y. Spira G. Vlodavsky I. Keshet E. Neufeld G. J. Biol. Chem. 1997; 272: 7151-7158Abstract Full Text Full Text PDF PubMed Scopus (455) Google Scholar). VEGF165 contains the heparin binding domain included in exon 7 and binds to heparin with an affinity that is similar to that of VEGF145. However, VEGF165 binds much less tightly than VEGF145 to extracellular matrix. VEGF121 lacks both exons and has no affinity for either heparin or for extracellular matrixes. Other VEGF family members such as PlGF and VEGF-B are also expressed in several forms that differ in their heparin binding ability. For example, the peptide encoded by exon 6 of PlGF is found only in PlGF-2 and confers a heparin binding ability to this form while PlGF-1 and PlGF-3 do not bind to heparin (15.Maglione D. Guerriero V. Viglietto G. Ferraro M.G. Aprelikova O. Alitalo K. Delvecchio S. Lei K.J. Chou J.Y. Persico M.G. Oncogene. 1993; 8: 925-931PubMed Google Scholar,16.Cao Y.H. Ji W.D.R. Qi P. Rosin A. Cao Y.M. Biochem. Biophys. Res. Commun. 1997; 235: 493-498Crossref PubMed Scopus (157) Google Scholar). All the VEGF isoforms bind to the tyrosine-kinase receptors VEGFR-1 (flt-1) (17.Shibuya M. Yamaguchi S. Yamane A. Ikeda T. Tojo A. Matsushime H. Sato M. Oncogene. 1990; 5: 519-524PubMed Google Scholar) and VEGFR-2 (KDR/flk-1) (18.Terman B.I. Carrion M.E. Kovacs E. Rasmussen B.A. Eddy R.L. Shows T.B. Oncogene. 1991; 6: 1677-1683PubMed Google Scholar). The binding of VEGF to VEGFR-2 initiates intracellular signal transduction (1.Neufeld G. Cohen T. Gengrinovitch S. Poltorak Z. FASEB J. 1999; 13: 9-22Crossref PubMed Scopus (3164) Google Scholar, 19.Terman B.I. Dougher-Vermazen M. Carrion M.E. Dimitrov D. Armellino D.C. Gospodarowicz D. Böhlen P. Biochem. Biophys. Res. Commun. 1992; 187: 1579-1586Crossref PubMed Scopus (1405) Google Scholar, 20.Devries C. Escobedo J.A. Ueno H. Houck K. Ferrara N. Williams L.T. Science. 1992; 255: 989-991Crossref PubMed Scopus (1896) Google Scholar, 21.Seetharam L. Gotoh N. Maru Y. Neufeld G. Yamaguchi S. Shibuya M. Oncogene. 1995; 10: 135-147PubMed Google Scholar, 22.Millauer B. Wizigmann-Voos S. Schnurch H. Martinez R. Moller N.P.H. Risau W. Ullrich A. Cell. 1993; 72: 835-846Abstract Full Text PDF PubMed Scopus (1764) Google Scholar) and is correlated with the induction of endothelial cell proliferation and migration, angiogenesis, and permeabilization of blood vessels (1.Neufeld G. Cohen T. Gengrinovitch S. Poltorak Z. FASEB J. 1999; 13: 9-22Crossref PubMed Scopus (3164) Google Scholar, 23.Millauer B. Shawver L.K. Plate K.H. Risau W. Ullrich A. Nature. 1994; 367: 576-579Crossref PubMed Scopus (1162) Google Scholar, 24.Waltenberger J. Claesson-Welsh L. Siegbahn A. Shibuya M. Heldin C.H. J. Biol. Chem. 1994; 269: 26988-26995Abstract Full Text PDF PubMed Google Scholar). In contrast the activation of VEGFR-1 does not seem to result in the induction of cell proliferation, angiogenesis, or permeabilization of blood vessels but enhances cell migration (24.Waltenberger J. Claesson-Welsh L. Siegbahn A. Shibuya M. Heldin C.H. J. Biol. Chem. 1994; 269: 26988-26995Abstract Full Text PDF PubMed Google Scholar, 25.Clauss M. Weich H. Breier G. Knies U. Roeckl W. Waltenberger J. Risau W. J. Biol. Chem. 1996; 271: 17629-17634Abstract Full Text Full Text PDF PubMed Scopus (756) Google Scholar, 26.Barleon B. Sozzani S. Zhou D. Weich H.A. Mantovani A. Marme D. Blood. 