FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2034785524> ?p ?o ?g. }

• W2034785524 endingPage "12004" @default.
• W2034785524 startingPage "11993" @default.
• W2034785524 abstract "Developmental processes are highly dependent on transcriptional regulation by RNA polymerase II. The RNA polymerase II core promoter is the ultimate target of a multitude of transcription factors that control transcription initiation. Core promoters consist of core promoter motifs, e.g. the initiator, TATA box, and the downstream core promoter element (DPE), which confer specific properties to the core promoter. Here, we explored the importance of core promoter functions in the dorsal-ventral developmental gene regulatory network. This network includes multiple genes that are activated by different nuclear concentrations of Dorsal, an NFκB homolog transcription factor, along the dorsal-ventral axis. We show that over two-thirds of Dorsal target genes contain DPE sequence motifs, which is significantly higher than the proportion of DPE-containing promoters in Drosophila genes. We demonstrate that multiple Dorsal target genes are evolutionarily conserved and functionally dependent on the DPE. Furthermore, we have analyzed the activation of key Dorsal target genes by Dorsal, as well as by another Rel family transcription factor, Relish, and the dependence of their activation on the DPE motif. Using hybrid enhancer-promoter constructs in Drosophila cells and embryo extracts, we have demonstrated that the core promoter composition is an important determinant of transcriptional activity of Dorsal target genes. Taken together, our results provide evidence for the importance of core promoter composition in the regulation of Dorsal target genes. Developmental processes are highly dependent on transcriptional regulation by RNA polymerase II. The RNA polymerase II core promoter is the ultimate target of a multitude of transcription factors that control transcription initiation. Core promoters consist of core promoter motifs, e.g. the initiator, TATA box, and the downstream core promoter element (DPE), which confer specific properties to the core promoter. Here, we explored the importance of core promoter functions in the dorsal-ventral developmental gene regulatory network. This network includes multiple genes that are activated by different nuclear concentrations of Dorsal, an NFκB homolog transcription factor, along the dorsal-ventral axis. We show that over two-thirds of Dorsal target genes contain DPE sequence motifs, which is significantly higher than the proportion of DPE-containing promoters in Drosophila genes. We demonstrate that multiple Dorsal target genes are evolutionarily conserved and functionally dependent on the DPE. Furthermore, we have analyzed the activation of key Dorsal target genes by Dorsal, as well as by another Rel family transcription factor, Relish, and the dependence of their activation on the DPE motif. Using hybrid enhancer-promoter constructs in Drosophila cells and embryo extracts, we have demonstrated that the core promoter composition is an important determinant of transcriptional activity of Dorsal target genes. Taken together, our results provide evidence for the importance of core promoter composition in the regulation of Dorsal target genes. Transcriptional regulation of gene expression is critical for embryonic development (1.Nüsslein-Volhard C. Wieschaus E. Mutations affecting segment number and polarity in Drosophila.Nature. 1980; 287: 795-801Crossref PubMed Scopus (3016) Google Scholar, 2.Pearson J.C. Lemons D. McGinnis W. Modulating Hox gene functions during animal body patterning.Nat. Rev. Genet. 2005; 6: 893-904Crossref PubMed Scopus (649) Google Scholar, 3.Levine M. Tjian R. Transcription regulation and animal diversity.Nature. 2003; 424: 147-151Crossref PubMed Scopus (927) Google Scholar, 4.Muse G.W. Gilchrist D.A. Nechaev S. Shah R. Parker J.S. Grissom S.F. Zeitlinger J. Adelman K. RNA polymerase is poised for activation across the genome.Nat. Genet. 2007; 39: 1507-1511Crossref PubMed Scopus (568) Google Scholar, 5.Zeitlinger J. Stark A. Kellis M. Hong J.W. Nechaev S. Adelman K. Levine M. Young R.A. RNA polymerase stalling at developmental control genes in the Drosophila melanogaster embryo.Nat. Genet. 