FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2035807710> ?p ?o ?g. }

• W2035807710 endingPage "3898" @default.
• W2035807710 startingPage "3889" @default.
• W2035807710 abstract "A major role of the multifunctional human Ape1 protein is to incise at apurinic/apyrimidinic (AP) sites in DNA via site-specific endonuclease activity. This nuclease function has been well characterized on double-stranded (ds) DNA substrates, where the complementary strand provides a template for subsequent base excision repair events. Recently, Ape1 was found to incise efficiently at AP sites positioned within the single-stranded (ss) regions of various biologically relevant DNA configurations. The studies within indicated that the ss endonuclease activity of Ape1 is poorly active on ss AP site-containing polyadenine or polythymine oligonucleotides, suggesting a requirement for some form of DNA secondary structure for efficient cleavage. Computational, footprinting, and biochemical analyses indicated that the nature of the secondary structure and the proximity of the AP site influence Ape1 incision efficiency significantly. Replication protein A (RPA), the major ssDNA-binding protein in mammalian cells, was found to bind ss AP-DNA with similar affinity as unmodified ssDNA and ds AP-DNA with lower affinity. Consistent with their known relative DNA binding affinities, RPA blocks/inhibits the ss, but not ds, AP endonuclease function of Ape1. Moreover, RPA inactivates Ape1 incision activity at an AP site within the ss region of a fork duplex, but not a transcription-like bubble intermediate. The data herein suggested a model whereby RPA selectively suppresses the nontemplated ss cleavage activity of Ape1 in vivo, particularly at sites of ongoing replication/recombination, by coating the ssDNA. A major role of the multifunctional human Ape1 protein is to incise at apurinic/apyrimidinic (AP) sites in DNA via site-specific endonuclease activity. This nuclease function has been well characterized on double-stranded (ds) DNA substrates, where the complementary strand provides a template for subsequent base excision repair events. Recently, Ape1 was found to incise efficiently at AP sites positioned within the single-stranded (ss) regions of various biologically relevant DNA configurations. The studies within indicated that the ss endonuclease activity of Ape1 is poorly active on ss AP site-containing polyadenine or polythymine oligonucleotides, suggesting a requirement for some form of DNA secondary structure for efficient cleavage. Computational, footprinting, and biochemical analyses indicated that the nature of the secondary structure and the proximity of the AP site influence Ape1 incision efficiency significantly. Replication protein A (RPA), the major ssDNA-binding protein in mammalian cells, was found to bind ss AP-DNA with similar affinity as unmodified ssDNA and ds AP-DNA with lower affinity. Consistent with their known relative DNA binding affinities, RPA blocks/inhibits the ss, but not ds, AP endonuclease function of Ape1. Moreover, RPA inactivates Ape1 incision activity at an AP site within the ss region of a fork duplex, but not a transcription-like bubble intermediate. The data herein suggested a model whereby RPA selectively suppresses the nontemplated ss cleavage activity of Ape1 in vivo, particularly at sites of ongoing replication/recombination, by coating the ssDNA. Apurinic/apyrimidinic (AP) 2The abbreviations used are: AP, apurinic/apyrimidinic; ds, double-stranded; ss, single-stranded; RPA, replication protein A; nt, nucleotide; MOPS, 4-morpholinepropanesulfonic acid; EMSA, electrophoretic mobility shift assay; endo, endonuclease; BER, base excision repair; DMS, dimethyl sulfate. endonuclease 1 (Ape1) is the major mammalian repair protein for abasic sites in DNA (1.Wilson III, D.M. Barsky D. Mutat. Res. 2001; 485: 283-307Crossref PubMed Scopus (341) Google Scholar). This enzyme catalyzes incision of the phosphodiester backbone immediately 5′ to an AP lesion, initiating a cascade of events that involves components of the base excision repair (BER) pathway and aims to remove the abasic residue and re-establish genetic integrity (2.Fortini P. Pascucci B. Parlanti E. D'Errico M. Simonelli V. Dogliotti E. Biochimie (Paris). 