1996; 87: 3336-3343Crossref PubMed Google Scholar). However, there have also been other reports that indicate that the activation of VEGFR-1 can induce cell proliferation and angiogenesis (27.Ziche M. Maglione D. Ribatti D. Morbidelli L. Lago C.T. Battisti M. Paoletti I. Barra A. Tucci M. Parise G. Vincenti V. Granger H.J. Viglietto G. Persico M.G. Lab. Invest. 1997; 76: 517-531PubMed Google Scholar). Both of these receptors have also been shown to play critical roles in embryonic vasculogenesis and angiogenesis (28.Shalaby F. Rossant J. Yamaguchi T.P. Gertsenstein M. Wu X.F. Breitman M.L. Schuh A.C. Nature. 1995; 376: 62-66Crossref PubMed Scopus (3371) Google Scholar,29.Fong G.H. Rossant J. Gertsenstein M. Breitman M.L. Nature. 1995; 376: 66-70Crossref PubMed Scopus (2224) Google Scholar). Endothelial cells also contain another type of VEGF receptors possessing a lower mass than either VEGFR-2 or VEGFR-1 (30.Vaisman N. Gospodarowicz D. Neufeld G. J. Biol. Chem. 1990; 265: 19461-19466Abstract Full Text PDF PubMed Google Scholar, 31.Gitay-Goren H. Soker S. Vlodavsky I. Neufeld G. J. Biol. Chem. 1992; 267: 6093-6098Abstract Full Text PDF PubMed Google Scholar). It was subsequently found that these smaller VEGF receptors of the endothelial cells are isoform specific receptors that bind VEGF165 but not VEGF121 (32.Gitay-Goren H. Cohen T. Tessler S. Soker S. Gengrinovitch S. Rockwell P. Klagsbrun M. Levi B. Neufeld G. J. Biol. Chem. 1996; 271: 5519-5523Abstract Full Text Full Text PDF PubMed Scopus (171) Google Scholar). It was therefore recognized that these receptors are not related to the VEGFR-1 or to the VEGFR-2 receptors, which bind to both VEGF isoforms. An additional search revealed several types of prostate and breast cancer cell lines, which express unusually large amounts of these isoform-specific receptors (33.Soker S. Fidder H. Neufeld G. Klagsbrun M. J. Biol. Chem. 1996; 271: 5761-5767Abstract Full Text Full Text PDF PubMed Scopus (289) Google Scholar). A VEGF165 affinity column was used to purify the receptors from MDA-MB-231 breast cancer cells, and sequencing of the receptor revealed it to be the product of the gene for np-1 (34.Soker S. Takashima S. Miao H.Q. Neufeld G. Klagsbrun M. Cell. 1998; 92: 735-745Abstract Full Text Full Text PDF PubMed Scopus (2088) Google Scholar). NP-1 is likely to play an important role in the development of the cardiovascular system. Gene disruption studies have indicated that np-1 is probably an important regulator of blood vessel development since mouse embryos lacking a functional np-1 gene die because their cardiovascular system fails to develop properly (35.Kawasaki T. Kitsukawa T. Bekku Y. Matsuda Y. Sanbo M. Yagi T. Fujisawa H. Development. 