FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2035279478> ?p ?o ?g. }

• W2035279478 endingPage "17237" @default.
• W2035279478 startingPage "17228" @default.
• W2035279478 abstract "A truncated naturally occurring variant of the human receptor P2X7 was identified in cancer cervical cells. The novel protein (P2X7-j), a polypeptide of 258 amino acids, lacks the entire intracellular carboxyl terminus, the second transmembrane domain, and the distal third of the extracellular loop of the full-length P2X7 receptor. The P2X7-j was expressed in the plasma membrane; it showed diminished ligand-binding and channel function capacities and failed to form pores and mediate apoptosis in response to treatment with the P2X7 receptor agonist benzoyl-ATP. The P2X7-j interacted with the full-length P2X7 in a manner suggesting heterooligomerization and blocked the P2X7-mediated actions. Interestingly, P2X7-j immunoreactivity and mRNA expression were similar in lysates of human cancer and normal cervical tissues, but fulllength P2X7 immunoreactivity and mRNA expression were higher in normal than in cancer tissues, and cancer tissues lacked 205-kDa P2X7 immunoreactivity suggesting lack of P2X7 homo(tri)-oligomerization. These results identify a novel P2X7 variant with apoptosis-inhibitory actions, and demonstrate a distinct regulatory property for a truncated variant to antagonize its full-length counterpart through hetero-oligomerization. This may represent a general paradigm for regulation of a protein function by its variant. A truncated naturally occurring variant of the human receptor P2X7 was identified in cancer cervical cells. The novel protein (P2X7-j), a polypeptide of 258 amino acids, lacks the entire intracellular carboxyl terminus, the second transmembrane domain, and the distal third of the extracellular loop of the full-length P2X7 receptor. The P2X7-j was expressed in the plasma membrane; it showed diminished ligand-binding and channel function capacities and failed to form pores and mediate apoptosis in response to treatment with the P2X7 receptor agonist benzoyl-ATP. The P2X7-j interacted with the full-length P2X7 in a manner suggesting heterooligomerization and blocked the P2X7-mediated actions. Interestingly, P2X7-j immunoreactivity and mRNA expression were similar in lysates of human cancer and normal cervical tissues, but fulllength P2X7 immunoreactivity and mRNA expression were higher in normal than in cancer tissues, and cancer tissues lacked 205-kDa P2X7 immunoreactivity suggesting lack of P2X7 homo(tri)-oligomerization. These results identify a novel P2X7 variant with apoptosis-inhibitory actions, and demonstrate a distinct regulatory property for a truncated variant to antagonize its full-length counterpart through hetero-oligomerization. This may represent a general paradigm for regulation of a protein function by its variant. The receptor P2X7 belongs to the P2X subfamily of P2 nucleotide receptors (1Buell G. Collo G. Rassendren F. Eur. J. Neurosci. 1996; 8: 2221-2228Crossref PubMed Scopus (241) Google Scholar, 2Soto F. Garcia-Guzman M. Stuhmer W. J. Membr. Biol. 1997; 160: 91-100Crossref PubMed Scopus (83) Google Scholar), which are membrane-bound, ligand-operated channels (3Dubyak G.R. el-Moatassim C. Am. J. Physiol. 1993; 265: C577-C606Crossref PubMed Google Scholar, 4Ralevic V. Burnstock G. Pharmacol. Rev. 1998; 50: 413-492PubMed Google Scholar, 5Khakh B.S. Burnstock G. Kennedy C. King B.F. North R.A. Seguela P. Voigt M. Humphrey P.P.A. Pharmacol. Rev. 2001; 53: 107-118PubMed Google Scholar). ATP is the naturally occurring ligand for the P2X7 and activation of the receptor by brief exposure to extracellular ATP opens cation channels that allow Ca2+, Na+, and K+ influx (6Surprenant A. Rassendren F. Kawashima E. North R.A. Buell G. Science. 1996; 272: 735-738Crossref PubMed Scopus (1507) Google Scholar). Longer exposure to ATP allows passage of cations with progressively larger diameters, up to 900 Da, through formation of pores (7Virginio C. MacKenzie A. North R.A. Surprenant A. J. Physiol. 1999; 519: 335-346Crossref PubMed Scopus (325) Google Scholar). The mechanism of pore formation is unclear, and opinions vary between decreased filter selectivity of existing channels (8Smart M.L. Panchal R.G. Bowser D.N. D. A. WilliamsPetrou S. Am. J. Physiol. 