2003; 85: 1053-1071Crossref PubMed Scopus (176) Google Scholar). Abasic sites are common products in DNA, arising either spontaneously (at a rate of 10,000 events per mammalian genome per day), via accelerated base release because of chemical modification, or through enzyme (glycosylase)-catalyzed removal of a damaged base (3.Lindahl T. Nature. 1993; 362: 709-715Crossref PubMed Scopus (4378) Google Scholar, 4.Stivers J.T. Jiang Y.L. Chem. Rev. 2003; 103: 2729-2759Crossref PubMed Scopus (397) Google Scholar). If unrepaired, AP lesions present mutagenic and cytotoxic challenges to the cell (5.Loeb L.A. Preston B.D. Annu. Rev. Genet. 1986; 20: 201-230Crossref PubMed Scopus (860) Google Scholar). Deficiencies in Ape1 activity in mice have been associated with increased spontaneous mutation frequencies in both somatic and germ line cells (6.Huamani J. McMahan C.A. Herbert D.C. Reddick R. McCarrey J.R. MacInnes M.I. Chen D.J. Walter C.A. Mol. Cell. Biol. 2004; 24: 8145-8153Crossref PubMed Scopus (65) Google Scholar), as well as increased cancer susceptibility and reduced survival in the face of exogenous oxidizing agents (7.Meira L.B. Devaraj S. Kisby G.E. Burns D.K. Daniel R.L. Hammer R.E. Grundy S. Jialal I. Friedberg E.C. Cancer Res. 2001; 61: 5552-5557PubMed Google Scholar). It is noteworthy that, although uncommon, human Ape1 protein variants with reduced function have been identified (8.Hadi M.Z. Coleman M.A. Fidelis K. Mohrenweiser H.W. Wilson III, D.M. Nucleic Acids Res. 2000; 28: 3871-3879Crossref PubMed Scopus (222) Google Scholar). It is generally accepted that Ape1 is the predominant AP site incision enzyme in mammals, accounting for >95% (if not all) of the total cellular AP endonuclease activity (9.Demple B. Harrison L. Annu. Rev. Biochem. 1994; 63: 915-948Crossref PubMed Scopus (1300) Google Scholar). In fact, recent evidence argues that its AP endonuclease function is essential for cell viability (10.Fung H. Demple B. Mol. Cell. 2005; 17: 463-470Abstract Full Text Full Text PDF PubMed Scopus (236) Google Scholar, 11.Izumi T. Brown D.B. Naidu C.V. Bhakat K.K. MacInnes M.A. Saito H. Chen D.J. Mitra S. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 5739-5743Crossref PubMed Scopus (187) Google Scholar). For many years, this activity had been characterized on double-stranded (ds) AP-DNA substrates (12.Barzilay G. Mol C.D. Robson C.N. Walker L.J. Cunningham R.P. Tainer J.A. Hickson I.D. Nat. Struct. Biol. 1995; 2: 561-568Crossref PubMed Scopus (121) Google Scholar, 13.Wilson III, D.M. Takeshita M. Grollman A.P. Demple B. J. Biol. Chem. 1995; 270 (and references therein): 16002-16007Abstract Full Text Full Text PDF PubMed Scopus (245) Google Scholar, 14.Strauss P.R. Beard W.A. Patterson T.A. Wilson S.H. J. Biol. Chem. 1997; 272: 1302-1307Abstract Full Text Full Text PDF PubMed Scopus (141) Google Scholar), as it was presumed that a successful BER event would take place exclusively on a template-containing (instructional) duplex DNA molecule. Recently, however, it was shown that Ape1 exhibits a robust endonuclease activity at AP sites in single-stranded (ss) oligonucleotides, in some instances greater than in dsDNA, as well as in several complex and biologically relevant ss structures, such as primer-template duplexes, bubble conformations, and fork-like arrangements (15.Marenstein D.R. Wilson III, D.M. Teebor G.W. DNA Repair (Amst.). 2004; 3: 527-533Crossref PubMed Scopus (64) Google Scholar, 16.Wilson III, D.M. J. Mol. Biol. 2005; 345 (and references therein): 1003-1014Crossref PubMed Scopus (45) Google Scholar). Presently, little is known about how these more “exotic” activities of Ape1 are modulated or how the resulting incision products are handled by the cell. Replication protein A (RPA) is the most abundant ssDNA-binding protein in mammalian cells, present at roughly 100,000 molecules per cell (17.Wold M.S. Annu. Rev. Biochem. 1997; 66: 61-92Crossref PubMed Scopus (1188) Google Scholar). This heterotrimeric complex was originally identified as an essential component of simian virus (SV40) DNA replication in vitro (18.Wobbe C.R. Weissbach L. Borowiec J.A. Dean F.B. Murakami Y. Bullock P. Hurwitz J. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 1834-1838Crossref PubMed Scopus (259) Google Scholar, 19.Wold M.S. Kelly T. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 2523-2527Crossref PubMed Scopus (369) Google Scholar, 20.Fairman M.P. Stillman B. EMBO J. 1988; 7: 1211-1218Crossref PubMed Scopus (295) Google Scholar). More recent studies have demonstrated that RPA operates in many processes of eukaryotic DNA metabolism, including repair and recombination (21.Thoma B.S. Vasquez K.M. Mol. Carcinog. 2003; 38: 1-13Crossref PubMed Scopus (108) Google Scholar, 22.Iftode C. Daniely Y. Borowiec J.A. Crit. Rev. Biochem. Mol. Biol. 1999; 34: 141-180Crossref PubMed Scopus (400) Google Scholar). Its primary role is presumed to be in modulating or coordinating these various DNA transactions, via both its well characterized DNA binding activity and its assorted interactions with other proteins (17.Wold M.S. Annu. Rev. Biochem. 1997; 66: 61-92Crossref PubMed Scopus (1188) Google Scholar). In this study, we aimed to identify the DNA structural elements that influence Ape1 ss AP site incision activity and to determine the effect of RPA on Ape1 ss and ds AP endonuclease functions. Our results herein reveal that Ape1 requires some form of DNA secondary conformation for proficient ss AP site incision, that the type and location of the secondary structure with respect to the AP lesion can have a significant impact on Ape1 efficiency, and that RPA is likely a key negative regulator of Ape1 ss cleavage activity in vivo. Proteins and Oligonucleotide Substrates—Recombinant human Ape1 protein was purified as described previously (23.Erzberger J.P. Barsky D. Scharer O.D. Colvin M.E. Wilson III, D.M. Nucleic Acids Res. 1998; 26 (and references therein): 2771-2778Crossref PubMed Scopus (91) Google Scholar). Recombinant human RPA was purified as detailed by Henricksen et al. (24.Henricksen L.A. Umbricht C.B. Wold M.S. J. Biol. Chem. 1994; 269: 11121-11132Abstract Full Text PDF PubMed Google Scholar) with some modification. Briefly, Rosetta(DE3)pLysS (Novagen) strains were transformed with p11dtRPA, and the RPA complex was expressed at 37 °C for 3 h in the presence of 1 mm isopropyl 1-thio-β-d-galactopyranoside. Harvested bacteria were lysed by sonication, and the resulting soluble fraction was subjected to column chromatography on Affi-Gel Blue (Bio-Rad), hydroxylapatite (CHT-II from Bio-Rad), and Q-Sepharose (Amersham Biosciences) as described (24.Henricksen L.A. Umbricht C.B. Wold M.S. J. Biol. Chem. 1994; 269: 11121-11132Abstract Full Text PDF PubMed Google Scholar), followed by chromatography on an ssDNA cellulose column (Sigma) (25.Kenny M.K. Schlegel U. Furneaux H. Hurwitz J. J. Biol. Chem. 1990; 265: 7693-7700Abstract Full Text PDF PubMed Google Scholar). The eluate from ssDNA cellulose was concentrated via Amicon Ultra-15 (molecular weight cutoff of 10,000; Millipore Corp.) and analyzed (Fig. 5A). T7 endo I was purchased from New England Biolabs. Oligonucleotides were purchased from Integrated DNA Technologies and are listed in Table 1. See Ref. 16.Wilson III, D.M. J. Mol. Biol. 2005; 345 (and references therein): 1003-1014Crossref PubMed Scopus (45) Google Scholar for additional details regarding substrates. For biochemical assays (see below), the oligonucleotides containing an AP site were radiolabeled at the 5′ end using [γ-32P]ATP and T4 polynucleotide kinase (New England Biolabs) as recommended by the manufacturer.TABLE 1Deoxyribose oligonucleotidesNameSequence (5′ to 3′)19 poly(A)-FAAAAAAAAAFAAAAAAAAA19 poly(T)-FTTTTTTTTTFTTTTTTTTT26 poly(T)-FTTTTTTTTTTTTTTFTTTTTTTTTTT34 poly(T)-FTTTTTTTTTTTTTTTFTTTTTTTTTTTTTTTTTT26GFAAATTCACCGGTACGFACTAGAATTCG26F3′DAATGCACCGGTAGCFACTAGCATTCG26FDDAATGCACCGGTACGFACTAGCATTCG26FDD1AATGCACCGGTACGCAFCAGCATTCG26FDD2AATGCACCGGTACGGACFAGCATTCG26FDTTTTTACCGGTACGGACFAGCATTCG26FD2TTTACCGTGTATCGGACFAGCATTGC34FCTGCAGCTGATGCGCFGTACGGATCCCCGGGTAC34F5′DCTGCAGCTGATGCGCFGTACTTATCCCCCGGTAG34FDDCTTTAGCTGATTTGCFGTACGGATCCCCGGGTAG34F5′D1CTGCAGCTGATGCGCTGFACTTATCCCCCGGTAG34F5′D2CTGCAGCTGATGCFCAGTACTTATCCCCCGGTAG34COMPCTGCAGCTGATGCGCCGTACGGATCCCCGGGTAC34GGTACCCGGGGATCCGTACGGCGCATCAGCTGCAG42CompTGCTTAGGATCATCGAGGATCGAGCTCGGTGCAATTCAGCGG42F-forkGGCGACTTAACFTGGCTCGAGCATCCTCGATGATCCTAAGCA42F-11bubbleCCGCTGAATTGCACCCTCGAFCTAGGTCGATGATCCTAAGCA Open table in a new tab AP Site Incision Assays—Ape1 endonuclease activity was monitored essentially as described (16.Wilson III, D.M. J. Mol. Biol. 2005; 345 (and references therein): 1003-1014Crossref PubMed Scopus (45) Google Scholar). In brief, unless otherwise indicated, Ape1 and 