1999; 126: 4895-4902Crossref PubMed Google Scholar). Subsequent experiments have shown that np-1 also serves as a receptor for the heparin-binding form of placenta growth factor (PlGF), PlGF-2, and for VEGF-B (36.Migdal M. Huppertz B. Tessler S. Comforti A. Shibuya M. Reich R. Baumann H. Neufeld G. J. Biol. Chem. 1998; 273: 22272-22278Abstract Full Text Full Text PDF PubMed Scopus (282) Google Scholar, 37.Makinen T. Olofsson B. Karpanen T. Hellman U. Soker S. Klagsbrun M. Eriksson U. Alitalo K. J. Biol. Chem. 1999; 274: 21217-21222Abstract Full Text Full Text PDF PubMed Scopus (231) Google Scholar). np-1 was previously identified as a receptor for semaphorin-3A (38.He Z. Tessier-Lavigne M. Cell. 1997; 90: 739-751Abstract Full Text Full Text PDF PubMed Scopus (973) Google Scholar, 39.Kolodkin A.L. Levengood D.V. Rowe E.G. Tai Y.T. Giger R.J. Ginty D.D. Cell. 1997; 90: 753-762Abstract Full Text Full Text PDF PubMed Scopus (1003) Google Scholar) and it was demonstrated that the VEGF165 and semaphorin-3A binding sites on np-1 overlap (40.Giger R.J. Urquhart E.R. Gillespie S.K. Levengood D.V. Ginty D.D. Kolodkin A.L. Neuron. 1998; 21: 1079-1092Abstract Full Text Full Text PDF PubMed Scopus (312) Google Scholar). Semaphorins act as repellents of growing tips of axons, and it was recently observed that semaphorin-3A inhibits migration of endothelial cells causing a collapse of the actin cytoskeleton (41.Miao H.Q. Soker S. Feiner L. Alonso J.L. Raper J.A. Klagsbrun M. J. Cell Biol. 1999; 146: 233-242Crossref PubMed Scopus (437) Google Scholar). NP-1 is part of a receptor family that also contains np-2, a receptor that displays highly similar structural features and is a receptor for semaphorin-3C and for semaphorin-3F. Interestingly, np-1 and np-2 can form complexes (40.Giger R.J. Urquhart E.R. Gillespie S.K. Levengood D.V. Ginty D.D. Kolodkin A.L. Neuron. 1998; 21: 1079-1092Abstract Full Text Full Text PDF PubMed Scopus (312) Google Scholar, 42.Chen H. Chedotal A. He Z. Goodman C.S. Tessier-Lavigne M. Neuron. 1997; 19: 547-559Abstract Full Text Full Text PDF PubMed Scopus (572) Google Scholar). NP-2 shares a 44% identity at the amino acids level with np-1. Several alternatively spliced forms of np-2 that can be divided into two broad groups have been identified. Mouse group A variants have insertions of 5, 17, or 22 amino acids at amino acid 809 (42.Chen H. Chedotal A. He Z. Goodman C.S. Tessier-Lavigne M. Neuron. 1997; 19: 547-559Abstract Full Text Full Text PDF PubMed Scopus (572) Google Scholar). In humans only one splice form of this group was identified having a 17-amino acid insertion at position 808 (42.Chen H. Chedotal A. He Z. Goodman C.S. Tessier-Lavigne M. Neuron. 1997; 19: 547-559Abstract Full Text Full Text PDF PubMed Scopus (572) Google Scholar). Mouse group B isoforms differ in the sequence of the transmembrane and intracellular parts starting from amino acid 809, and two such isoforms have been identified (42.Chen H. Chedotal A. He Z. Goodman C.S. Tessier-Lavigne M. Neuron. 1997; 19: 547-559Abstract Full Text Full Text PDF PubMed Scopus (572) Google Scholar). The expression pattern of np-2 differs from that of np-1. Although there are broad overlaps, there are regions in which there is np-1 expression but no np-2 expression. For example, in contrast to np-1, np-2 expression was not detected in the heart or in capillaries but was found in the dorsal aorta colliculus (40.Giger R.J. Urquhart E.R. Gillespie S.K. Levengood D.V. Ginty D.D. Kolodkin A.L. Neuron. 