2007; 39: 1512-1516Crossref PubMed Scopus (574) Google Scholar, 6.Lagha M. Bothma J.P. Levine M. Mechanisms of transcriptional precision in animal development.Trends Genet. 2012; 28: 409-416Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar). Multiple sequence-specific DNA binding transcription factors and co-regulators control gene expression (7.Spitz F. Furlong E.E. Transcription factors: from enhancer binding to developmental control.Nat. Rev. Genet. 2012; 13: 613-626Crossref PubMed Scopus (1167) Google Scholar, 8.Ochoa-Espinosa A. Small S. Developmental mechanisms and cis-regulatory codes.Curr. Opin. Genet. Dev. 2006; 16: 165-170Crossref PubMed Scopus (23) Google Scholar, 9.Malik S. Roeder R.G. The metazoan Mediator co-activator complex as an integrative hub for transcriptional regulation.Nat. Rev. Genet. 2010; 11: 761-772Crossref PubMed Scopus (532) Google Scholar, 10.Bulger M. Groudine M. Functional and mechanistic diversity of distal transcription enhancers.Cell. 2011; 144: 327-339Abstract Full Text Full Text PDF PubMed Scopus (595) Google Scholar), but the ultimate target of the transcription machinery is the initiation of transcription at the core promoter, which could hence be referred to as the gateway to transcription (11.Smale S.T. Kadonaga J.T. The RNA polymerase II core promoter.Annu. Rev. Biochem. 2003; 72: 449-479Crossref PubMed Scopus (796) Google Scholar, 12.Juven-Gershon T. Hsu J.-Y. Theisen J.W. Kadonaga J.T. The RNA polymerase II core promoter: the gateway to transcription.Curr. Opin. Cell Biol. 2008; 20: 253-259Crossref PubMed Scopus (258) Google Scholar, 13.Juven-Gershon T. Kadonaga J.T. Regulation of gene expression via the core promoter and the basal transcriptional machinery.Dev. Biol. 2010; 339: 225-229Crossref PubMed Scopus (348) Google Scholar, 14.Thomas M.C. Chiang C.M. The general transcription machinery and general cofactors.Crit. Rev. Biochem. Mol. Biol. 2006; 41: 105-178Crossref PubMed Scopus (614) Google Scholar, 15.Heintzman N.D. Ren B. The gateway to transcription: identifying, characterizing and understanding promoters in the eukaryotic genome.Cell. Mol. Life Sci. 2007; 64: 386-400Crossref PubMed Scopus (85) Google Scholar, 16.Smale S.T. Core promoters: active contributors to combinatorial gene regulation.Genes Dev. 2001; 15: 2503-2508Crossref PubMed Scopus (199) Google Scholar). Focused core promoters, i.e. promoters in which transcription initiates at a single nucleotide or within a narrow region of several nucleotides, exist in all eukaryotes and are predominant in simple organisms, such as Drosophila (13.Juven-Gershon T. Kadonaga J.T. Regulation of gene expression via the core promoter and the basal transcriptional machinery.Dev. Biol. 2010; 339: 225-229Crossref PubMed Scopus (348) Google Scholar, 17.Lenhard B. Sandelin A. Carninci P. Metazoan promoters: emerging characteristics and insights into transcriptional regulation.Nat. Rev. Genet. 2012; 13: 233-245Crossref PubMed Scopus (331) Google Scholar, 18.Ohler U. Wassarman D.A. Promoting developmental transcription.Development. 2010; 137: 15-26Crossref PubMed Scopus (60) Google Scholar). Focused core promoters are typically ∼80 nucleotides in length and encompass the RNA start site (13.Juven-Gershon T. Kadonaga J.T. Regulation of gene expression via the core promoter and the basal transcriptional machinery.Dev. Biol. 2010; 339: 225-229Crossref PubMed Scopus (348) Google Scholar, 17.Lenhard B. Sandelin A. Carninci P. Metazoan promoters: emerging characteristics and insights into transcriptional regulation.Nat. Rev. Genet. 2012; 13: 233-245Crossref PubMed Scopus (331) Google Scholar, 18.Ohler U. Wassarman D.A. Promoting developmental transcription.Development. 2010; 137: 15-26Crossref PubMed Scopus (60) Google Scholar). Core promoters may contain one or more functional DNA sequence elements, termed core promoter elements or motifs, such as the TATA box, TFIIB recognition elements (BREu and BREd), initiator (Inr), 2The abbreviations used are: InrinitiatorDPEdownstream core promoter elementMTEmotif 10 elementTBPTATA box-binding proteinPolpolymeraseGRNgene regulatory networkmDPEmutant DPE. TCT motif, motif 10 element (MTE), and downstream core promoter element (DPE), which confer specific properties to the core promoter (13.Juven-Gershon T. Kadonaga J.T. Regulation of gene expression via the core promoter and the basal transcriptional machinery.Dev. Biol. 2010; 339: 225-229Crossref PubMed Scopus (348) Google Scholar, 19.Gershenzon N.I. Trifonov E.N. Ioshikhes I.P. The features of Drosophila core promoters revealed by statistical analysis.BMC Genomics. 