SemOpenAlex |

SemOpenAlex

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2035306523> ?p ?o ?g. }

Showing items 1 to 89 of 89 with 100 items per page.

W2035306523 endingPage "30471" @default.
W2035306523 startingPage "30466" @default.
W2035306523 abstract "We identified new, potentially unstable loci in the human genome containing 5′-(CGG)n-3′ trinucleotide repeats by screening a human subgenomic library as well as a chromosome 16 library with a 5′-(CGG)17-3′ oligodeoxyribonucleotide probe. Five different clones were isolated, two from the chromosome 16 library and three from the subgenomic library. Determinations of the nucleotide sequences have revealed that the E7 clone displayed, in addition to the 5′-(CGG)n-3′ trinucleotide repeat, a 5′-(CAG)n-3′ and a 5′-(CCT)n-3′ trinucleotide repeat. Two clones, CL16-1 and P5-5, had homologies to known genes, the human casein kinase II α′ subunit (chromosome 16) and the human calcium-activated potassium channel (chromosome 10), respectively. Clones E7 and P4 were assigned to chromosome 6, whereas CL16-8 mapped to chromosome 16. Their potential coding capacities were assessed by RNA transfer (Northern blotting) experiments. Four different transcripts were identified by using the E7 clones as hybridization probes, three of them being brain-specific. The P4 clone was expressed in placenta and skeletal muscle. Minor polymorphisms within the repeats were observed in normal and in fragile X individuals. Lung and colon carcinoma cell lines in which some microsatellites were shown to be unstable were also investigated. Expansions of the 5′-(CGG)n-3′ repeats were not found. We identified new, potentially unstable loci in the human genome containing 5′-(CGG)n-3′ trinucleotide repeats by screening a human subgenomic library as well as a chromosome 16 library with a 5′-(CGG)17-3′ oligodeoxyribonucleotide probe. Five different clones were isolated, two from the chromosome 16 library and three from the subgenomic library. Determinations of the nucleotide sequences have revealed that the E7 clone displayed, in addition to the 5′-(CGG)n-3′ trinucleotide repeat, a 5′-(CAG)n-3′ and a 5′-(CCT)n-3′ trinucleotide repeat. Two clones, CL16-1 and P5-5, had homologies to known genes, the human casein kinase II α′ subunit (chromosome 16) and the human calcium-activated potassium channel (chromosome 10), respectively. Clones E7 and P4 were assigned to chromosome 6, whereas CL16-8 mapped to chromosome 16. Their potential coding capacities were assessed by RNA transfer (Northern blotting) experiments. Four different transcripts were identified by using the E7 clones as hybridization probes, three of them being brain-specific. The P4 clone was expressed in placenta and skeletal muscle. Minor polymorphisms within the repeats were observed in normal and in fragile X individuals. Lung and colon carcinoma cell lines in which some microsatellites were shown to be unstable were also investigated. Expansions of the 5′-(CGG)n-3′ repeats were not found. polymerase chain reaction Expressed Sequence Tag bacterial artificial chromosome kilobase(s) base pair(s) simple tandem repeats. Fragile sites can be classified into two major groups, rare and common ones. Among the rare fragile sites, at least 19 are folate-sensitive. So far, five folate-sensitive fragile sites have been characterized at the molecular level: FRAXA, FRAXE, FRAXF, FRA16A, and FRA11B. They are associated with an expansion of 5′-(CGG)n-3′ trinucleotide repeats, with three of them being linked to clinical phenotypes. Whereas expansion at the FRAXA locus results in the fragile X syndrome, expansion at the FRAXE locus leads to mild mental retardation, and the FRA11B locus can be involved in the Jacobsen syndrome. The amplified FRA16A and FRAXF loci are not linked to known phenotypes, and genes have not yet been found near these fragile sites. Several severe human diseases have been associated with the expansion of naturally occurring triplet repeats in the human genome (for recent reviews, see Refs. 1Ashley Jr., C.T. Warren S.T. Annu. Rev. Genet. 1995; 29: 703-728Crossref PubMed Scopus (370) Google Scholar, 2Warren S.T. Science. 1996; 271: 1374-1375Crossref PubMed Scopus (147) Google Scholar, 3Koshy B.T. Zoghbi H.Y. Brain Pathol. 1997; 7: 927-942Crossref PubMed Scopus (102) Google Scholar, 4La Spada A.R. Brain Pathol. 