1998; 21: 1079-1092Abstract Full Text Full Text PDF PubMed Scopus (312) Google Scholar). The neuropilins have short intracellular domains and are therefore unlikely to function as independent signaling receptors, and it was indeed shown recently that plexins form signaling complexes with both neuropilins (43.Takahashi T. Fournier A. Nakamura F. Wang L.H. Murakami Y. Kalb R.G. Fujisawa H. Strittmatter S.M. Cell. 1999; 99: 59-69Abstract Full Text Full Text PDF PubMed Scopus (708) Google Scholar, 44.Tamagnone L. Artigiani S. Chen H. He Z. Ming G.I. Song H. Chedotal A. Winberg M.L. Goodman C.S. Poo M. Tessier-Lavigne M. Comoglio P.M. Cell. 1999; 99: 71-80Abstract Full Text Full Text PDF PubMed Scopus (950) Google Scholar). Since np-1 functions as a VEGF receptor, we sought to determine whether np-2 is also a receptor for VEGF family members. We have cloned the np-2 cDNA from HUVEC. We show that np-2 functions as a splice variant specific VEGF receptor that binds VEGF165 but not VEGF121. However, the two receptors do not behave equally with regard to their interactions with VEGF since np-2 is able to bind VEGF145, a VEGF splice form that does not bind to np-1. The VEGF splice forms and PlGF-2 were produced in sF9 cells using appropriate baculoviruses and purified as described previously (9.Poltorak Z. Cohen T. Sivan R. Kandelis Y. Spira G. Vlodavsky I. Keshet E. Neufeld G. J. Biol. Chem. 1997; 272: 7151-7158Abstract Full Text Full Text PDF PubMed Scopus (455) Google Scholar, 36.Migdal M. Huppertz B. Tessler S. Comforti A. Shibuya M. Reich R. Baumann H. Neufeld G. J. Biol. Chem. 1998; 273: 22272-22278Abstract Full Text Full Text PDF PubMed Scopus (282) Google Scholar, 45.Cohen T. Gitay-Goren H. Neufeld G. Levi B. Growth Factors. 1992; 7: 131-138Crossref PubMed Scopus (51) Google Scholar, 46.Cohen T. Gitay-Goren H. Sharon R. Shibuya M. Halaban R. Levi B. Neufeld G. J. Biol. Chem. 1995; 270: 11322-11326Abstract Full Text Full Text PDF PubMed Scopus (240) Google Scholar). LipofectAMINE was bought from Life Technologies, Inc. The pBabePuro plasmid was kindly given to us by Dr. Eyal Ben-Gal from the Technion School of Medicine (Haifa, Israel). BS3 was obtained from Pierce. Tissue culture media, sera, and cell culture supplements were from Beth-Haemek Biological Industries (Kibbutz Beth-Haemek, Israel), or from Life Technologies, Inc. All other chemicals were purchased from Sigma. The pre-stained protein size markers used were purchased from Bio-Rad. The np-1 and np-2 cDNA were reverse transcribed using Moloney murine leukemia virus reverse transcriptase (U. S. Biochemical Corp.) from total RNA prepared from HUVEC as described (47.Chomczynski P. Sacchi N. Anal. Biochem. 1987; 162: 156-159Crossref PubMed Scopus (63232) Google Scholar). The cDNA was amplified using the expand high fidelity PCR system kit (Roche Molecular Biochemicals). The primers used were ACGCGGATCCACCATGGAGAGGGGGCTGCCGCT and AGCGGATCCGTCGACTCATGCCTCCGAATAAGTACTC for np-1 and GCTCTAGAACCATGGATATGTTTCCTCTCACC and GCTCTAGAGT CGACTCATGCCTCGGAGCAGCACTT for np-2. The primers for np-2 generated two cDNA products corresponding to the previously described a17 and a22 forms of np-2 (42.Chen H. Chedotal A. He Z. Goodman C.S. Tessier-Lavigne M. Neuron. 