1 pmol of 32P-labeled F-containing ss or ds oligonucleotide substrates (10 μl final volume) were incubated at 37 °C under the previously defined, physiologically relevant reaction conditions (OPT buffer: 25 mm MOPS, pH 7.2; 100 mm KCl; 1 mm MgCl2; 1 mm dithiothreitol; and 50 μg/ml bovine serum albumin). Protein amount and incubation time are indicated in the figure or associated legend. Where RPA was included, RPA was pre-mixed with the substrate on ice for 20 min prior to the addition of Ape1 and the initiation of the reaction at 37 °C. Following the addition of stop buffer and heat inactivation at 95 °C for 10 min, an aliquot of the completed reaction was separated on a 15% polyacrylamide urea denaturing gel. Intact radiolabeled substrate and incised product were visualized and quantified using a Storm PhosphorImager (Amersham Biosciences) and accompanying software. DNA Secondary Structure Prediction—Potential secondary structure for all oligonucleotides was determined using the RNAfold program at rna.tbi.univie.ac.at/cgi-bin/RNAfold.cgi. Structure predictions were run using DNA parameters and the default options. Native Gel Electrophoresis—ss oligonucleotides were 5′-radiolabeled as described above. DNAs were then incubated for 30 min at 37 °C in OPT buffer plus 10% glycerol (see above). Oligonucleotides (0.5 pmol) were immediately loaded on a 12% nondenaturing polyacrylamide gel (19:1 acrylamide/bis) and electrophoresed at 160 V in 1× TBE for 2.5 h at room temperature. Gel images were obtained by standard PhosphorImager analysis. T7 Endo I Footprinting—One μl of 5′-radiolabeled oligonucleotide (1 pmol) was added to 18 μl of 1× New England Biolabs buffer 2 and incubated at 37 °C for 10 min. Reactions were then continued at 37 °C for 60 min in the presence of 1 μl of T7 endo I (i.e. 1–1.5 units of enzyme). DNA was subsequently precipitated by the addition of 0.5 ml of ethanol and 1 μl (20 μg) of glycogen, followed by centrifugation. The pelleted DNA was dried, resuspended in stop buffer, and heated at 95 °C for 5 min before electrophoresis on an 18% denaturing polyacrylamide sequencing gel. Images were obtained by standard PhosphorImager analysis. Standard and Competition EMSAs—A DNA competitor-based EMSA was employed to evaluate the relative affinities of Ape1 for specific ss F-containing oligonucleotides. In brief, 50 fmol of radiolabeled ds 34F:34G were incubated with 0.5 ng of Ape1 (14 fmol) for 20 min in OPT buffer without MgCl2 and plus 5% glycerol. Subsequently, 100× (5 pmol) of the indicated ss substrate was added (final volume of 10 μl), and the incubation was continued for another 20 min on ice. The reaction was subsequently resolved on a 4% polyacrylamide nondenaturing gel at 4 °C in 0.5× TBE. Electrophoresis was carried out for 80 min at 10 V/cm gel. Radiolabeled DNA was visualized and quantified using standard PhosphorImager analysis (see above). RPA DNA binding affinity was determined using a slightly modified EMSA. In brief, 20 fmol of labeled DNA substrate was incubated as above with the indicated amount of RPA. Where both RPA and Ape1 were included, Ape1 (60 fmol) was pre-mixed with the substrate for 20 min prior to the addition of RPA (see figure legend). Binding reactions were then analyzed as above. Dependence of Ape1 ss Incision Activity on DNA Secondary Structure— Ape1 has been shown to effectively incise at AP sites in ssDNA (15.Marenstein D.R. Wilson III, D.M. Teebor G.W. DNA Repair (Amst.). 2004; 3: 527-533Crossref PubMed Scopus (64) Google Scholar), with its endonuclease efficiency seemingly influenced by the potential secondary structure of the oligonucleotide (16.Wilson III, D.M. J. Mol. Biol. 2005; 345 (and references therein): 1003-1014Crossref PubMed Scopus (45) Google Scholar). To determine more explicitly the role of DNA secondary structure on Ape1 activity in vitro, incision assays were performed using DNAs unable to form secondary conformations, namely 19 poly(A)-F and 19 poly(T)-F (Table 1). As shown in Fig. 1, A (time course) and B (protein titration), Ape1 was unable to efficiently incise these ss 19-mer AP site-containing oligonucleotides, although the enzyme was fully capable of cleaving the positive control ss 34F DNA (see below). To exclude the possibility that 19 poly(A)-F and 19 poly(T)-F were improperly synthesized, complementary DNAs (19T