2002; 283: C77-C84Crossref PubMed Scopus (32) Google Scholar) to rearrangement of receptor molecules (9Kim M. Spelta V. Sim J. North R.A. Surprenant A. J. Biol. Chem. 2001; 276: 23262-23267Abstract Full Text Full Text PDF PubMed Scopus (95) Google Scholar). P2X7 receptors function in a cell-specific manner and effects of receptor activation are determined by receptor expression (10Guerra L. Denlinger C. Bertics P.J. Drug Dev. Res. 2001; 53: 91-99Crossref Scopus (24) Google Scholar), trafficking and plasma membrane localization (11Li G.H. Lee E.M. Blair D. Holding C. Poronnik P. Cook D.I. Barden J.A. Bennett M.R. J. Biol. Chem. 2000; 275: 29107-29112Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar, 12Bobanovic L.K. Royle S.J. Murrell-Lagnado R.D. J. Neurosci. 2002; 22: 4814-4824Crossref PubMed Google Scholar, 13Gu B.J. Zhang W.Y. Bendall L.J. Chessell I.P. Buell G.N. Wiley J.S. Am. J. Physiol. 2000; 279: C1189-C1197Crossref PubMed Google Scholar), oligomerization (5Khakh B.S. Burnstock G. Kennedy C. King B.F. North R.A. Seguela P. Voigt M. Humphrey P.P.A. Pharmacol. Rev. 2001; 53: 107-118PubMed Google Scholar), and post-activation internalization, recycling, and degradation (14Feng Y.H. Wang L. Wang Q. Li X. Zeng R. Gorodeski G.I. Am. J. Physiol. 2005; 288: C1342-C1356Crossref PubMed Scopus (57) Google Scholar). Expression of P2X7 can be regulated hormonally; in human cervical epithelial cells epinephrine down-regulates expression of the glycosylated form of the P2X7 and increases receptor degradation, and the effects can be potentiated by epidermal growth factor (15Wang L. Feng Y.H. Gorodeski G.I. Endocrinology. 2005; 146: 164-174Crossref PubMed Scopus (22) Google Scholar). Evidence for the physiological role of the P2X7 comes from studies of P2X7-deficient mice, indicating its role in inflammatory (16Solle M. Labasi J. Perregaux D.G. Stam E. Petrushova N. Koller B.H. Griffiths R.J. Gabel C.A. J. Biol. Chem. 2001; 276: 125-132Abstract Full Text Full Text PDF PubMed Scopus (780) Google Scholar) and immune processes (17Labasi J.M. Petrushova N. Donovan C. McCurdy S. Lira P. Payette M.M. Brissette W. Wicks J.R. Audoly L. Gabel C.A. J. Immunol. 2002; 168: 6436-6445Crossref PubMed Scopus (438) Google Scholar). Epithelial cells of the female lower reproductive tract express the P2X7 (18Bardini M. Lee H.Y. Burnstock G. Cell Tissue Res. 2000; 299: 105-113Crossref PubMed Scopus (43) Google Scholar), and in human cervical epithelial cells ligand binding induces apoptosis by a mechanism that involves pore formation, augmented calcium influx, and calcium-dependent activation of the apoptotic mitochondrial pathway (19Wang Q. Wang L. Feng Y.H. Li X. Zeng R. Gorodeski G.I. Am. J. Physiol. 2004; 287: C1349-C1358Crossref PubMed Scopus (106) Google Scholar, 20Wang Q. Li X. Wang L. Feng Y.H. Zeng R. Gorodeski G.I. Endocrinology. 2004; 145: 5568-5579Crossref PubMed Scopus (47) Google Scholar). Because human cervical epithelial cells secrete ATP into the extracellular milieu at concentrations that suffice to induce P2X7 pores (19Wang Q. Wang L. Feng Y.H. Li X. Zeng R. Gorodeski G.I. Am. J. Physiol. 2004; 287: C1349-C1358Crossref PubMed Scopus (106) Google Scholar), it was proposed that growth of cervical cells in vivo is controlled by autocrine-paracrine P2X7-mediated apoptosis (14Feng Y.H. Wang L. Wang Q. Li X. Zeng R. Gorodeski G.I. Am. J. Physiol. 2005; 288: C1342-C1356Crossref PubMed Scopus (57) Google Scholar, 15Wang L. Feng Y.H. Gorodeski G.I. Endocrinology. 2005; 146: 164-174Crossref PubMed Scopus (22) Google Scholar, 19Wang Q. Wang L. Feng Y.H. Li X. Zeng R. Gorodeski G.I. Am. J. Physiol. 2004; 287: C1349-C1358Crossref PubMed Scopus (106) Google Scholar, 20Wang Q. Li X. Wang L. Feng Y.H. Zeng R. Gorodeski G.I. Endocrinology. 2004; 145: 5568-5579Crossref PubMed Scopus (47) Google Scholar). Cervical neoplasia is a common disease in women. Although most cases are detected and managed at an early stage of development, an estimated 13,000 women progress to invasive cancer and about 4000 women die annually of the disease in the United States (21Saslow D. Runowicz C.D. Solomon D. Moscicki A.B. Smith R.A. Eyre H.J. Cohen C. CA Cancer J. Clin. 2002; 52: 342-362Crossref PubMed Scopus (809) Google Scholar). Until recently little was known about the role of the P2X7 system in human cancer cervical cells. ATP and the P2X7-specific agonist 2′,3′-O-(4-benzoylbenzoyl)-adenosine 5′-triphosphate (BzATP) 3The abbreviations used are: BzATP, 2′,3′-O-(4-benzoylbenzoyl)-adenosine 5′-triphosphate; MDCK, Madin-Darby canine kidney cells; HEK, human embryonic kidney; RT, reverse transcriptase; HA, hemagglutinin. can induce apoptosis in both normal and cancer cervical cells. However, the effects are greater in normal than in cancer cells (19Wang Q. Wang L. Feng Y.H. Li X. Zeng R. Gorodeski G.I. Am. J. Physiol. 