1997; 19: 547-559Abstract Full Text Full Text PDF PubMed Scopus (572) Google Scholar). Both strands of the PCR products were sequenced and the nucleotide sequence compared with published sequences. The np-1 cDNA contained one consistent deviation from published sequences. Nucleotide 2197 contains an A instead of a G, giving rise to an isoleucine residue instead a valine residue. The np-1 cDNA was subcloned into the BamHI site of pcDNA3/neo expression vector to generate the pcDNA3/np-1 expression vector, and the two np-2 cDNAs were subcloned into XbaI site of the PECE expression vector (48.Peretz D. Gitay-Goren H. Safran M. Kimmel N. Gospodarowicz D. Neufeld G. Biochem. Biophys. Res. Commun. 1992; 182: 1340-1347Crossref PubMed Scopus (47) Google Scholar) to generate PECE/np-2 expression vectors containing the two splice forms (42.Chen H. Chedotal A. He Z. Goodman C.S. Tessier-Lavigne M. Neuron. 1997; 19: 547-559Abstract Full Text Full Text PDF PubMed Scopus (572) Google Scholar). Human umbilical vein-derived endothelial cells (HUVEC) were isolated and cultured in M199 medium containing 20% fetal calf serum, as described previously (32.Gitay-Goren H. Cohen T. Tessler S. Soker S. Gengrinovitch S. Rockwell P. Klagsbrun M. Levi B. Neufeld G. J. Biol. Chem. 1996; 271: 5519-5523Abstract Full Text Full Text PDF PubMed Scopus (171) Google Scholar). The PAE cells used throughout this report were cultured as described in F-12 medium containing 10% fetal calf serum, glutamine, and antibiotics (24.Waltenberger J. Claesson-Welsh L. Siegbahn A. Shibuya M. Heldin C.H. J. Biol. Chem. 1994; 269: 26988-26995Abstract Full Text PDF PubMed Google Scholar). The PAE cells were kindly provided by Dr. Carl Heldin. The np-1-expressing PAE cell lines were generated by transfecting PAE cells with the pcDNA3/np-1 expression vector followed by selection of stable transfectants using G418 (0.5 mg/ml). The np-2-expressing cell lines were generated by co-transfecting PAE cells with the PECE/np-2(a17) or PECE/np-2(a22) expression vectors and the pBabePuro plasmid (49.Morgenstern J.P. Land H. Nucleic Acids Res. 1990; 18: 3587-3596Crossref PubMed Scopus (1903) Google Scholar), followed by selection with 0.5 μg/ml puromycin (49.Morgenstern J.P. Land H. Nucleic Acids Res. 1990; 18: 3587-3596Crossref PubMed Scopus (1903) Google Scholar). Transfection was carried out using LipofectAMINE according to manufacturer's instructions. Stable cell lines were subsequently cultured without puromycin or G418. MDA-MB-231 breast cancer cells were cultured as described previously (33.Soker S. Fidder H. Neufeld G. Klagsbrun M. J. Biol. Chem. 1996; 271: 5761-5767Abstract Full Text Full Text PDF PubMed Scopus (289) Google Scholar). VEGF121, VEGF145, and VEGF165 were produced using the baculovirus expression system and iodinated as described (9.Poltorak Z. Cohen T. Sivan R. Kandelis Y. Spira G. Vlodavsky I. Keshet E. Neufeld G. J. Biol. Chem. 1997; 272: 7151-7158Abstract Full Text Full Text PDF PubMed Scopus (455) Google Scholar, 32.Gitay-Goren H. Cohen T. Tessler S. Soker S. Gengrinovitch S. Rockwell P. Klagsbrun M. Levi B. Neufeld G. J. Biol. Chem. 1996; 271: 5519-5523Abstract Full Text Full Text PDF PubMed Scopus (171) Google Scholar, 45.Cohen T. Gitay-Goren H. Neufeld G. Levi B. Growth Factors. 