and 19A) were generated and annealed accordingly, and the resulting duplexes were examined for Ape1 incision. As shown in Fig. 1C, although the ss versions of poly(A)-F and poly(T)-F were not cleaved, the ds conformations were converted to product at a rate >100-fold more rapid. To examine the possibility that nucleotide (nt) length was a limiting factor in incision of the 19-mer ss F-DNAs, poly(T) oligonucleotides were created (i.e. 26 poly(T)-F and 34 poly(T)-F; see Table 1), which have identical length and harbor an abasic residue at the equivalent position as the previously studied 26GFA and 34F DNAs (16.Wilson III, D.M. J. Mol. Biol. 2005; 345 (and references therein): 1003-1014Crossref PubMed Scopus (45) Google Scholar). Consistent with the 19 poly(A)-F and 19 poly(T)-F studies, no significant incision was observed with the 26- and 34-mer poly(T)-F oligonucleotides, whereas the ss 34F control was incised essentially completely (Fig. 1D). Our results argue that Ape1 requires some form of duplex arrangement to effectively bind and/or incise at the AP sites in ssDNA. Secondary Structure Analysis of the ss Oligonucleotide Substrates— The ss AP site-containing oligonucleotides, 26GFA and 34F (Table 1), were shown previously to be cleaved at an efficiency ∼20-fold less and ∼5-fold higher than comparable ds AP-DNA substrates, respectively, revealing an ∼100-fold difference in Ape1 ss AP-DNA incision rates (16.Wilson III, D.M. J. Mol. Biol. 2005; 345 (and references therein): 1003-1014Crossref PubMed Scopus (45) Google Scholar). It was presumed based on secondary structure predictions that the overall conformation of the ss oligonucleotide and the precise position of the AP site dictated Ape1 cleavage efficiency. In an attempt to identify the DNA structural elements that influence Ape1 ss AP site incision effectiveness, we designed related (i.e. sequence-modified) oligonucleotides that had the potential to form alternative secondary conformations, and then we tested Ape1 cleavage activity (see below). The various 26- and 34-mer F-containing oligonucleotides (Table 1) were chosen based largely on secondary structure predictions using the RNAfold algorithm. This computational program computes the optimal minimum free energy structure, employing experimental parameters measured at 37 °C (26.Hofacker I.L. Nucleic Acids Res. 2003; 31: 3429-3431Crossref PubMed Scopus (1791) Google Scholar). As shown in Fig. 2A (top), 34F5′D and 34FDD were created to evaluate the contribution of either the 3′ or 5′ duplex structure seen in 34F flanking the AP site. 34F5′D, 34F5′D1, and 34F5′D2 were synthesized to determine the effect of the location of the AP site with respect to the hairpin loop (i.e. 3, 5, or 1 nt(s) from, respectively). 26FDD, 26FDD1, and 26FDD2 were created to assess the role of duplexes on either side of the AP site (as seen in 34F), as well as the location of the AP damage and the size of the bubble conformation (Fig. 2A, bottom). With 26FD and 26FD2, a more stable 5′ duplex stem was introduced (i.e. 3 bp as seen in 34F), and the size of the unpaired loop was modified, from 3 nt in 26FD to 5 nt in 26FD2. 26F3′D is distinct from 26GFA in that the AP site is placed more toward the center of the ss loop, and the position of the duplex has changed relative to the lesion. To determine the accuracy of these computational predictions (Fig. 2A), we first utilized native (nondenaturing) polyacrylamide gel electrophoresis to test for the existence of secondary structure. We reasoned that any ds arrangement would alter the mobility of the F-containing oligonucleotides with respect to the poly(T)-F counterpart, which should retain normal linear ss form. Such studies revealed that each of the 34-mer DNAs migrated more quickly than 34 poly(T)-F, indicating that ss 34F, 34F5′D, 34FDD, 34F5′D1, and 34F5′D2 consist of compact, intramolecular DNA secondary structure that promotes a more rapid mobility (Fig. 2B, left). In addition, each 34-mer exists as a single predominant detectable DNA species, without the existence of significant alternative DNA conformations. Similar results were obtained with the 26-mer AP-DNAs, with the ss oligonucleotides migrating more rapidly than 26 poly(T)-F and, in some instances, 19 poly(T)-F (Fig. 2B, right). Unlike the 34-mers, however, three of the 26-mers, 26F3′D, 26FDD, and 