2004; 287: C1349-C1358Crossref PubMed Scopus (106) Google Scholar), suggesting that cancer cervical cells have evolved mechanisms that protect them from P2X7-mediated apoptosis. Understanding these phenomena is important because mechanisms that block apoptosis could provide growth advantage to cells and enhance the growth of cancers. The present paper reports our discovery of a novel variant of the human P2X7 (P2X7-j) that lacks the entire intracellular carboxyl terminus, the second transmembrane domain, and the distal third of the extracellular loop of the P2X7. This variant was deficient in ligand binding, but interacted with the full-length P2X7 and blocked P2X7-mediated channel activity. Because pore formation depends on oligomerization of P2X7 molecules (22North R.A. Physiol. Rev. 2002; 82: 1013-1067Crossref PubMed Scopus (2474) Google Scholar), the present results suggest that the P2X7-j variant hetero-oligomerizes with the full-length P2X7 to form nonfunctional P2X7 oligomers that do not mediate P2X7-dependent apoptosis. Because in cancer cervical cells the P2X7-j is co-expressed with the wild-type P2X7 (present results), it is hypothesized that co-expression of the P2X7-j could lead to defective apoptosis and enhance the growth of the cancer cervical cells. Reagents, Cells, and Human Tissues—All chemicals, unless specified otherwise, were obtained from Sigma. The following types of cells were used (all from ATCC): human cervical epithelial cancer CaSki, HeLa, SiHa, and HT3 cells; MDCK (Madin-Darby canine kidney cells, strain II); and HEK293 (human embryonic kidney 293 cells). MDCK cells were cultured in minimal essential medium containing Earle's salts and supplemented with 5% fetal bovine serum, 100 units/ml penicillin, and 100 μg/ml streptomycin. Cell culture conditions for the other types of cells were described (19Wang Q. Wang L. Feng Y.H. Li X. Zeng R. Gorodeski G.I. Am. J. Physiol. 2004; 287: C1349-C1358Crossref PubMed Scopus (106) Google Scholar). Discarded human uterine cervical tissues from women undergoing hysterectomy for indications unrelated to the present study were obtained according to IRB protocols 12-03-50 and 03-90-300 from the Human Tissue Procurement Facility of University Hospitals of Cleveland and the Comprehensive Cancer Center Tissue Procurement Core Facility (CTPC), Case Western Reserve University, Cleveland, OH; and from the Cooperative Human Tissue Network (CHTN) (National Cancer Institute) through the Human Tissue Resource Network (HTRN), Department of Pathology at the Ohio State University, Columbus, OH. Upon removal, tissues were washed in cold saline, snap frozen in liquid N2, transferred in liquid N2, or shipped on dry ice to the laboratory and stored at -80 °C until assayed. The present experiments utilized a total of three histologically normal human uterine cervical tissues and three tissues designated histologically as squamous cell carcinomas of the cervix. The histological diagnoses were assigned by the Departments of Pathology at University Hospitals of Cleveland or at Ohio State University. All six tissues were from premenopausal women ages 44-49. For assays, cultured cells were lysed as described (14Feng Y.H. Wang L. Wang Q. Li X. Zeng R. Gorodeski G.I. Am. J. Physiol. 2005; 288: C1342-C1356Crossref PubMed Scopus (57) Google Scholar). Tissues (about 30 mg) were minced using mortar and pestle in liquid nitrogen, and lysed in ice-cold lysis buffer (phosphate-buffered saline plus 1% Triton X-100 and protease inhibitors (Halt Protease Inhibitor Mixture Kit, Pierce). Protein quantification was performed using the Bio-Rad Protein Assay (Bio-Rad). Samples were mixed with 2 × SDS sample buffer, boiled at 100 °C for 5 min, and stored at -80 °C. Molecular Biology Techniques and Transfections—Total RNA extracted from CaSki cells using the RNeasy Mini kit (Qiagen, Valencia, CA) was used for RT-PCR using the RT-PCR kit (Invitrogen Corp.) to amplify the human P2X7 gene (Ref. 23Buell G.N. Talabot F. Gos A. Lorenz J. Lai E. Morris M.A. Antonarakis S.E. Receptors Channels. 