1992; 7: 131-138Crossref PubMed Scopus (51) Google Scholar). The binding of the VEGF isoforms to cells and cross-linking was carried out essentially as described previously (30.Vaisman N. Gospodarowicz D. Neufeld G. J. Biol. Chem. 1990; 265: 19461-19466Abstract Full Text PDF PubMed Google Scholar, 32.Gitay-Goren H. Cohen T. Tessler S. Soker S. Gengrinovitch S. Rockwell P. Klagsbrun M. Levi B. Neufeld G. J. Biol. Chem. 1996; 271: 5519-5523Abstract Full Text Full Text PDF PubMed Scopus (171) Google Scholar). All the experiments were repeated at least twice. NP-2 was originally characterized as a receptor for semaphorins 3C and 3F, whereas np-1 was originally identified as a semaphorin-3A receptor (39.Kolodkin A.L. Levengood D.V. Rowe E.G. Tai Y.T. Giger R.J. Ginty D.D. Cell. 1997; 90: 753-762Abstract Full Text Full Text PDF PubMed Scopus (1003) Google Scholar, 42.Chen H. Chedotal A. He Z. Goodman C.S. Tessier-Lavigne M. Neuron. 1997; 19: 547-559Abstract Full Text Full Text PDF PubMed Scopus (572) Google Scholar). NP-1 was subsequently found to be a receptor for VEGF165 (34.Soker S. Takashima S. Miao H.Q. Neufeld G. Klagsbrun M. Cell. 1998; 92: 735-745Abstract Full Text Full Text PDF PubMed Scopus (2088) Google Scholar). We hypothesized, therefore, that np-2 may also act as a VEGF receptor. Northern blot analysis revealed np-2 mRNA transcripts in HUVEC (data not shown). RT-PCR led to the isolation of two cDNA species encoding two splice forms of human np-2 from HUVEC-derived mRNA. These correspond to the previously identified a17 and a22 splice forms (42.Chen H. Chedotal A. He Z. Goodman C.S. Tessier-Lavigne M. Neuron. 1997; 19: 547-559Abstract Full Text Full Text PDF PubMed Scopus (572) Google Scholar). The full-length cDNAs encoding these np-2 forms were stably expressed in PAE cells. 125I-VEGF165 was subsequently bound and cross-linked to the PAE/np-2(a22) cells. The binding was strongly enhanced by heparin, and two125I-VEGF165/np-2 cross-linked complexes of ∼140 and ∼160 kDa could be observed (Fig.1 A, lane 2). The binding was specific since125I-VEGF165 did not bind to parental PAE cells, even though heparin was added during the binding (Fig.1 B, lane 3). Similar results were obtained when PAE/np-2(a17) cells were used (data not shown). It was previously observed that the related receptor encoded by the np-1 gene binds VEGF165 but not VEGF121 (34.Soker S. Takashima S. Miao H.Q. Neufeld G. Klagsbrun M. Cell. 1998; 92: 735-745Abstract Full Text Full Text PDF PubMed Scopus (2088) Google Scholar, 36.Migdal M. Huppertz B. Tessler S. Comforti A. Shibuya M. Reich R. Baumann H. Neufeld G. J. Biol. Chem. 1998; 273: 22272-22278Abstract Full Text Full Text PDF PubMed Scopus (282) Google Scholar). It seems that np-2 behaves similarly since cells expressing the recombinant np-2 forms were not able to bind125I-VEGF121 (Fig. 1 A,lane 4), even though the125I-VEGF121 used bound efficiently to recombinant VEGFR-1 receptors that were expressed in PAE cells (Fig.1 B, lane 2). The affinities of np-1 and np-2 toward VEGF165 were compared using Scatchard analysis. The dissociation constant of VEGF165 from np-2 found to be 1.3 × 10−10m, while the dissociation constant of VEGF165 from np-1 was 1.8 × 10−10m (data not shown). The dissociation constants are thus very similar. NP-1 was also found to function as a VEGF-B receptor and a receptor for the heparin-binding form of placenta growth factor, PlGF-2 (36.Migdal M. Huppertz B. Tessler S. Comforti A. Shibuya M. Reich R. Baumann H. Neufeld G. J. Biol. Chem. 1998; 273: 22272-22278Abstract Full Text Full Text PDF PubMed Scopus (282) Google Scholar, 37.Makinen