1997; 7: 943-963Crossref PubMed Scopus (73) Google Scholar, 5Reddy P.S. Housman D.E. Curr. Opin. Cell Biol. 1997; 9: 364-372Crossref PubMed Scopus (173) Google Scholar). The cause of these instabilities in human DNA has remained unknown. In eight different loci, a 5′-(CAG)n-3′ repeat as part of the coding region of genes can be amplified and cause a lengthening of a normal polyglutamine sequence. Severe neurological disorders, spinal and bulbar muscular atrophy, spinocerebellar ataxia types 1, 2, 6, and 7, Huntington disease, dentatorubral-pallidoluysian atrophy (Haw River syndrome), and Machado-Joseph disease (spinocerebellar ataxia type 3) are associated with the expansion of polyglutamine tracts. In Friedreich's ataxia, the only disease in this group with an autosomal recessive inheritance pattern, a 5′-(GAA)n-3′ repeat is expanded in the first intron of the X25 gene (6Campuzano V. Montermini L. Moltò M.D. Pianese L. Cossée M. Cavalcanti F. Monros E. Rodius F. Duclos F. Monticelli A. Zara F. Cañizares J. Koutnikova H. Bidichandani S.I. Gellera C. Brice A. Trouillas P. De Michele G. Filla A. De Frutos R. Palau F. Patel P.I. Di Donato S. Mandel J.-L. Cocozza S. Koenig M. Pandolfo M. Science. 1996; 271: 1423-1427Crossref PubMed Scopus (2284) Google Scholar). Surprisingly, in myotonic dystrophy, the expanded 5′-(CTG)n-3′ repeat lies in the 3′-untranslated region, allegedly affecting the structure of the 3′-region of the messenger RNA (7Buxton J. Shelbourne P. Davies J. Jones C. Van Tongeren T. Aslanidis C. de Jong P. Jansen G. Anvret M. Riley B. Williamson R. Johnson K. Nature. 1992; 355: 547-548Crossref PubMed Scopus (567) Google Scholar, 8Fu Y.H. Pizzuti A. Fenwick Jr., R.G. King J. Rajnarayan S. Dunne P.W. Dubel J. Nasser G.A. Ashizawa T. de Jong P. Wieringa B. Korneluk R. Perryman M.B. Epstein H.F. Caskey C.T. Science. 1992; 255: 1256-1258Crossref PubMed Scopus (1273) Google Scholar). But the same region also constitutes the 5′ segment of the myotonic dystrophy-associated homeobox gene (9Thornton C.A. Wymer J.P. Simmons Z. McClan C. Moxly III R.T. Nat. Genet. 1997; 16: 407-409Crossref PubMed Scopus (195) Google Scholar, 10Klesert T.R. Otten A.D. Bird T.D. Tapscott J. Nat. Genet. 1997; 16: 402-406Crossref PubMed Scopus (220) Google Scholar). The fragile X syndrome has been the first disease to be linked to a fragile site in the human genome. The FRAXA fragile site on the X chromosome in location A can be elicited by culturing the cells in a medium devoid of folic acid and thymidine (for reviews, see Refs. 11Sutherland G.R. Genet. Anal. Tech. Appl. 1991; 8: 161-166Crossref PubMed Scopus (64) Google Scholarand 12Sutherland G.R. Richards R.I. Curr. Opin. Genet. Dev. 1995; 5: 323-327Crossref PubMed Scopus (94) Google Scholar). By now, in excess of 100 fragile sites have been identified in the human genome, their recognition being dependent on the addition of specific chemicals to the culture medium, such as 5-bromo-deoxyuridine, thymidine, distamycin A, aphidicolin, 5-azacytidine, and others. Most of these fragile sites exhibit no genetic phenotype, e.g.those at chromosomes XF (FRAXF) or 16A (FRA16A). The fragile sites FRAXA at Xq27.3 or FRAXE at Xq28 are linked to varying degrees of mental retardation. At several of the fragile sites in the human genome, expansions of naturally occurring 5′-(CGG)n-3′ repeats have been documented. The pathologically expanded repeats and adjacent nucleotide sequences can become de novo5′-(CG)-3′-methylated (13Oberlé I. Rousseau F. Heitz D. Kretz C. Devys D. Hanauer A. Boue J. Bertheas M.F. Mandel J.-L. Science. 1991; 252: 1097-1102Crossref PubMed Scopus (1307) Google Scholar). In the FRAXA syndrome, typically presenting with severe mental retardation, facial dysmorphologies, macroorchidism, and joint hyperextensibility, the 5′-(CGG)n-3′ repeat amplification is located in the 5′-untranslated region and promoter regions of theFMR1 gene. The 5′-(CG)-3′ methylation is associated with the inactivation of the FMR1 promoter. In a few cases, this methylation has been absent despite a marked 5′-(CGG)n-3′ expansion, theFMR1 gene continued to be expressed, and the probands with the full expansion have failed to exhibit the FRAXA phenotype (14Oostra B.A. Acta Genet. Med. Gemellol. (Roma). 1996; 45: 93-108Crossref PubMed Scopus (10) Google Scholar). Recent results of genomic sequencing experiments in the FMR1repeat region indicate that methylation mosaics exist in healthy and some fragile X individuals. 1B. Genç, H. Müller-Hartmann, M. Zeschnigk, H. Deissler, B. Schmitz, F. Majewski, A. von Gontard, and W. Doerfler, submitted for publication. 