2006; 7: 161Crossref PubMed Scopus (37) Google Scholar, 20.Parry T.J. Theisen J.W. Hsu J.-Y. Wang Y.-L. Corcoran D.L. Eustice M. Ohler U. Kadonaga J.T. The TCT motif, a key component of an RNA polymerase II transcription system for the translational machinery.Genes Dev. 2010; 24: 2013-2018Crossref PubMed Scopus (74) Google Scholar, 21.Dikstein R. The unexpected traits associated with core promoter elements.Transcription. 2011; 2: 201-206Crossref PubMed Scopus (37) Google Scholar). The TATA box, the Inr, the MTE, and the DPE motifs are recognized and bound by subunits of TFIID, the first complex that recognizes and binds the core promoter in the process of RNA polymerase II recruitment to the core promoter. initiator downstream core promoter element motif 10 element TATA box-binding protein polymerase gene regulatory network mutant DPE. The TATA box is the first core promoter motif identified and is conserved from archaebacteria to humans (22Goldberg, M. L., (1979) Sequence analysis of Drosophila histone genes. Ph.D. Thesis, Stanford University,Google Scholar, 23.Reeve J.N. Archaeal chromatin and transcription.Mol. Microbiol. 2003; 48: 587-598Crossref PubMed Scopus (123) Google Scholar). The upstream T is typically located at −30 or −31 relative to the transcription start site (24.Carninci P. Sandelin A. Lenhard B. Katayama S. Shimokawa K. Ponjavic J. Semple C.A. Taylor M.S. Engström P.G. Frith M.C. Forrest A.R. Alkema W.B. Tan S.L. Plessy C. Kodzius R. Ravasi T. Kasukawa T. Fukuda S. Kanamori-Katayama M. Kitazume Y. Kawaji H. Kai C. Nakamura M. Konno H. Nakano K. Mottagui-Tabar S. Arner P. Chesi A. Gustincich S. Persichetti F. Suzuki H. Grimmond S.M. Wells C.A. Orlando V. Wahlestedt C. Liu E.T. Harbers M. Kawai J. Bajic V.B. Hume D.A. Hayashizaki Y. Genome-wide analysis of mammalian promoter architecture and evolution.Nat. Genet. 2006; 38: 626-635Crossref PubMed Scopus (1000) Google Scholar). The TATA box is bound by the TATA box-binding protein (TBP) subunit of TFIID. The Inr encompasses the transcription start site and is the most common core promoter element (11.Smale S.T. Kadonaga J.T. The RNA polymerase II core promoter.Annu. Rev. Biochem. 2003; 72: 449-479Crossref PubMed Scopus (796) Google Scholar, 19.Gershenzon N.I. Trifonov E.N. Ioshikhes I.P. The features of Drosophila core promoters revealed by statistical analysis.BMC Genomics. 2006; 7: 161Crossref PubMed Scopus (37) Google Scholar, 25.FitzGerald P.C. Sturgill D. Shyakhtenko A. Oliver B. Vinson C. Comparative genomics of Drosophila and human core promoters.Genome Biol. 2006; 7: R53Crossref PubMed Scopus (113) Google Scholar). The Inr is bound by the TAF1 and TAF2 subunits of TFIID (26.Chalkley G.E. Verrijzer C.P. DNA binding site selection by RNA polymerase II TAFs: a TAF(II)250-TAF(II)150 complex recognizes the Initiator.EMBO J. 1999; 18: 4835-4845Crossref PubMed Scopus (176) Google Scholar). The DPE was originally discovered as a TFIID recognition site that is located downstream of the initiator element (precisely from +28 to +33 relative to the A+1 of the Inr) and is conserved from Drosophila to humans (27.Burke T.W. Kadonaga J.T. Drosophila TFIID binds to a conserved downstream basal promoter element that is present in many TATA-box-deficient promoters.Genes Dev. 1996; 10: 711-724Crossref PubMed Scopus (324) Google Scholar, 28.Burke T.W. Kadonaga J.T. The downstream core promoter element, DPE, is conserved from Drosophila to humans and is recognized by TAF(II)60 of Drosophila.Genes Dev. 1997; 11: 3020-3031Crossref PubMed Scopus (396) Google Scholar). It is bound by the TAF6 and TAF9 subunits of TFIID (28.Burke T.W. Kadonaga J.T. The downstream core promoter element, DPE, is conserved from Drosophila to humans and is recognized by TAF(II)60 of Drosophila.Genes Dev. 1997; 11: 3020-3031Crossref PubMed