T. Olofsson B. Karpanen T. Hellman U. Soker S. Klagsbrun M. Eriksson U. Alitalo K. J. Biol. Chem. 1999; 274: 21217-21222Abstract Full Text Full Text PDF PubMed Scopus (231) Google Scholar). We have therefore asked whether PlGF-2 can also bind to np-2. A complex corresponding in size to a PlGF-2/np-2 complex was observed when 125I-PlGF-2 was bound and cross-linked to PAE cells expressing either the a22 splice form of np-2 (Fig. 2, lane 1) or the a17 form (Fig. 2, lane 3). Similar complexes were absent when 125I-PlGF-2 was bound and cross-linked to parental PAE cells (Fig. 2, lanes 2 and 4). These experiments indicate that np-2 can also function as a receptor for PlGF-2. np-2 and np-1 bind to different ligands in the central nervous system. Our initial experiments did not reveal any differences between np-1 and np-2 with regard to their interactions with VEGF165 and PlGF-2. However, when VEGF145 was bound and subsequently cross-linked to np-1 and to np-2, it was found that VEGF145is able to bind to np-2 but not to np-1 (Fig.3). VEGF145 is a VEGF splice form that lacks exon 7 and contains instead the peptide encoded by exon 6 of the VEGF gene (9.Poltorak Z. Cohen T. Sivan R. Kandelis Y. Spira G. Vlodavsky I. Keshet E. Neufeld G. J. Biol. Chem. 1997; 272: 7151-7158Abstract Full Text Full Text PDF PubMed Scopus (455) Google Scholar). These results were verified by competition experiments, which have shown clearly that VEGF145 competes with VEGF165 for binding to np-2 but not for binding to np-1 (Fig. 3 B). The affinity of VEGF145 toward np-2 is about 5 fold lower than that of VEGF165 as is revealed by binding/competition experiments (Fig. 4 B). Thus the dissociation constant of VEGF145 is around 7 × 10−10m as compared with 1.3 × 10−10m for VEGF165. However, even 4 μg/ml VEGF145 were not sufficient to inhibit significantly the binding of125I-VEGF165 to np-1, indicating that the affinity of np-1 to VEGF145 is at least 100-fold lower (Fig. 4 A). Because VEGF145 differentiates between the two neuropilin types, we have also looked at the expression of np-2 on the surface of sev" @default.
• W2034646933 created "2016-06-24" @default.
• W2034646933 creator A5044819086 @default.
• W2034646933 creator A5048706787 @default.
• W2034646933 creator A5049688926 @default.
• W2034646933 creator A5075192194 @default.
• W2034646933 date "2000-06-01" @default.
• W2034646933 modified "2023-10-17" @default.
• W2034646933 title "Neuropilin-2 and Neuropilin-1 Are Receptors for the 165-Amino Acid Form of Vascular Endothelial Growth Factor (VEGF) and of Placenta Growth Factor-2, but Only Neuropilin-2 Functions as a Receptor for the 145-Amino Acid Form of VEGF" @default.
• W2034646933 cites W1562216431 @default.
• W2034646933 cites W1591057067 @default.
• W2034646933 cites W1600542667 @default.
• W2034646933 cites W1964361550 @default.
• W2034646933 cites W1965157961 @default.
• W2034646933 cites W1981612052 @default.
• W2034646933 cites W1983763042 @default.
• W2034646933 cites W1986559037 @default.
• W2034646933 cites W1990983421 @default.
• W2034646933 cites W1992579449 @default.
• W2034646933 cites W1993362999 @default.
• W2034646933 cites W1995821745 @default.
• W2034646933 cites W1996890384 @default.
• W2034646933 cites W2002045669 @default.
• W2034646933 cites W2003598961 @default.