1B. Genç, H. Müller-Hartmann, M. Zeschnigk, H. Deissler, B. Schmitz, F. Majewski, A. von Gontard, and W. Doerfler, submitted for publication. We have initiated a search for regions in the human genome with 5′-(CGG)n-3′ repeats. Because most of the previously isolated 5′-(CGG)n-3′ repeat-containing fragments are located in noncoding regions, genomic libraries were screened with a32P-labeled 5′-(CGG)17-3′ oligodeoxyribonucleotide. We report here the isolation of new genomic sequences containing 5′-(CGG)n-3′ repeats, mostly from the 5′-upstream segments of gene-rich regions. The cell lines KB (human oral carcinoma), HeLa (human cervix carcinoma), 293 (adenovirus type 5-transformed human embryonic kidney cells), HEp-2 (human epidermoid larynx carcinoma), Hep G2 (human hepatocellular carcinoma), A549 (human lung carcinoma), LoVo and SW480 (human colon carcinomas), and A172 and U138 (human glioblastoma cell lines) were cultivated in Dulbecco's medium containing 10% fetal calf serum. DNA was prepared from peripheral blood as described (16Behn-Krappa A. Hölker I. Sandaradura da Silva U. Doerfler W. Genomics. 1991; 11: 1-7Crossref PubMed Scopus (30) Google Scholar). RNA was isolated from cultured cells according to published protocols (17Glisin V. Crkvenjakov R. Buys C. Biochemistry. 1974; 13: 2633-2637Crossref PubMed Scopus (1550) Google Scholar, 18Ullrich A. Shine J. Chirgwin J. Pictet R. Tischer E. Rutter W.J. Goodman H.M. Science. 1977; 196: 1313-1319Crossref PubMed Scopus (829) Google Scholar). Restriction enzyme cleavage, gel electrophoresis, 32P-labeling of hybridization probes, hybridization and autoradiography were carried out as described (19Koetsier P.A. Schorr J. Doerfler W. BioTechniques. 1993; 15: 260-262PubMed Google Scholar,20Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). For Southern transfer (21Southern E.M. J. Mol. Biol. 1975; 98: 503-517Crossref PubMed Scopus (21440) Google Scholar) and Northern transfer experiments, a downward blotting protocol was used (19Koetsier P.A. Schorr J. Doerfler W. BioTechniques. 1993; 15: 260-262PubMed Google Scholar). The filter with the human somatic cell hybrid panel was obtained from Oncor. The human RNA master blot and the human multiple tissue Northern blot were purchased fromCLONTECH. All hybridization steps were performed using the prehybridization and hybridization solutions described elsewhere (19Koetsier P.A. Schorr J. Doerfler W. BioTechniques. 1993; 15: 260-262PubMed Google Scholar). In hybridization experiments with the RNA master blot, 40 μg of Cot-1 DNA and 50 μg of herring sperm DNA were added to the labeled probe before hybridization. All DNA-RNA hybridizations were carried out at 65 °C. A 4–8 kilobase pair size-selected fraction of human genomic DNA cleaved withEcoRI was isolated by velocity sedimentation on a sucrose density gradient and ligated into the EcoRI-precleaved ZAP express or ZAP II vector (Stratagene), packaged, and screened according to the manufacturer's protocol. The filters were hybridized as described (19Koetsier P.A. Schorr J. Doerfler W. BioTechniques. 1993; 15: 260-262PubMed Google Scholar). A total of 104 colonies of a human chromosome 16-specific library (22Colins C. Kuo W.L. Segraves R. Fuscoe J. Pinkel D. Gray J.W. Genomics. 1991; 11: 997-1006Crossref PubMed Scopus (225) Google Scholar) were screened as follows. Oriented filters were incubated for 5 min in 2 × SSC (1 × SSC is 0.15 m NaCl, 15 mm sodium citrate) and 5% SDS and dried for 2 min in a microwave oven at full power. The hybridization was carried out overnight at 68 °C in 5 × SSC, 1% sarkosyl. The posthybridization washes were twice for 10 min in 2 × SSC, 0.5% sarkosyl followed by twice 10 min in 0.5 × SSC, 0.5% sarkosyl. The probe used in all screening experiments was a32P-end-labeled 5′-(CGG)17-3′ oligodeoxyribonucleotide. The template DNAs were from seven fragile X full-expansion patients or from healthy individuals. The primers used in the PCRs were synthesized at Life Technology, Inc. (5′ → 3′): P4 locus (P1, CGGAATTCCAGCTCGGGGTCTCTCCGCCGCCCC; P2, AAGCAGTGAACTGCGGCGGCTTCGC); E7 locus (P9, CAACCACAAACTGAAAACCGTTGG; P10, CCATGTTGCGGCTGCTCCATGTCG); (P11 CGAGCACCCAAGCTTGGGCGCCC; P12 CTCAGCACCCGGTACCCCGCGGAC); (P13 CCGCCAGGCCTCGCCACGCCGC; P14 GGTTGGGTACCAGCCCCGTCTCCATGG); (P15C GCCGGCCAGAACCAGCACCG; P16C GTTGCGCGGCCGCCCAGGCC). Amounts of 200 to 400 ng of genomic DNA were amplified in 50 μl of 1 × Pfu of polymerase buffer (20 mm Tris-HCl, pH 8.8, 2 mmMgSO4, 10 mm KCl, 10 mm(NH4)2SO4, 0.1% Triton X-100, 100 μg of nuclease-free bovine serum albumin/ml) (Stratagene), 10% Me2SO, 200 mm each dNTP, 100 to 200 ng of