Scopus (396) Google Scholar). The MTE is located immediately upstream of the DPE at precisely +18 to +27 relative to the A+1 in the Inr and is also conserved from Drosophila to humans (29.Ohler U. Liao G.C. Niemann H. Rubin G.M. Computational analysis of core promoters in the Drosophila genome.Genome Biol. 2002; 3 (RESEARCH0087)Crossref PubMed Google Scholar, 30.Lim C.Y. Santoso B. Boulay T. Dong E. Ohler U. Kadonaga J.T. The MTE, a new core promoter element for transcription by RNA polymerase II.Genes Dev. 2004; 18: 1606-1617Crossref PubMed Scopus (146) Google Scholar). Both the DPE and the MTE motifs are dependent on the Inr and function cooperatively with it (28.Burke T.W. Kadonaga J.T. The downstream core promoter element, DPE, is conserved from Drosophila to humans and is recognized by TAF(II)60 of Drosophila.Genes Dev. 1997; 11: 3020-3031Crossref PubMed Scopus (396) Google Scholar, 30.Lim C.Y. Santoso B. Boulay T. Dong E. Ohler U. Kadonaga J.T. The MTE, a new core promoter element for transcription by RNA polymerase II.Genes Dev. 2004; 18: 1606-1617Crossref PubMed Scopus (146) Google Scholar, 31.Juven-Gershon T. Cheng S. Kadonaga J.T. Rational design of a super core promoter that enhances gene expression.Nat. Methods. 2006; 3: 917-922Crossref PubMed Scopus (142) Google Scholar, 32.Theisen J.W. Lim C.Y. Kadonaga J.T. Three key subregions contribute to the function of the downstream RNA polymerase II core promoter.Mol. Cell Biol. 2010; 30: 3471-3479Crossref PubMed Scopus (38) Google Scholar, 33.Kutach A.K. Kadonaga J.T. The downstream promoter element DPE appears to be as widely used as the TATA box in Drosophila core promoters.Mol. Cell Biol. 2000; 20: 4754-4764Crossref PubMed Scopus (271) Google Scholar). Moreover, we have previously demonstrated that gene expression levels can be modulated via the core promoter (31.Juven-Gershon T. Cheng S. Kadonaga J.T. Rational design of a super core promoter that enhances gene expression.Nat. Methods. 2006; 3: 917-922Crossref PubMed Scopus (142) Google Scholar). The existence of different types of core promoters implies that core promoter elements play regulatory roles beyond the specification of transcription initiation. Transcription of TATA-dependent genes differs from transcription of DPE-dependent genes in many respects. First, the set of basal transcription factors that is necessary to transcribe TATA-dependent promoters in vitro is insufficient to transcribe DPE-dependent promoters (34.Lewis B.A. Sims 3rd, R.J. Lane W.S. Reinberg D. Functional characterization of core promoter elements: DPE-specific transcription requires the protein kinase CK2 and the PC4 coactivator.Mol. Cell. 2005; 18: 471-481Abstract Full Text Full Text PDF PubMed Scopus (58) Google Scholar, 35.Goodrich J.A. Tjian R. Unexpected roles for core promoter recognition factors in cell-type-specific transcription and gene regulation.Nat. Rev. Genet. 2010; 11: 549-558Crossref PubMed Google Scholar). Second, enhancers with preference for DPE-containing promoters or TATA-containing promoters have been identified, supporting the existence of enhancer-promoter specificity (16.Smale S.T. Core promoters: active contributors to combinatorial gene regulation.Genes Dev. 2001; 15: 2503-2508Crossref PubMed Scopus (199) Google Scholar, 36.Ohtsuki S. Levine M. Cai H.N. Different core promoters possess distinct regulatory activities in the Drosophila embryo.Genes Dev. 1998; 12: 547-556Crossref PubMed Scopus (178) Google Scholar, 37.Butler J.E. Kadonaga J.T. Enhancer-promoter specificity mediated by DPE or TATA core promoter motifs.Genes Dev. 2001; 15: 2515-2519Crossref PubMed Scopus (198) Google Scholar, 38.Butler J.E. Kadonaga J.T. The RNA polymerase II core promoter: a key component in the regulation of gene expression.Genes Dev. 2002; 16: 2583-2592Crossref PubMed Scopus (445) Google Scholar). Third, TBP is necessary for TATA-dependent transcription. However, TBP down-regulates DPE-dependent transcription (39.Hsu J.-Y. Juven-Gershon T. Marr 2nd, M.T. Wright K.J. Tjian R. Kadonaga J.T. TBP, Mot1, and NC2 establish a regulatory circuit that controls DPE-dependent versus TATA-dependent transcription.Genes Dev. 2008; 22: 2353-2358Crossref PubMed Scopus (59) Google Scholar). The two transcriptional regulators, NC2 and MOT1, which have been shown to be positive regulators of DPE-dependent transcription, do so by counteracting TBP, thus relieving its inhibition of DPE transcription (39.Hsu J.