1998; 6: 347-354Google Scholar, GenBank™ accession number Y09561). Oligo(dT) primer was used for the RT reaction. A pair of P2X7 primers (BIOSOURCE, Camarillo, CA) of sense (TTTTTAAGCTTATGCCGGCCTGCTGCAGCTG) and antisense (TTTTTGCGGCCGCTCAGTAAGGACTCTTGAAGCC) were used for PCR amplification. The amplified P2X7 genes were subcloned into pcDNA5/FRT vector (Invitrogen) with HindIII and NotI sites. For inducible expression of P2X7 receptors in MDCK cells that lack endogenous expression of the receptors, P2X7 genes were subcloned into pcDNA4/TO vector (Invitrogen) with HindIII and NotI sites. A c-Myc tag was also attached to the NH2-terminal of the P2X7 genes with a new Myc-containing sense primer (TTTTAAGCTTATGGAACAAAAACTTATTTCTGAAGAAGATCTGCCGGCCTGCTGCAGCTGA) and the same antisense primer. For simultaneous heterologous expression of both the P2X7 and the P2X7-j in HEK293 cells, P2X7 and Myc-P2X7-j or Myc-P2X7 and P2X7-j DNAs were subcloned into pBud 4.1 plasmid (Invitrogen) with HindIII and NotI sites or XbaI and BglII sites, respectively. All genes were fully sequenced for both strands (Cleveland Genomics, Cleveland, OH). Transfections of P2X7 plasmid DNAs were performed using Gene-PORTER Transfection Reagent (GST Inc. San Diego, CA). For generation of stable MDCK cells, zeocin at 300 μg/ml was used. Stable clonal cells were maintained in minimal essential medium containing 5% tetracycline-free fetal bovine serum and 100 μg/ml zeocin. Inducibility of expression of P2X7 genes (Myc-P2X7 and Myc-P2X7-j) in the stable MDCK cells was confirmed by RT-PCR with sense primer (CTGTTCCTCTGACCGAGGTT) and antisense primer (TCCGTTTCTCAACATTGTTTTCC). The PCR products for the Myc-P2X7 and Myc-P2X7-j were 539 and 401 bp, respectively (Fig. 2). Expression of Myc-P2X7 and Myc-P2X7-j proteins in stable MDCK cells was induced by 100 ng/ml doxycycline. Stable HEK293 clonal cells were generated by transfection of P2X7 genes in pBud4.1 vector or pcDNA5/FRT vector in Flp-In™-293 cells (Invitrogen) and selection in the presence of 300 μg/ml zeocin or 500 μg/ml hygromycin, respectively. Transfections of P2X7 genes in pcDNA5/FRT vector were carried out in the presence of pOG44 plasmid (Invitrogen) following the manufacturers instruction. The expression of P2X7 genes in both stable MDCK and stable HEK293 cells was confirmed by immunocytochemistry and Western blotting. The hygromycin-inducible HEK293 cells expressing the full-length P2X7 were kindly provided by Dr. George Dubyak, Case Western Reserve University. Stable HEK293 clones were maintained in the presence of 100 μg/ml zeocin, 500 μg/ml hygromycin, or both. Real time PCR assays utilized SYBR Green PCR master mixture machine with ABI 7500 Real-time PCR SDS software (Applied Biosystems, Foster City, CA) and experiments were carried out according to the manufacturer's instructions. Primers were as follows: full-length P2X7: forward, ATACAGTTTCCGTCGCCTTG; reverse, AACGGATCCCGAAGACTTTT. The truncated P2X7 variant P2X7-j: forward, TTTCAGATGTGGCAATTCAGATA, reverse, AAGTAGGAGAGGGTTGAGCC; glyceraldehyde-3-phosphate dehydrogenase: forward, CAATGACCCCTTCATTGACC; reverse, GACAAGCTTCCCGTTCTCAG. The reaction mixture was composed of 0.5 μl of primers (5 μm), 9 μl of diluted cDNA, and 10 μl of SYBR Green PCR master mixture. PCR conditions were 50 °C for 2 min, 95 °C for 10 min, 40 cycles of 15 s at 95 °C, and 60 °C for 1 min. Results were calculated using the comparative threshold cycle (Ct) method of relative quantitation (RQ). Protein Methods—Western blots were carried out on post-nuclear supernatant of cell lysates (14Feng Y.H. Wang L. Wang Q. Li X. Zeng R. Gorodeski G.I. Am. J. Physiol. 