primers, and 2.5 to 5 units of cloned Pfu polymerase. In the P13/P14 reaction, a dGTP:7-deaza-dGTP ratio of 1:3 was used. Conditions for PCR were 1 cycle for 5 min at 96 °C, 25 cycles for 2 min at 95 °C, 30 s at 65 °C (in the P9/P10 reaction annealing was at 61 °C), and for 2 to 2.3 min at 72 °C. One-tenth of the PCR products was analyzed by electrophoresis on a 2% agarose gel. The specificities of PCR products were ascertained by Southern blot hybridization using a 32P-end-labeled 5′-(CGG)8-3′ probe. A subset of PCR products from reactions P1/P2, P9/P10, and P11/P12 with DNA from three fragile X patients and from five normal individuals was used for cloning. PCR products from the primer set P1/P2 were cleaved with EcoRI and NotI and cloned in EcoRI/NotI precleaved pBluescript KS+. The PCR products from the primer set P9/P10 were cut with AciI and cloned intoAccI-precleaved pBluescript KS+. PCR products from the primer set P11/P12 were directly cloned into the PCRscript vector from Stratagene. Single clones were used to determine nucleotide sequences. Plasmid DNAs were sequenced with a Taq fluorescent dideoxy terminator cycle sequencing kit (Applied Biosystems). The University of Wisconsin Genetics Computer Group (UWGCG) package versions 9.0 and 9.1 were used for sequence analyses such as homology search and restriction mapping. Expressed sequence-tagged (EST) and bacterial artificial chromosome (BAC) clones were obtained from Genome Systems Inc. Human peripheral blood cells from the buffy coat layer were grown for 72 h in RPMI 1640 medium supplemented with 10% fetal calf serum enriched with 26 μg of phytohemagglutinin/ml of medium. The cells were then arrested in metaphase by incubation at 37 °C for 2 h with 10 μg of ethidium bromide and 50 ng of Colcemid/ml. The chromosome harvesting, hybridization, and detection procedures were as described (23Lichter P. Tang C.-J. Call K. Hermanson G. Evans G.A. Hausman D. Ward D.C. Science. 1990; 247: 64-69Crossref PubMed Scopus (1329) Google Scholar). The BAC clones were labeled by nick translation with biotin-16-dUTP, and the chromosome 6-specific probe 6q27 (Oncor) was digoxygenin-labeled. Undesirable cross-hybridizations with the labeled BAC probe was suppressed by adding 20 μg of human Cot1 DNA to the hybridization mixture, which was incubated for 10 min at 37 °C before adding the mixture to the chromosome preparation. The chromosomal DNA was counterstained with propidium iodide or 4′, 6-diamidino-2-phenylindole when two different probes had to be detected. A subgenomic library was constructed by ligating EcoRI-cleaved genomic DNA from human white blood cells into the Zap express and Zap II λ vectors as described under “Experimental Procedures.” In addition, chromosome-specific libraries (22Colins C. Kuo W.L. Segraves R. Fuscoe J. Pinkel D. Gray J.W. Genomics. 1991; 11: 997-1006Crossref PubMed Scopus (225) Google Scholar) were screened, and we began to isolate positive clones from the chromosome 16 library, since the DNA on this chromosome had already shown expansions in the 5′-(CGG)n-3′-containing region of the locus FRA16A at 16p13.11 in some individuals (24Nancarrow J.K. Kremer E. Holman K. Eyre H. Doggett N.A. Le Paslier D. Callen D.F. Sutherland G.R. Richards R.I. Science. 1994; 264: 1938-1941Crossref PubMed Scopus (134) Google Scholar, 25Nancarrow J.K. Holman K. Mangelsdorf M. Hori T. Denton M. Sutherland G.R. Richards R.I. Hum. Mol. Genet. 1995; 4: 367-372Crossref PubMed Scopus (34) Google Scholar). All the clones isolated so far are schematically presented in Fig. 1. The total lengths of the nucleotide sequences and the nature and locations of the 5′-(CGG)n-3′ repeats actually detected in each of the cloned DNA segments are also indicated. In addition to the 5′-(CGG)n-3′ repeats, repeats with different sequences were also present in two of these DNA segments. The actual nucleotide sequences were not reproduced here. They are available via accession numbers AJ001215, AJ001216, AJ001217, AJ001218, and AJ001219 from the EMBL data base for clones P4, E7, P5-5, CL16-1, and CL16-8, respectively. Table I summarizes the homologies found among the individual DNA sequences in the GenBank using the Blast program.Table IHomologies of the isolated human DNA segments to previously determined nucleotide sequencesClonesHomology toReferencesCL16–1Human casein kinase II α′ subunit mapped on 16p13.2-p13.3, HSA1CKII26Lozeman F.J. Litchfield D.W. Piening C. Takio K. Walsh K.A. Krebs E.G. Biochemistry. 