-Y. Juven-Gershon T. Marr 2nd, M.T. Wright K.J. Tjian R. Kadonaga J.T. TBP, Mot1, and NC2 establish a regulatory circuit that controls DPE-dependent versus TATA-dependent transcription.Genes Dev. 2008; 22: 2353-2358Crossref PubMed Scopus (59) Google Scholar, 40.Willy P.J. Kobayashi R. Kadonaga J.T. A basal transcription factor that activates or represses transcription.Science. 2000; 290: 982-985Crossref PubMed Scopus (134) Google Scholar, 41.van Werven F.J. van Bakel H. van Teeffelen H.A. Altelaar A.F. Koerkamp M.G. Heck A.J. Holstege F.C. Timmers H.T. Cooperative action of NC2 and Mot1p to regulate TATA-binding protein function across the genome.Genes Dev. 2008; 22: 2359-2369Crossref PubMed Scopus (58) Google Scholar). In this study, we explored the contribution of the DPE motif to the regulation of gene expression in the dorsal-ventral developmental gene network that is governed by the Rel family transcription factor Dorsal. We show that the promoters of many Dorsal target genes contain DPE sequence motifs. We demonstrate that core promoters of multiple Dorsal target genes are evolutionarily conserved and are functionally dependent on the DPE motif. Moreover, we have analyzed the activation of key Dorsal target genes by Dorsal and another Rel family transcription factor, Relish, and the dependence on the DPE motif. Using Drosophila S2R+ cells, we further demonstrate that the TATA box cannot compensate for the loss of DPE in the Dorsal target brinker and can only partially compensate for the loss of DPE in the Dorsal target twist. The addition of a TATA box to the brinker and twist promoter can, however, compensate for the loss of DPE using nuclear extracts derived from Drosophila embryos. We show that Dorsal is able to discriminate between a TATA box-containing promoter and a DPE-containing promoter. Transcription of enhancer-promoter constructs in both Drosophila S2R+ cells and embryo extracts manifests the importance of the core promoter in transcriptional regulation of Dorsal target genes. Collectively, we demonstrate that the DPE motif plays an important role in the expression of Dorsal target genes regulating dorsal-ventral patterning and provides evidence for the key contribution of the core promoter composition to gene regulatory networks. Sequence conservation analysis was performed using the UCSC genome browser. Drosophila transcripts that initiate at different chromosomal positions (based on the RefSeq database) were used to calculate the frequency of the core promoter elements (see Tables 1 and 2). Inr elements were identified in the region −10 to +10 relative to the transcription start site if there was an A at +1 and at least three of five additional matches to the consensus (TCAKTY, where the A is the +1 of the transcript). DPE motifs that were precisely located at +28 relative to the A + 1 of the Inr, were identified based on at least five of six matches to the DPE functional range set (DSWYVY). Putative TATA box elements were identified based on a match to a TATA sequence located from −45 to −19 relative to the RefSeq transcription start site. The significance of differences in core promoter composition between Drosophila transcripts and Dorsal target genes was calculated using the chi-square test.TABLE 1Core promoter composition of Dorsal target genes Open table in a new tab TABLE 2Frequency of core promoter elements among Drosophila transcripts that initiate at different chromosomal positions and Dorsal target genesCombination of core promoter elementsDrosophila transcriptsDorsal target genesp valueNo. of GenesFrequencyNo. of GenesFrequency%%Inr16,352828391<0.02TATA3,494182629<0.01TATA and no DPE2,5681378<0.15TATA and no Inr4612221Inr and DPE4,628236369<0.0001Inr, DPE and TATA83641921<0.0001Total19,865(100)91(100) Open table in a new tab Double-stranded oligonucleotides comprising core promoter sequences from −10 to +40 (see Fig. 1 and supplemental Fig. S1) of the tested Dorsal target genes core promoters were inserted into the PstI and XbaI sites