2005; 288: C1342-C1356Crossref PubMed Scopus (57) Google Scholar), and total proteins were quantified using the Bio-Rad Protein Assay (Bio-Rad). Samples were mixed with 2 × SDS sample buffer and boiled at 100 °C for 5 min. Fractionation of cultured cells was done using the Proteo-Extract Subcellular Proteome Extraction kit (EMD Biosciences, Inc., San Diego, CA) according to the manufacturer's instructions. Aliquots of cell lysates (normalized to 15 μg of protein) were separated in SDS-polyacrylamide 6-10% gels by gel electrophoresis (PAGE) and blotted by Western analysis. Receptor polypeptides were visualized using 1.5 μg/ml of primary antibodies. The rabbit polyclonal anti-P2X7 antibody (Alomone Labs, Jerusalem, Israel) recognizes the stretch of 12 amino acids (KKGWMDPSKGIQTGRC) from 136 to 152 of the mouse P2X7 receptor. Rabbit monoclonal anti-Myc antibody was from Santa Cruz Biotechnology (Santa Cruz, CA). The anti-tubulin antibody (hybridoma supernatant, clone E7, generated with the antigen of β-tubulin-galactosidase/ftz fusion protein) was from the Developmental Studies Hybridoma Bank, University of Iowa (Iowa City, IA), and was used at 1:500 dilution. Anti-rabbit peroxidase-conjugated secondary antibody was used for visualization (ECL kit, Santa Cruz Biotechnology, Santa Cruz CA). Co-immunoprecipitation, immunostaining, light microscopy, and confocal laser scanning microscopy were described (14Feng Y.H. Wang L. Wang Q. Li X. Zeng R. Gorodeski G.I. Am. J. Physiol. 2005; 288: C1342-C1356Crossref PubMed Scopus (57) Google Scholar). Cell Number, Cell Cycle, Flow Cytometry, and Apoptosis Assays—Cell number was evaluated using the CyQUANY cell proliferation assay kit (Molecular Probes, Eugene, OR) according to the manufacturer's instructions. For cell cycle analysis cells were synchronized by culturing in 10% fetal bovine serum, Dulbecco's modified Eagle's medium overnight and serum starvation in Dulbecco's modified Eagle's medium for 6 h. Cells were shifted to 10% fetal bovine serum, Dulbecco's modified Eagle's medium containing 1:500 defined keratinocyte growth factors from bovine pituitary extract (Invitrogen) for 18 h, and treated with 100 μm BzATP (or the vehicle) for 8 h. Harvested cells were washed with phosphate-buffered saline and fixed with 100% methanol at -20 °C overnight. Following treatment with 20 μg/ml RNase, the cells were stained with 50 μg/ml propidium iodide. Aliquots of 5 × 104 cells were analyzed for DNA content by flow cytometry using Beckman Epics XL-MCL. Apoptosis was quantified using Roche Cell Death Detection ELISA Kit (Roche Applied Science) according to the manufacturer's instructions. Briefly, cells plated in 96-multiwell plates at 104 cells/well and maintained overnight in 10% serum-enriched medium were serumstarved for 6 h in the absence or presence of added BzATP. At the completion of incubation the medium was removed, spun, and the pellet stored. The cells together with the stored pellet were lysed with the provided lysis buffer, and the mixture was spun at 200 × g for 10 min at room temperature. An aliquot from the supernatant, containing the cytoplasmic fraction of oligonucleosomes was added to a streptavidincoated multiplate and mixed with pre-prepared reaction reagent containing the anti-histone-biotin and anti-DNA-POD antibodies. After a 2-h incubation on a shaker at room temperature the solution was collected and mixed with 2,2′-azino-bis(3-ethylbenziazolin-6-sulfonic acid) solution at room temperature for 15 min. Absorbance was measured at 405 nm against blank, and the degree of apoptosis was determined in reference to the control/standard provided in the kit. Dynamic Confocal Laser Scanning Microscopy—We used a described method (24Tagliarino C. Pink J.J. Dubyak G.R. Nieminen A.L. Boothman D.A. J. Biol. Chem. 2001; 276: 19150-19159Abstract Full Text Full Text PDF PubMed Scopus (141) Google Scholar) with minor modifications. Briefly, cells were seeded at 2-3 × 105 on 35-mm glass bottom Petri dishes (MatTek Corp., Ashland, MA), and allowed to reach confluence. Cells were loaded with 5 μm Fluo-4/AM (Molecular Probes) in 0.1% bovine serum albumin, Ringer's solution for 20 min at 37 °C, rinsed twice with Ringer's solution, and incubated for additional 20 min at 37 °C. Cells were imaged with a Zeiss LSM 510 inverted real time confocal microscope equipped with a ×20 water immersion objective at room temperature (Comprehensive Cancer Center Microscopy Facility of Case Western Reserve University). Images were collected at 488/505 nm (excitation/emission) before and after treatment with 100 μm BzATP, added to both the luminal and subluminal perfusates, at intervals of 10 to 15 s afterward. For ethidium bromide influx experiments, cells cultured on glass-bottomed dishes were loaded onto the microscope. Images (collected at 