1990; 29: 8436-8447Crossref PubMed Scopus (126) Google Scholar27Yang-Feng T. Naiman T. Kopatz I. Eli D. Dafni N. Canaani D. Genomics. 1994; 9: 173Crossref Scopus (22) Google ScholarP5–5Human calcium-activated potassium channel mapped on 10q22.328Tseng-Crank J. Foster C.D. Krause J.D. Mertz R. Godinot N. DiChiara T.J. Reinhart P.H. Neuron. 1994; 13: 1315-1330Abstract Full Text PDF PubMed Scopus (383) Google Scholar29McCobb D.P. Fowler N.L. Featherstone T. Lingle C.J. Saito M. Krause J.E. Salkoff L. Am. J. Physiol. 1995; 269: H767-H777Crossref PubMed Google ScholarE7DAN 15 EMBL: Y0826630Imbert G. Saudou F. Yvert G. Devys D. Trottier Y. Gernier J.-M. Weber C. Mandel J.-L. Cancel G. Abbas N. Dürr A. Didierjean O. Stevanin G. Agid Y. Brice A. Nat. Genet. 1996; 14: 185-191Crossref PubMed Scopus (772) Google ScholarEST1 g1186169P4EST g1364621CL16–8None Open table in a new tab The isolated human DNA segments with 5′-(CGG)n-3′ repeats have been mapped to specific locations on the human chromosomes (i) by hybridization to a somatic cell hybrid panel (Oncor), (ii) by fluorescent in situ hybridization of the biotinylated BAC clones to human chromosome spreads (Fig. 2), and (iii) by hybridization to radiation hybrid panels (31Walter M.A. Spillett D.J. Thomas P. Weissenbach J. Goodfellow P.N. Nat. Genet. 1994; 7: 22-28Crossref PubMed Scopus (353) Google Scholar). The CL16-1 and the CL16-8 clones were confirmed to be derived from human chromosome 16, and the P5-5 clone was located on chromosome 10 (data not shown). The mapping results of the CL16-1 and P5-5 clones were in line with the locations of their homologous sequences (Table I). The E7 and P4 clones mapped to chromosome 6q. The E7 genomic fragment mapped to 6q25-26 (Fig. 2 a) and the P4 segment to 6q22-23 (Fig. 2 b). The clone P4 has been more precisely assigned to a chromosomal location by radiation hybrid mapping that has been performed at the Sanger Center in Cambridge, UK. The P4 clone is closely linked to the marker stSG11083, which lies between markers D6S1004 and D6S1620 on the long arm of chromosome 6 at position 510.7 cR3000 of the Sanger Center's radiation hybrid map (data not shown). The 32P-labeled subfragments of the clones were hybridized to a multiple tissue Northern blot (CLONTECH), to a Master blot (CLONTECH), or to a Northern blot on which poly(A)-selected RNAs from different tumor cell lines were immobilized. The human DNA segment in clone P4 was transcribed in skeletal muscle into RNAs of 5.1, 3.3, 2.8, and 1.8 kb and in placenta into RNA of 2.8-kb lengths (Fig. 3 a). This apparently tissue-specific 2.8-kb RNA was also present in the human tumor cell lines A172, 293, A549, KB, HeLa, and Hep2 (Fig. 3 b). In all the tissues tested, the DNA segment in the E7 clone was transcribed into a 5-kb RNA molecule (Fig. 4, a and b). None of the tested tumor cell lines expressed this segment. The brain-specific transcripts, detected by theEcoRI-EcoRI fragment as hybridization probe were 9.6, 4.8, and 3.8 kb in lengths (Fig. 4 c). The 5-kb transcript present in all tested tissues (Fig. 4 b) was not detected with the EcoRI-EcoRI fragment of E7 in Fig. 4 c. To assess the extent of this brain-specific expression, we probed a master blot carrying dot-blotted poly(A) RNAs from 50 different human tissues (Fig. 4 d). Transcripts were mainly found in different parts of the brain, with a stronger signal in cerebellum. Significant expression was also seen in some glandular tissues like the pituitary gland (D4), the thymus (E5), and to a lesser extent in the thyroid (D6) and the adrenal gland (D5), as well as in fetal brain, kidney, and thymus (Fig. 4 c). Transcription analyses were not conducted for the CL16-1 and P5-5 clones. However, the CL16-8 clone did not allow the detection of RNA molecules by hybridization to the multiple tissue Northern or the master blot. We next searched for polymorphisms within the repeats in the DNA loci E7, P4, and CL16-8 from healthy individuals. The possibility existed that in fragile X patients 5′-(CGG)n-3′ repeats outside the bona fide location on Xq27.3 would also become subject to expansions. Therefore, DNAs from several full expansion fragile X patients were analyzed. Southern blotting experiments did not reveal abnormal mobility of the corresponding P4 (Fig. 5, a–c), E7 (Fig. 5,d–f), or CL16-8 bands (data not shown) in normal individuals (Fig. 5, a and d) or in fragile X individuals (Fig. 5, b and e). Minor variations in the repeat-containing regions were assessed by PCR using primers indicated in the scheme of each clone (see maps in