• W2034646933 cites W2006659499 @default.
• W2034646933 cites W2010092400 @default.
• W2034646933 cites W2012585750 @default.
• W2034646933 cites W2012596140 @default.
• W2034646933 cites W2013038209 @default.
• W2034646933 cites W2013184812 @default.
• W2034646933 cites W2018768026 @default.
• W2034646933 cites W2021087194 @default.
• W2034646933 cites W2029757116 @default.
• W2034646933 cites W2032595673 @default.
• W2034646933 cites W2043850275 @default.
• W2034646933 cites W2043863730 @default.
• W2034646933 cites W2045247659 @default.
• W2034646933 cites W2046034465 @default.
• W2034646933 cites W2046516822 @default.
• W2034646933 cites W2047166961 @default.
• W2034646933 cites W2050358495 @default.
• W2034646933 cites W2055613750 @default.
• W2034646933 cites W2067817921 @default.
• W2034646933 cites W2077861409 @default.
• W2034646933 cites W2084506573 @default.
• W2034646933 cites W2090877530 @default.
• W2034646933 cites W2093498435 @default.
• W2034646933 cites W2098732827 @default.
• W2034646933 cites W2103686156 @default.
• W2034646933 cites W2107964792 @default.
• W2034646933 cites W2137299803 @default.
• W2034646933 cites W2141046053 @default.
• W2034646933 cites W2163339962 @default.
• W2034646933 cites W2166156136 @default.
• W2034646933 cites W4234101443 @default.
• W2034646933 cites W4294216491 @default.
• W2034646933 doi "https://doi.org/10.1074/jbc.m909259199" @default.
• W2034646933 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10748121" @default.
• W2034646933 hasPublicationYear "2000" @default.
• W2034646933 type Work @default.
• W2034646933 sameAs 2034646933 @default.
• W2034646933 citedByCount "384" @default.
• W2034646933 countsByYear W20346469332012 @default.
• W2034646933 countsByYear W20346469332013 @default.
• W2034646933 countsByYear W20346469332014 @default.
• W2034646933 countsByYear W20346469332015 @default.
• W2034646933 countsByYear W20346469332016 @default.
• W2034646933 countsByYear W20346469332017 @default.
• W2034646933 countsByYear W20346469332018 @default.
• W2034646933 countsByYear W20346469332019 @default.
• W2034646933 countsByYear W20346469332020 @default.
• W2034646933 countsByYear W20346469332021 @default.
• W2034646933 countsByYear W20346469332022 @default.
• W2034646933 countsByYear W20346469332023 @default.
• W2034646933 crossrefType "journal-article" @default.
• W2034646933 hasAuthorship W2034646933A5044819086 @default.
• W2034646933 hasAuthorship W2034646933A5048706787 @default.
• W2034646933 hasAuthorship W2034646933A5049688926 @default.
• W2034646933 hasAuthorship W2034646933A5075192194 @default.
• W2034646933 hasBestOaLocation W20346469331 @default.
• W2034646933 hasConcept C106420622 @default.
• W2034646933 hasConcept C167734588 @default.
• W2034646933 hasConcept C170493617 @default.
• W2034646933 hasConcept C172680121 @default.
• W2034646933 hasConcept C185592680 @default.
• W2034646933 hasConcept C2775960820 @default.
• W2034646933 hasConcept C2776953305 @default.
• W2034646933 hasConcept C2777025900 @default.
• W2034646933 hasConcept C2779234561 @default.
• W2034646933 hasConcept C34425596 @default.
• W2034646933 hasConcept C502942594 @default.
• W2034646933 hasConcept C54355233 @default.
• W2034646933 hasConcept C55493867 @default.
• W2034646933 hasConcept C86803240 @default.
• W2034646933 hasConcept C95444343 @default.
• W2034646933 hasConceptScore W2034646933C106420622 @default.
• W2034646933 hasConceptScore W2034646933C167734588 @default.
• W2034646933 hasConceptScore W2034646933C170493617 @default.

• next