488/505 nm (excitation/emission)) were taken before, and at intervals of 30 s after adding 5 μm ethidium bromide to both the luminal and subluminal perfusates. Average fluorescence intensity was quantified from collated images using MetaVue software (Fryer Company Inc., Huntley, IL) by subtracting the basal intensity value. Densitometry—Densitometry was done using a AGFA Arcus II scanner (AGFA, New York) and Un-Scan-It gel automated digital software (Silk Scientific, Orem, UT). Statistical Analysis—Data are presented as mean ± S.D. and significance of differences among means was estimated by Student's t test. Trends were analyzed by analysis of variance. Cloning and Expression of the Truncated P2X7 Variant P2X7-j—A PCR product (∼1652 bp) of smaller size than the expected full-length P2X7 (∼1789 bp) was identified in RT-PCR experiments trying to amplify the full-length P2X7 gene (data not shown). DNA sequencing and gene analysis of the 1652-bp PCR product revealed an identical P2X7 gene that lacks the putative exon 8 except the A882, with a shift of coding frame to a new variant (Fig. 1A). As a result, the gene product becomes a truncated variant of only 258 amino acids (compared with 595 of the full-length P2X7) with 10 altered unique residues at the COOH-terminal (Fig. 1B). The predicted sequence of this variant lacks the entire carboxyl cytoplasmic domain, the second transmembrane domain, and the distal third of the extracellular domain of the full-length P2X7 (Fig. 1B, lower panel). We named this newly discovered variant as P2X7-j because previous studies identified splice variants isoforms designated P2X7-b-P2X7-h (Ref. 25Cheewatrakoolpong B. Gilchrest H. Anthes J.C. Greenfeder S. Biochem. Biophys. Res. Commun. 2005; 332: 17-27Crossref PubMed Scopus (155) Google Scholar, accession numbers AY847 (298-304)), and a truncated P2X7 variant 2 (149 residues) (Ref. 26Georgiou J.G. Skarratt K.K. Fuller S.J. Martin C.J. Christopherson R.I. Wiley J.S. Sluyter R. J. Investig. Dermatol. 2005; 125: 482-490Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar, accession number NM177427). The sequence of our novel P2X7-j variant has been deposited in the GenBank (accession number DQ399293). Blast search of available gene data base showed that this variant has not been reported before. To determine the translational product of the P2X7-j gene, the P2X7-j cDNA was subcloned into various expression vectors as described under “Materials and Methods,” and was introduced into MDCK and HEK293 cells by transfection. MDCK cells, in contrast to the HEK293 cells form sheets of cells with typical epithelial characteristics. Stable lines of MDCK and HEK293 cells expressing the P2X7-j were successfully generated, and the expression of P2X7-j was confirmed at both the mRNA level by RT-PCR (Fig. 2A) and the protein level by Western blots (Fig. 2, A-E). Specific bands at 75 kDa for the full-length P2X7 proteins and 45-42 kDa for the P2X7-j proteins expressed in MDCK cells were visualized with both anti-Myc antibodies and anti-P2X7 antibodies (Fig. 2, B-D). Similar patterns of expression of the P2X7 and the P2X7-j proteins were also observed in HEK293 cells (Fig. 2, E and F). To determine whether the P2X7-j gene is also naturally translated into protein, CaSki cells expressing P2X7-j mRNA were examined by Western blot with anti-P2X7 antibody. Fig. 2G shows two main specific forms at 75 and 42 kDa that can be blocked by the P2X7 antigen. The 75-kDa form is most likely the full-length P2X7 (14Feng Y.H. Wang L. Wang Q. Li X. Zeng R. Gorodeski G.I. Am. J. Physiol. 2005; 288: C1342-C1356Crossref PubMed Scopus (57) Google Scholar, 15Wang L. Feng Y.H. Gorodeski G.I. Endocrinology. 2005; 146: 164-174Crossref PubMed Scopus (22) Google Scholar). The 42-kDa is likely the P2X7-j because the sizes of heterologously expressed P2X7-j in MDCK cells (Fig. 2, B-D) and HEK293 cells (Fig. 2, E and F) were also 42 kDa. The presence of the P2X7-j variant (45-42 kDa) was confirmed also in the human cancer cervical cell lines HT3, SiHa, and HeLa (Fig. 2H). Collectively, these data suggest that the P2X7-j is a naturally occurring P2X7 variant. Cellular Localization of the P2X7-j—In MDCK cells and HEK293 cells, both the 75-kDa P2X7 and the 45-42-kDa forms were present predominantly in the plasma-membrane fraction. Small amounts of the 75-kDa P2X7 were detected also in the cytosol, nuclear, and cytoskeletal fractions (Fig. 3). Interestingly, a significant amount of the 45-42-kDa form was also detected in the nuclear fraction. These findings are supported by the results obtained using laser confocal microscopy (Fig. 3C), which also show that some of the P2X7-j localizes in nuclear/perinuclear regions of the HEK293 cells. Deficient Induction of Apoptosis and Activation of Pore Formation—In cervical cells an important function of the full-length P2X7 is induction of apoptosis (19Wang Q. Wang L. Feng Y.H. Li X. Zeng R. Gorodeski G.I. Am. J. Physiol. 