Fig. 1, aand b). Changes in sizes could not be detected in the tested DNAs. Because the trinucleotide repeats observed were cryptic and complex, we cloned some of the PCR products from P4 and regions R2 plus R3 of the E7 DNA segment in a suitable vector to sequence individual clones, as described under “Experimental Procedures.” Only minor polymorphisms were observed in region R2 of the E7 locus in healthy and fragile X individuals (Table II). The control PCR products from the E7 plasmid remained constant throughout the cloning procedure. It is concluded that the 5′-(CGG)n-3′ repeats in various segments of the human genome outside the Xq27.3 locus are not expanded in fragile X patients. The P4 and E7 loci are not markedly polymorphic.Table IIThe various alleles of the E7 repeat R2 observed in normal individual (N2) and in full expansion fragile X individual (RF)R2 Consensus(CTT)4(CGG)8N2(CTT)3(CCG)8(CCT)4(CCG)7(CCT)4(CCG)8RF(CCT)4(CCG)7(CCT)4(CCG)8The relevant part of R2 is reproduced here; the sequences were analyzed after sequencing the single clones. The 10 isolated clones from the plasmid control E7 did not show any variations. Open table in a new tab The relevant part of R2 is reproduced here; the sequences were analyzed after sequencing the single clones. The 10 isolated clones from the plasmid control E7 did not show any variations. Because of the differences in expression of the E7 and P4 DNA segments between different human tissues and human tumor-derived cell lines, we decided to analyze repeats in the DNAs from these cell lines as well as from two colon carcinoma cell lines, RER(−) SW480 and RER(+) LoVo. The latter is known to exhibit (CA)nmicrosatellite instabilities. Analyses of the DNAs from these tumor cell lines by Southern blotting (Fig. 5, c and f) or by PCR experiments (data not shown) did not reveal any major rearrangements in either locus. Therefore, the observed differential expression (loss of tissue specificity) could be attributed to alterations of DNA methylation in the P4 region. However, some deletions occurring upstream and/or downstream the 6170-bp E7 fragment and/or mutations in the E7 sequence could still be responsible for the complete absence of E7 expression in tumor cell lines. In several human genomic DNA fragments we have identified 5′-(CGG)n-3′ repeats located 5′ to the previously identified cDNA sequences of the genes for the Ca2+-activated potassium channel and the casein kinase II α′ subunit. These repeats might play a role in the regulation or altered functions of the corresponding proteins. The human Ca2+-activated potassium channel (Kca) proteins are a large and diverse family of ion channels. All the different isoforms of the Kca are generated by alternative splicing of a single gene mapped on 10q22.3 (28Tseng-Crank J. Foster C.D. Krause J.D. Mertz R. Godinot N. DiChiara T.J. Reinhart P.H. Neuron. 1994; 13: 1315-1330Abstract Full Text PDF PubMed Scopus (383) Google Scholar, 29McCobb D.P. Fowler N.L. Featherstone T. Lingle C.J. Saito M. Krause J.E. Salkoff L. Am. J. Physiol. 1995; 269: H767-H777Crossref PubMed Google Scholar). Although the expression of the Kca is widely distributed, the highest levels of expression are found in brain, aorta, and skeletal muscle (28Tseng-Crank J. Foster C.D. Krause J.D. Mertz R. Godinot N. DiChiara T.J. Reinhart P.H. Neuron. 1994; 13: 1315-1330Abstract Full Text PDF PubMed Scopus (383) Google Scholar). So far, only the different cDNA sequences of the gene were reported. The genomic clone P5-5 isolated here contains the 5′ region of the different spliced mRNA molecules, and only a part of the complete 5′-(GCC)n-3′-rich region is included in the different transcripts reported. Clone CL16-1 is a genomic DNA fragment comprising the 5′ region of the casein kinase II α′ subunit (CSNK2A2). This enzyme is known to have three possible isoforms α2β2, αα′β2, and α′2β2. The α and α′ polypeptides are the catalytic subunits. The α′ cDNA can detect several mRNAs in Northern blot experiments (26Lozeman F.J. Litchfield D.W. Piening C. Takio K. Walsh K.A. Krebs E.G. Biochemistry. 1990; 29: 8436-8447Crossref PubMed Scopus (126) Google Scholar). Alterations of the repeat-rich region located 5′ to the CSNK2A2 gene might play a role in the regulation of different levels of mRNAs. In the case of spinocerebellar ataxia 6, the gene had been known for a long time before it could be assigned to a disease (32Matsuyama Z. Kawakami H. Maruyama H. Izumi Y. Komure A. Udaka F. Kameyama M. Nishio T. Kuroda Y. Nishimura M. Nakamura S. Hum. Mol. Genet. 