26FDD2, appeared to exist in alternative, secondary configurations that roughly comprised 23, 16, and 9% of the total DNA species, respectively. Most interestingly, the 26-mers that migrated most swiftly (i.e. 26F3′D, 26FDD, 26FDD1, and 26FDD2; Fig. 2B, right) were those predicted to possess the most compact (i.e. duplex) structure (Fig. 2A, bottom). Although it is evident that each of the 26- and 34-mer AP site-containing oligonucleotides exist in a complex secondary form that is distinct from comparable linear ssDNA (and in some cases is unique from its sequence-altered counterparts; Fig. 2B), to gain a more precise picture of the intramolecular nature of the various substrates, we employed chemical and nuclease footprinting assays. Unfortunately, studies with either dimethyl sulfate (DMS) or diethyl pyrocarbonate, which did react with the DNA bases of the 34-mers as expected, did not uncover any obvious secondary conformation, which we hypothesized would reduce target base (namely guanine) reactivity. This result likely indicates that the short stretches of dsDNA present in the ss 34-mer oligonucleotides do not prevent DMS (supplemental Fig. 1) or diethyl pyrocarbonate (data not shown) modification. Thus, as an alternative means of probing for secondary conformations, we employed T7 endonuclease I (T7 endo I), a structure-selective enzyme that recognizes and cleaves nonperfectly matched DNA, cruciform DNA, and Holliday structures or junctions (27.Parkinson M.J. Lilley D.M. J. Mol. Biol. 1997; 270: 169-178Crossref PubMed Scopus (42) Google Scholar, 28.Declais A.C. Fogg J.M. Freeman A.D. Coste F. Hadden J.M. Phillips S.E. Lilley D.M. EMBO J. 2003; 22: 1398-1409Crossref PubMed Scopus (38) Google Scholar). Although recognizing that the substrate specificity of T7 endo I has not been thoroughly defined on ss oligonucleotides, our footprinting analyses generally support the existence of secondary structure as predicted for the 34- and 26-mer DNAs (Fig. 2A). In particular, in the case of 34F, the predominant nuclease band (24 nt in length) corresponds to a cutting site within the predicted unpaired 3′ loop, whereas the less prominent, yet significant, 13-nt band corresponds to incision immediately adjacent to the predicted 5′ stem-loop (Fig. 2C, left). Moreover, the major products of 13 and 24 nt seen with 34F5′D and 34FDD, respectively, are compatible with the above predicted 5′ and 3′ stem-loop structures. The 13-nt cleavage product observed with 34F5′D2 is also consistent with the theorized 5′ stem-loop, although the observation of additional bands implies the existence of alternative DNA secondary structures not predicted (e.g. a potential stem-loop between T18–A19 and T22–A23; denoted by dots in Fig. 2A), or an effect of the AP site location. A minor band of ∼24 nt is observed with 34F5′D and may reflect the presence of this 2-bp stem-loop as well, which again was not predicted by the RNAfold program. In the case of 34F5′D1, the major bands of 14, 16, 17, and 18 nt could be explained by T7 endo I incision at sites 3′ to the predicted stem-loop structure that may be influenced by the position of the AP site. With respect to the 26-mers, the existence of the large ds region predicted for 26F3′D, 26FDD, 26FDD1, and 26FDD2 is supported by the generation of the prominent 5- and 6-nt products (Fig. 2C, right), which correspond to T7 endo I incision immediately 3′ to the stem base (Fig. 2A). More importantly, the overall digestion patterns of 26F3′D, 26FDD and 26FDD1 are comparable, consistent with their similar mobility as seen in Fig. 2B (right). The predicted stem-loop structures of 26FD and 26FD2 are supported by the production of the 14–16-nt fragments, which are generated by cutting near the base of the evidently more stable 3-nt stem-loop structure. Significantly, the predicted structure of 26GFA was not confirmed by our footprinting studies, likely indicative of the weak stability of the predicted stem-loop structure, which consists of a short stem (2 nt) and a small loop (3 nt). Our native gel electrophoresis experiments indicate the presence of secondary structure in each of the 26- and 34-nt F-containing oligonucleotides. The T7 endo I footprinting studies support that the proposed, favored conformations are by and large the predominant DNA species. We emphasize that to our knowledge