2004; 287: C1349-C1358Crossref PubMed Scopus (106) Google Scholar). To examine whether the P2X7-j preserves this action, the cell number, cell cycle, and direct apoptosis assays were performed using both MDCK and HEK293 cells. In MDCK cells, Inducible expression of P2X7 alone, but not P2X7-j alone resulted in a significant decrease in cell numbers (∼25%, Fig. 4A). A similar effect was observed in HEK293 cells where induced expression of the P2X7 alone, but not the P2X7-j, decreased cell number by about 35% compared with mock HEK293 cells (Fig. 4A). In contrast, P2X7-j expressing cells, in particular HEK293 cells, showed an increase in cell number (by about 35%, Fig. 4A). Cell cycle assays in MDCK and HEK293 cells showed that expression of the full-length P2X7 induced a 2-4-fold increase of cells in the sub-G1 phase. Treatment with BzATP augmented the effect (Fig. 4B) in P2X7-expressing HEK293, suggesting increased apoptosis. In contrast, expression of the P2X7-j altered only little the percent of cells in the sub-G1 phase as compared with control cells (Fig. 4B). Direct apoptosis assays in MDCK and HEK293 cells showed that expression of the P2X7 increased apoptosis by about 2-fold, and treatment with BzATP augmented the effect (Fig. 4C). In contrast, expression of the P2X7-j resulted in no change in baseline or in BzATP-induced apoptosis (Fig. 4C). In HEK293 cells, co-expression of the P2X7-j blocked P2X7-mediated apoptosis (Fig. 4C). In cervical cells, P2X7-mediated apoptosis requires formation of pores (19Wang Q. Wang L. Feng Y.H. Li X. Zeng R. Gorodeski G.I. Am. J. Physiol. 2004; 287: C1349-C1358Crossref PubMed Scopus (106) Google Scholar, 20Wang Q. Li X. Wang L. Feng Y.H. Zeng R. Gorodeski G.I. Endocrinology. 2004; 145: 5568-5579Crossref PubMed Scopus (47) Google Scholar). The failure of P2X7-j-expressing cells to undergo apoptosis could be the result of the inability of the P2X7-j to effectively activate pore formation. As expected, in both MDCK and HEK293 cells stimulation of P2X7-j with BzATP induced only a negligible influx of ethidium bromide compared with effects in cells expressing the P2X7 (Fig. 5A), suggesting deficient pore formation. In HEK293 cells, co-expression of the P2X7-j inhibited by about 80% the P2X7-mediated influx of ethidium bromide in the presence of BzATP (Fig. 5A). Deficient BzATP-induced Acute Ca2+ Influx—An early event of P2X7 receptor activation is the acute channel opening that precedes, and possibly mediates P2X7 pore formation (22North R.A. Physiol. Rev. 2002; 82: 1013-1067Crossref PubMed Scopus (2474) Google Scholar). MDCK and HEK293 cells expressing P2X7 or P2X7-j were loaded with the Ca2+-sensitive dye Fluo-4 and examined using dynamic confocal laser scanning microscopy in the absence and presence of BzATP. In P2X7-expressing cells BzATP induced an acute transient increase in cytosolic calcium (Fig. 5B). The BzATP effects could be blocked by pre-treatment with 1.2 mm EGTA (to chelate extracellular calcium) (data not shown), indicating that the acute increase in cytosolic calcium is the result of calcium influx. In P2X7-j-expressing cells BzATP induced a significantly smaller increase in cytosolic Ca2+ (Fig. 5B). In P2X7-expressing HEK293 cells, co-expression of the P2X7-j inhibited the BzATP-induced increase in cytosolic Ca2+ to levels seen in cells expressing P2X7-j alone (Fi" @default.
• W2035279478 created "2016-06-24" @default.
• W2035279478 creator A5020897634 @default.
• W2035279478 creator A5022526821 @default.
• W2035279478 creator A5046796483 @default.
• W2035279478 creator A5048497773 @default.
• W2035279478 creator A5059764431 @default.
• W2035279478 date "2006-06-01" @default.
• W2035279478 modified "2023-10-18" @default.