of pUC119. Mutation of the DPE in the core promoters was identical to that used previously (30.Lim C.Y. Santoso B. Boulay T. Dong E. Ohler U. Kadonaga J.T. The MTE, a new core promoter element for transcription by RNA polymerase II.Genes Dev. 2004; 18: 1606-1617Crossref PubMed Scopus (146) Google Scholar), where the mutant DPE contains CATA at +30 to +33 relative to A + 1. Natural tinman (tin), brinker (brk), twist (twi), and leak (lea) enhancer-promoter constructs driving the luciferase reporter gene were used in FIGURE 3., FIGURE 4., FIGURE 5., and tin-twi hybrid enhancer-promoter constructs driving the luciferase reporter gene were used in Fig. 6. In vitro transcription reactions were carried out as described previously (42.Wampler S.L. Tyree C.M. Kadonaga J.T. Fractionation of the general RNA polymerase II transcription factors from Drosophila embryos.J. Biol. Chem. 1990; 265: 21223-21231Abstract Full Text PDF PubMed Google Scholar) using 250 ng of supercoiled DNA templates with Drosophila high salt nuclear extracts (43.Soeller W.C. Poole S.J. Kornberg T. In vitro transcription of the Drosophila engrailed gene.Genes Dev. 1988; 2: 68-81Crossref PubMed Scopus (190) Google Scholar). The resulting transcripts were subjected to primer extension analysis with an M13 reverse sequencing primer (AGCGGATAACAATTTCACACAGGA; see Fig. 2) or with a reverse luciferase primer (TCTTCCAGCGGATAGAATGGCGCC; see Figs. 5 and 6). Quantitation of reverse transcription products was carried out using ImageQuant, ImageJ, and GelQuantNET. All experiments were carried out a minimum of three independent times to ensure reproducibility of the data.FIGURE 3.The activation of transcription of the natural tinman, brinker, and twist promoters in Drosophila S2R+ cells by Dorsal and the dependence of their activation on the DPE motif. Drosophila S2R+ cells were co-transfected with firefly luciferase reporter constructs containing wt or mDPE promoter, as well as varying amounts of a Dorsal expression plasmid, as indicated. To normalize for transfection efficiency, cells were co-transfected with a Pol III-Renilla luciferase control plasmid and assayed for dual luciferase activity. The activities are reported relative to the wild-type promoter in the absence of co-transfected Dorsal expression plasmid, which was defined to be 1. A schematic diagram of the genomic fragments is shown on top of panels A–C. A, transcriptional activation of the natural tinman promoter by Dorsal (n = 3). B, transcription activation of the natural brinker promoter by Dorsal (n = 3). C, transcription activation of the natural twist promoter by Dorsal (n = 4). D, basal transcription levels of twi. To enable the visualization of the basal transcription levels of wt and mDPE twist reporters, these data are presented in a separate panel. In all panels, error bars represent S.E.View Large Image Figure ViewerDownload Hi-res image Download (PPT)FIGURE 4.The TATA box motif cannot substitute for the loss of a DPE motif in brk transcription and can only partially substitute for the loss of a DPE motif in twi in Drosophila S2R+ cells, whereas transcriptional activation of the natural leak promoter by Dorsal is dependent on the DPE motif and could fully be restored via a TATA box. Drosophila S2R+ cells were transfected with firefly luciferase reporter constructs containing wt (columns 1), mDPE (columns 2), or mDPE + TATA box promoter (columns 3), as well as a Dorsal expression vector, a Relish expression vector, or an empty vector, as indicated. To normalize for transfection efficiency, cells were co-transfected with a Pol III-Renilla luciferase control plasmid and assayed for dual luciferase activity. The activities are reported relative to the wild-type promoter in the absence of co-transfected Dorsal or Relish expression plasmid, which was defined to be 1. A, transcriptional activation of the natural brinker promoter by Dorsal is dependent on the DPE motif and cannot be compensated via a TATA box (n = 3). B, transcriptional activation of the natural twist promoter by Dorsal is dependent on the DPE and could partially be restored via a TATA box (n = 3). C, basal transcription levels of twi. To enable the visualization of the basal transcription levels