routine methodologies to interrogate secondary structures of ssDNA oligonucleotides are not well established. Effect of Secondary Structure on Ape1 Incision and Binding Activities— With the above structural information in hand, we next evaluated the efficiency with which Ape1 cleaved the various ss F-containing oligonucleotides. As shown in Fig. 3A (time course reactions) and quantitatively reported in Table 2 (specific activities), 34F5′D was cleaved at an efficiency similar to 34F (<1.1-fold difference), whereas Ape1 incision of 34FDD was significantly slower (∼7-fold reduced). Moreover, 34F5′D2 was converted to product at a rate ∼50-fold slower than 34F5′D1 (which was incised at a rate similar to 34F; Table 2). The steady-state kinetic curves shown in Fig. 3A are consistent with the presence of a single major DNA species for each oligonucleotide substrate, as seen in the native gel electrophoresis studies (Fig. 2B). Time course experiments with the 26-mer substrates indicate that each of the sequence-modified DNAs were cleaved by Ape1 (i) more efficiently than the parental 26GFA oligonucleotide (Table 2) and (ii) primarily via near-linear kinetics (Fig. 3B). Notably, 26FD2, which most closely mimics the 5′ portion of 34F (Fig. 2A), was found to be the best substrate (among the 26-mers) for Ape1, with an ∼8-fold improvement over 26GFA. Nonetheless, for reasons that are not clear (but may reflect the precise nt composition), all 26-mers were significantly poorer substrates (i.e. cleaved at a rate around 300-fold slower) in comparison to 34F, although 26FD2 was cleaved at an efficiency nearly identical to 34F5′D2 (summarized in Table 2).TABLE 2Specific incision activity of Ape1 and relative percent ds 34F bound by Ape1 in the presence of various ss substratesSubstratesSpecific incision activityRelative percent ds 34F bound to Ape1 in the presence of ss competitor DNAaThe numbers are relative to the absence of ss DNA and are graphed in Fig. 3D.pmol min-1 μg-1%34F3836 ± 9195.9 ± 8.834F5′D3612 ± 11485.1 ± 6.134FDD568 ± 12537 ± 1234F5′D14793 ± 35557 ± 1034F5′D2100 ± 1536 ± 1126GFA4.7 ± 1.269 ± 2026F3′D12 ± 2.9106 ± 2026FDD13 ± 3.9110 ± 2326FDD15.5 ± 1.7106 ± 1126FDD211 ± 2.898 ± 1226FD16 ± 2.5103 ± 1826FD237 ± 4.6101 ± 27a The numbers are relative to the absence of ss DNA and are graphed in Fig. 3D. Open table in a new tab The incision experiments in total suggest the following. (i) A 5′ duplex structure (with respect to the abasic site) is more favorable than a 3′ duplex, and ds structure on both sides is not essential for Ape1 cleavage (see 34F5′D versus 34FDD and see Ref. 13.Wilson III, D.M. Takeshita M. Grollman A.P. Demple B. J. Biol. Chem. 1995; 270 (and references therein): 16002-16007Abstract Full Text Full Text PDF PubMed Scopus (245) Google Scholar). (ii) A larger ss loop (i.e. 5 nt in 26FD2) is more favorable than a shorter loop (3 nt in 26FD), implying that the neighboring 5′-duplex stability, which is likely adversely affected by the torsional strain created by a short ss region in the hairpin loop, is an important element in determining Ape1 effectiveness (see also the results with 26GFA and 34F). (iii) an AP site immediately adjacent to a 5′ duplex structure is a deterrent to Ape1 cleavage, as compared with an abasic lesion positioned 3 or 5 nt from the secondary conformation (compare for instance 34F5′D2 with 34F5′D and 34F5′D1), although such conclusions are tentative because the T7 endo I footprinting studies do not fully support the predicted secondary configurations for 34F5′D and 34F5′D2. As a means of determining qualitatively whether the observed differences in Ape1 incision efficiency for the varying ss AP-DNAs (Table 2) were mainly the product of reduced substrate affinity, we employed a competitor-based EMSA. In these experiments, radiolabeled ds 34F: 34G DNA (Table 1) was incubated with Ape1, and a 100-fold molar" @default.
• W2035807710 created "2016-06-24" @default.
• W2035807710 creator A5068693127 @default.
• W2035807710 creator A5071015857 @default.
• W2035807710 creator A5076615388 @default.
• W2035807710 date "2006-02-01" @default.
• W2035807710 modified "2023-09-27" @default.
• W2035807710 title "Nucleotide Sequence and DNA Secondary Structure, as Well as Replication Protein A, Modulate the Single-stranded Abasic Endonuclease Activity of APE1" @default.