1997; 6: 1283-1287Crossref PubMed Scopus (143) Google Scholar, 33Riess O. Schöls L. Böttger H. Nolte D. Menezes Vieira-Saecker A.M. Schimming C. Kreuz F. Macek Jr., M. Krebsová A. Macek M. Sen Klockgether T. Zühlke C. Laccone F.A. Hum. Mol. Genet. 1997; 6: 1289-1293Crossref PubMed Scopus (118) Google Scholar, 34Zhuchenko O. Bailey J. Bonnen P. Ashizawa T. Stockton D.W. Amos C. Dobyns W.B. Subramony S.H. Zoghbi H.Y. Lee C.C. Nat. Genet. 1997; 15: 62-69Crossref PubMed Scopus (1424) Google Scholar). Interestingly, the human DNA segments investigated here exhibit a combination of several types of repeats, CGG, CAG, CCT, GGA, and GAG. Within a 1.8-kb fragment, the DNA segment E7 clone carries most of the identified repeat sequences. So far, none of the new 5′-(CGG)n-3′ repeat-containing segments have been found expanded in fragile X patients, nor are these repeats highly polymorphic in the tested healthy individuals. The instability observed at the expanded FRAXA locus in fragile X patients is most likely not the result of a widespread instability in the genome but rather confined to this single locus. A similar conclusion has been reached by Goellner et al. (35Goellner G.M. Tester D. Thibodeau S. Almqvist E. Goldberg Y.P. Hayden M.R. McMurray C.T. Am. J. Hum. Genet. 1997; 60: 879-890PubMed Google Scholar) on the instabilities within simple tandem repeats (STR) at 10 loci in 29 Huntington disease families that have been compared with instabilities at the same loci in 29 colon cancer patients with defects in mismatch repair enzymes. The hypothesis that secondary structures adopted by CAG, CGG, or GAA repeats in the trinucleotide repeat diseases might mediate instability is supported by the work of Gacy et al. (36Gacy A.M. Goellner G.M. Spiro C. Chen X. Gupta G. Bradbury E.M. Dyer R.B. Mikesell M.J. Yao J.Z. Johnson A.J. Richter A. Melancon S.B. McMurray C.T. Mol. Cell. 1998; 1: 583-593Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar). This group has suggested that the improper DNA structure at the repeat region is responsible for GAA instability in Friedreich's ataxia. The tissue-specific transcription displayed by the P4 DNA segment is apparently erased in the tumor cell lines. In only one of the two glioblastoma cell lines, the 2.8-kb transcript has been identified. The location of the P4 clone, 6q22-23, and its strong muscle expression renders it a possible candidate gene for muscular dystrophy. Indeed it maps close to some other genes also expressed in muscle,e.g. lamA2 and lamA4. ThelamA2 gene is involved in merosin-deficient congenital muscular dystrophy (37Naom I.S. D'Allessandro M. Topaloglu H. Sewry C. Ferlini A. Helbling-Leclerc A. Guicheney P. Weissenbach J. Schwartz K. Bushby K. Philpot J. Dubowitz V. Muntoni F. J. Med. Genet. 1997; 34: 99-104Crossref PubMed Google Scholar). Surprisingly, the 5-kb transcripts ubiquitous in many tissues were absent in all tumor cell lines tested. Could this region be involved in the process of tumorigenesis because of its location at 6q25-26? Several authors reported that the telomeric part of the long arm of chromosome 6 might contain tumor suppressor genes (15Banga S.S. Kim S.-H. Hubbard K. Dasgupta T. Jha K.K. Patsalis P. Hauptschein R. Gamberi B. Dalla-Favera R. Kraemer P. Ozer H.L. Oncogene. 1997; 14: 313-321Crossref PubMed Scopus (60) Google Scholar, 38Parsa N.Z. Gaidano G. Mukherjee A.B. Hauptschein R.S. Lenoir G. Dalla-Favera R. Chaganti R.S. Genes Chromosomes Cancer. 1994; 9: 13-18Crossref PubMed Scopus (33) Google Scholar, 39Saito S. Sirahama S. Matsushima M. Suzuki M. Sagae S. Kudo R. Saito J. Noda K. Nakamura Y. Cancer Res. 1996; 56: 5586-5589PubMed Google Scholar). The region R3 with its 5′-(CAG)n-3′ triplet repeat and region R4 of the E7 locus were transcribed. The EST1 clone, which is homologous to the E7 region detecting the brain-specific transcripts, was only 1,283 nucleotide pairs long. The sequence available in the data base from the DAN15 clone is 575 bp long. By isolating the full-length cDNA of both genes, one might be able to identify the location of the 5′-(CGG)n-3′ and other repeats. The E7 DNA fragment maps to 6q25-26, is repeat-rich, and expressed specifically in brain. We are very grateful to Andy Mungall from the Sanger Center, Cambridge, UK for help with the chromosome 6 detailed mapping. We thank Helmut Deissler, Institute of Cell Biology, University of Essen, Essen, Germany, for cell lines SW480 and LoVo. We also thank Petra Böhm for expert editorial work." @default.