of wt (columns 1), mDPE (columns 2), and mDPE + TATA box (columns 3) twist reporters (in the absence of transfected Dorsal), these data are presented in a separate panel. D, transcriptional activation of the natural leak promoter by Dorsal is dependent on the DPE and could fully be restored via a TATA box (n = 3). In all panels, error bars represent S.E.View Large Image Figure ViewerDownload Hi-res image Download (PPT)FIGURE 5.Transcription of the natural twist, leak, and brinker promoters is dependent on the DPE motif but could be restored via a TATA box using Drosophila embryo nuclear extracts, which contain transcription factors that are absent from Drosophila S2R+ cells. A, the natural enhancer-promoter constructs of twist, leak, and brinker containing either wt, mDPE, or mDPE + TATA motifs were subjected to in vitro transcription analysis with a Drosophila embryo nuclear extract. The resulting transcripts were detected by primer extension-reverse transcription analysis. B, unlike Dorsal and Caudal, Bicoid does activate the mDPE reporter and to some extent, also the mDPE+TATA brk reporter. Drosophila S2R+ cells were transfected with natural brinker promoters firefly luciferase reporter constructs containing wt (columns 1), mDPE (columns 2), or mDPE + TATA box promoter (columns 3), as well as expression vectors of either Dorsal, Bicoid, Caudal, or an empty vector, as indicated. To control for transfection efficiency variations, cells were co-transfected with a control Renilla luciferase reporter and assayed for dual luciferase. In both panels, n = 3 and error bars represent S.E.View Large Image Figure ViewerDownload Hi-res image Download (PPT)FIGURE 6.The core promoter is a key contributor to the transcriptional output. Drosophila S2R+ cells were transfected with firefly luciferase reporter constructs containing hybrid enhancer-promoters with either wt, mDPE, or MDPE + TATA core promoter, as well as varying amounts of a Dorsal expression plasmid, as indicated. To normalize for transfection efficiency, cells were co-transfected with a Pol III-Renilla luciferase control plasmid and assayed for dual luciferase activity. The activities are reported relative to the wild-type promoter in the absence of co-transfected Dorsal expression plasmid, which was defined to be 1. A schematic diagram of the hybrid genomic fragments is shown on top. A, transcriptional activation of the hybrid tinman enhancer-twist core promoter constructs by Dorsal (n = 3). B, the hybrid tinman enhancer-twist core promoter constructs containing either wt, mDPE, or mDPE + TATA motifs, were subjected to in vitro transcription analysis with a Drosophila embryo nuclear extract. The resulting transcripts were detected by primer extension-reverse transcription analysis.View Large Image Figure ViewerDownload Hi-res image Download (PPT)FIGURE 2.The DPE is functional in multiple Dorsal target genes. The wt and mDPE versions of the indicated core promoters (from −10 to +40 relative to the A + 1 start site) were subjected to in vitro transcription analysis with a Drosophila embryo nuclear extract. The resulting transcripts were detected by primer extension-reverse transcription analysis. The previously characterized Drosophila Antp P2 (Antennapedia downstream promoter) served as a control.View Large Image Figure ViewerDownload Hi-res image Download (PPT) pAcDorsal expression plasmid was kindly provided by Dr. Albert Courey (UCLA) For the construction of a Relish expression vector, the active N terminus of Relish (amino acids 1–532; not including the ankyrin repeat-containing inhibitory domain) (44.Dushay M.S. Asling B. Hultmark D. Origins of immunity: Rel" @default.
• W2034785524 created "2016-06-24" @default.
• W2034785524 creator A5020739453 @default.
• W2034785524 creator A5029113936 @default.
• W2034785524 creator A5076684808 @default.
• W2034785524 creator A5086160193 @default.
• W2034785524 date "2014-04-01" @default.
• W2034785524 modified "2023-10-17" @default.
• W2034785524 title "Core Promoter Functions in the Regulation of Gene Expression of Drosophila Dorsal Target Genes" @default.
• W2034785524 cites W1576291976 @default.
• W2034785524 cites W1604102349 @default.
• W2034785524 cites W1900422662 @default.