• W2035279478 title "A Truncated P2X7 Receptor Variant (P2X7-j) Endogenously Expressed in Cervical Cancer Cells Antagonizes the Full-length P2X7 Receptor through Hetero-oligomerization" @default.
• W2035279478 cites W1481135965 @default.
• W2035279478 cites W1815757713 @default.
• W2035279478 cites W1830561018 @default.
• W2035279478 cites W1964755615 @default.
• W2035279478 cites W1977740770 @default.
• W2035279478 cites W1986901277 @default.
• W2035279478 cites W2003060921 @default.
• W2035279478 cites W2012510435 @default.
• W2035279478 cites W2014057738 @default.
• W2035279478 cites W2017849325 @default.
• W2035279478 cites W2018934217 @default.
• W2035279478 cites W2023506303 @default.
• W2035279478 cites W2024039709 @default.
• W2035279478 cites W2024463179 @default.
• W2035279478 cites W2025242478 @default.
• W2035279478 cites W2045131720 @default.
• W2035279478 cites W2046292099 @default.
• W2035279478 cites W2047876133 @default.
• W2035279478 cites W2048584025 @default.
• W2035279478 cites W2051271802 @default.
• W2035279478 cites W2052389548 @default.
• W2035279478 cites W2059770344 @default.
• W2035279478 cites W2061688009 @default.
• W2035279478 cites W2065632159 @default.
• W2035279478 cites W2066784771 @default.
• W2035279478 cites W2073927517 @default.
• W2035279478 cites W2084383502 @default.
• W2035279478 cites W2105685878 @default.
• W2035279478 cites W2106417317 @default.
• W2035279478 cites W2109961396 @default.
• W2035279478 cites W2111178472 @default.
• W2035279478 cites W2112671639 @default.
• W2035279478 cites W2122574609 @default.
• W2035279478 cites W2126106112 @default.
• W2035279478 cites W2126695278 @default.
• W2035279478 cites W2129347483 @default.
• W2035279478 cites W2132958789 @default.
• W2035279478 cites W2136134177 @default.
• W2035279478 cites W2136828475 @default.
• W2035279478 cites W2139683239 @default.
• W2035279478 cites W2139775312 @default.
• W2035279478 cites W2151516998 @default.
• W2035279478 cites W2156346381 @default.
• W2035279478 cites W2158974109 @default.
• W2035279478 cites W2160604649 @default.
• W2035279478 cites W2163529793 @default.
• W2035279478 cites W2182174465 @default.
• W2035279478 cites W2248033023 @default.
• W2035279478 cites W2333209163 @default.
• W2035279478 cites W4236243797 @default.
• W2035279478 doi "https://doi.org/10.1074/jbc.m602999200" @default.
• W2035279478 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/2409001" @default.
• W2035279478 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16624800" @default.
• W2035279478 hasPublicationYear "2006" @default.
• W2035279478 type Work @default.
• W2035279478 sameAs 2035279478 @default.
• W2035279478 citedByCount "134" @default.
• W2035279478 countsByYear W20352794782012 @default.
• W2035279478 countsByYear W20352794782013 @default.
• W2035279478 countsByYear W20352794782014 @default.
• W2035279478 countsByYear W20352794782015 @default.
• W2035279478 countsByYear W20352794782016 @default.
• W2035279478 countsByYear W20352794782017 @default.
• W2035279478 countsByYear W20352794782018 @default.
• W2035279478 countsByYear W20352794782019 @default.
• W2035279478 countsByYear W20352794782020 @default.
• W2035279478 countsByYear W20352794782021 @default.
• W2035279478 countsByYear W20352794782022 @default.
• W2035279478 countsByYear W20352794782023 @default.
• W2035279478 crossrefType "journal-article" @default.
• W2035279478 hasAuthorship W2035279478A5020897634 @default.
• W2035279478 hasAuthorship W2035279478A5022526821 @default.
• W2035279478 hasAuthorship W2035279478A5046796483 @default.
• W2035279478 hasAuthorship W2035279478A5048497773 @default.
• W2035279478 hasAuthorship W2035279478A5059764431 @default.
• W2035279478 hasBestOaLocation W20352794781 @default.
• W2035279478 hasConcept C121608353 @default.
• W2035279478 hasConcept C153911025 @default.
• W2035279478 hasConcept C170493617 @default.
• W2035279478 hasConcept C185592680 @default.
• W2035279478 hasConcept C2778220009 @default.
• W2035279478 hasConcept C502942594 @default.
• W2035279478 hasConcept C54355233 @default.
• W2035279478 hasConcept C86803240 @default.
• W2035279478 hasConcept C95444343 @default.
• W2035279478 hasConcept C96232424 @default.
• W2035279478 hasConceptScore W2035279478C121608353 @default.
• W2035279478 hasConceptScore W2035279478C153911025 @default.

• next