W2035306523 created "2016-06-24" @default.
W2035306523 creator A5020094417 @default.
W2035306523 creator A5027016488 @default.
W2035306523 creator A5029170230 @default.
W2035306523 creator A5084088045 @default.
W2035306523 date "1998-11-01" @default.
W2035306523 modified "2023-09-29" @default.
W2035306523 title "New 5′-(CGG) -3′ Repeats in the Human Genome" @default.
W2035306523 cites W1500052390 @default.
W2035306523 cites W1965798133 @default.
W2035306523 cites W1971507786 @default.
W2035306523 cites W1972704271 @default.
W2035306523 cites W1986223011 @default.
W2035306523 cites W1989619236 @default.
W2035306523 cites W1991231381 @default.
W2035306523 cites W2001698040 @default.
W2035306523 cites W2007373568 @default.
W2035306523 cites W2024973560 @default.
W2035306523 cites W2038220637 @default.
W2035306523 cites W2043522420 @default.
W2035306523 cites W2051013729 @default.
W2035306523 cites W2054184368 @default.
W2035306523 cites W2063113059 @default.
W2035306523 cites W2063450941 @default.
W2035306523 cites W2064551580 @default.
W2035306523 cites W2069003894 @default.
W2035306523 cites W2072952476 @default.
W2035306523 cites W2075843233 @default.
W2035306523 cites W2076892293 @default.
W2035306523 cites W2077114056 @default.
W2035306523 cites W2082772297 @default.
W2035306523 cites W2084106399 @default.
W2035306523 cites W2085534162 @default.
W2035306523 cites W2100065191 @default.
W2035306523 cites W2107240963 @default.
W2035306523 cites W2125492442 @default.
W2035306523 cites W2158155007 @default.
W2035306523 cites W2159880072 @default.
W2035306523 cites W2160284605 @default.
W2035306523 cites W2166301043 @default.
W2035306523 cites W2329710350 @default.
W2035306523 cites W2397430633 @default.
W2035306523 doi "https://doi.org/10.1074/jbc.273.46.30466" @default.
W2035306523 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9804814" @default.
W2035306523 hasPublicationYear "1998" @default.
W2035306523 type Work @default.
W2035306523 sameAs 2035306523 @default.
W2035306523 citedByCount "9" @default.
W2035306523 countsByYear W20353065232014 @default.
W2035306523 crossrefType "journal-article" @default.
W2035306523 hasAuthorship W2035306523A5020094417 @default.
W2035306523 hasAuthorship W2035306523A5027016488 @default.
W2035306523 hasAuthorship W2035306523A5029170230 @default.
W2035306523 hasAuthorship W2035306523A5084088045 @default.
W2035306523 hasBestOaLocation W20353065231 @default.
W2035306523 hasConcept C104317684 @default.
W2035306523 hasConcept C141231307 @default.
W2035306523 hasConcept C197077220 @default.
W2035306523 hasConcept C54355233 @default.
W2035306523 hasConcept C70721500 @default.
W2035306523 hasConcept C86803240 @default.
W2035306523 hasConceptScore W2035306523C104317684 @default.
W2035306523 hasConceptScore W2035306523C141231307 @default.
W2035306523 hasConceptScore W2035306523C197077220 @default.
W2035306523 hasConceptScore W2035306523C54355233 @default.
W2035306523 hasConceptScore W2035306523C70721500 @default.
W2035306523 hasConceptScore W2035306523C86803240 @default.
W2035306523 hasIssue "46" @default.
W2035306523 hasLocation W20353065231 @default.
W2035306523 hasOpenAccess W2035306523 @default.
W2035306523 hasPrimaryLocation W20353065231 @default.
W2035306523 hasRelatedWork W1988981743 @default.
W2035306523 hasRelatedWork W2024439539 @default.
W2035306523 hasRelatedWork W2057998009 @default.
W2035306523 hasRelatedWork W2102304447 @default.
W2035306523 hasRelatedWork W2105376545 @default.
W2035306523 hasRelatedWork W2138245520 @default.
W2035306523 hasRelatedWork W2161955640 @default.
W2035306523 hasRelatedWork W2419284744 @default.
W2035306523 hasRelatedWork W2435512095 @default.
W2035306523 hasRelatedWork W2944602870 @default.
W2035306523 hasVolume "273" @default.
W2035306523 isParatext "false" @default.
W2035306523 isRetracted "false" @default.
W2035306523 magId "2035306523" @default.
W2035306523 workType "article" @default.