• W2034785524 cites W1968219928 @default.
• W2034785524 cites W1968993907 @default.
• W2034785524 cites W1972813594 @default.
• W2034785524 cites W1979028385 @default.
• W2034785524 cites W1980645953 @default.
• W2034785524 cites W1981391168 @default.
• W2034785524 cites W1984189354 @default.
• W2034785524 cites W1986683530 @default.
• W2034785524 cites W1988708102 @default.
• W2034785524 cites W1993470489 @default.
• W2034785524 cites W2000519009 @default.
• W2034785524 cites W2000572318 @default.
• W2034785524 cites W2003038417 @default.
• W2034785524 cites W2004548159 @default.
• W2034785524 cites W2005737641 @default.
• W2034785524 cites W2012418253 @default.
• W2034785524 cites W2025294830 @default.
• W2034785524 cites W2028381655 @default.
• W2034785524 cites W2033348165 @default.
• W2034785524 cites W2034719432 @default.
• W2034785524 cites W2036619779 @default.
• W2034785524 cites W2038010573 @default.
• W2034785524 cites W2041892053 @default.
• W2034785524 cites W2045362835 @default.
• W2034785524 cites W2047634049 @default.
• W2034785524 cites W2057692691 @default.
• W2034785524 cites W2058368054 @default.
• W2034785524 cites W2062856079 @default.
• W2034785524 cites W2066704768 @default.
• W2034785524 cites W2067116931 @default.
• W2034785524 cites W2073097315 @default.
• W2034785524 cites W2079124813 @default.
• W2034785524 cites W2083073732 @default.
• W2034785524 cites W2087202849 @default.
• W2034785524 cites W2095612833 @default.
• W2034785524 cites W2097140065 @default.
• W2034785524 cites W2097353028 @default.
• W2034785524 cites W2097469177 @default.
• W2034785524 cites W2097920884 @default.
• W2034785524 cites W2100860947 @default.
• W2034785524 cites W2100885642 @default.
• W2034785524 cites W2101079676 @default.
• W2034785524 cites W2101633713 @default.
• W2034785524 cites W2104467425 @default.
• W2034785524 cites W2108712717 @default.
• W2034785524 cites W2109412588 @default.
• W2034785524 cites W2111856168 @default.
• W2034785524 cites W2122535550 @default.
• W2034785524 cites W2124220434 @default.
• W2034785524 cites W2128937741 @default.
• W2034785524 cites W2129656350 @default.
• W2034785524 cites W2129838490 @default.
• W2034785524 cites W2130150170 @default.
• W2034785524 cites W2131918846 @default.
• W2034785524 cites W2133676917 @default.
• W2034785524 cites W2137670824 @default.
• W2034785524 cites W2140485864 @default.
• W2034785524 cites W2146975493 @default.
• W2034785524 cites W2147372875 @default.
• W2034785524 cites W2148944713 @default.
• W2034785524 cites W2151658462 @default.
• W2034785524 cites W2154854793 @default.
• W2034785524 cites W2165765830 @default.
• W2034785524 cites W2170698318 @default.
• W2034785524 doi "https://doi.org/10.1074/jbc.m114.550251" @default.
• W2034785524 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/4002106" @default.
• W2034785524 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/24634215" @default.
• W2034785524 hasPublicationYear "2014" @default.
• W2034785524 type Work @default.
• W2034785524 sameAs 2034785524 @default.
• W2034785524 citedByCount "28" @default.
• W2034785524 countsByYear W20347855242014 @default.
• W2034785524 countsByYear W20347855242015 @default.
• W2034785524 countsByYear W20347855242016 @default.
• W2034785524 countsByYear W20347855242017 @default.
• W2034785524 countsByYear W20347855242019 @default.
• W2034785524 countsByYear W20347855242020 @default.
• W2034785524 countsByYear W20347855242021 @default.
• W2034785524 countsByYear W20347855242023 @default.
• W2034785524 crossrefType "journal-article" @default.
• W2034785524 hasAuthorship W2034785524A5020739453 @default.
• W2034785524 hasAuthorship W2034785524A5029113936 @default.
• W2034785524 hasAuthorship W2034785524A5076684808 @default.
• W2034785524 hasAuthorship W2034785524A5086160193 @default.
• W2034785524 hasBestOaLocation W20347855241 @default.
• W2034785524 hasConcept C101762097 @default.

• next