• W2035807710 cites W1550656265 @default.
• W2035807710 cites W1558614105 @default.
• W2035807710 cites W1602417853 @default.
• W2035807710 cites W1605838085 @default.
• W2035807710 cites W1964616976 @default.
• W2035807710 cites W1966720879 @default.
• W2035807710 cites W1973039292 @default.
• W2035807710 cites W1974823582 @default.
• W2035807710 cites W1978124987 @default.
• W2035807710 cites W1981565987 @default.
• W2035807710 cites W1983343321 @default.
• W2035807710 cites W1985818914 @default.
• W2035807710 cites W1986606105 @default.
• W2035807710 cites W1990069731 @default.
• W2035807710 cites W1991315224 @default.
• W2035807710 cites W1991374720 @default.
• W2035807710 cites W1998607580 @default.
• W2035807710 cites W2007730035 @default.
• W2035807710 cites W2015006197 @default.
• W2035807710 cites W2017783254 @default.
• W2035807710 cites W2025504171 @default.
• W2035807710 cites W2031254460 @default.
• W2035807710 cites W2035746057 @default.
• W2035807710 cites W2038878236 @default.
• W2035807710 cites W2041145998 @default.
• W2035807710 cites W2042367379 @default.
• W2035807710 cites W2047924613 @default.
• W2035807710 cites W2053573382 @default.
• W2035807710 cites W2055462773 @default.
• W2035807710 cites W2056264448 @default.
• W2035807710 cites W2060850037 @default.
• W2035807710 cites W2061294664 @default.
• W2035807710 cites W2067546483 @default.
• W2035807710 cites W2071457845 @default.
• W2035807710 cites W2073207608 @default.
• W2035807710 cites W2074964515 @default.
• W2035807710 cites W2076154132 @default.
• W2035807710 cites W2076316122 @default.
• W2035807710 cites W2078882775 @default.
• W2035807710 cites W2080982746 @default.
• W2035807710 cites W2082829202 @default.
• W2035807710 cites W2090573596 @default.
• W2035807710 cites W2094680495 @default.
• W2035807710 cites W2097432692 @default.
• W2035807710 cites W2098312065 @default.
• W2035807710 cites W2103250001 @default.
• W2035807710 cites W2108192168 @default.
• W2035807710 cites W2122002835 @default.
• W2035807710 cites W2123527421 @default.
• W2035807710 cites W2126917185 @default.
• W2035807710 cites W2134259738 @default.
• W2035807710 cites W2134759386 @default.
• W2035807710 cites W2137026987 @default.
• W2035807710 cites W2139768549 @default.
• W2035807710 cites W2149128483 @default.
• W2035807710 cites W2149922717 @default.
• W2035807710 cites W2161880088 @default.
• W2035807710 cites W2171775098 @default.
• W2035807710 doi "https://doi.org/10.1074/jbc.m511004200" @default.
• W2035807710 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16356936" @default.
• W2035807710 hasPublicationYear "2006" @default.
• W2035807710 type Work @default.
• W2035807710 sameAs 2035807710 @default.
• W2035807710 citedByCount "32" @default.
• W2035807710 countsByYear W20358077102012 @default.
• W2035807710 countsByYear W20358077102013 @default.
• W2035807710 countsByYear W20358077102014 @default.
• W2035807710 countsByYear W20358077102015 @default.
• W2035807710 countsByYear W20358077102017 @default.
• W2035807710 countsByYear W20358077102018 @default.
• W2035807710 countsByYear W20358077102019 @default.
• W2035807710 countsByYear W20358077102021 @default.
• W2035807710 countsByYear W20358077102022 @default.
• W2035807710 countsByYear W20358077102023 @default.
• W2035807710 crossrefType "journal-article" @default.
• W2035807710 hasAuthorship W2035807710A5068693127 @default.
• W2035807710 hasAuthorship W2035807710A5071015857 @default.
• W2035807710 hasAuthorship W2035807710A5076615388 @default.
• W2035807710 hasBestOaLocation W20358077101 @default.
• W2035807710 hasConcept C104317684 @default.
• W2035807710 hasConcept C150777479 @default.
• W2035807710 hasConcept C153911025 @default.
• W2035807710 hasConcept C185592680 @default.
• W2035807710 hasConcept C2777028655 @default.
• W2035807710 hasConcept C2778112365 @default.
• W2035807710 hasConcept C512185932 @default.
• W2035807710 hasConcept C54355233 @default.
• W2035807710 hasConcept C552990157 @default.
• W2035807710 hasConcept C73573662 @default.
• W2035807710 hasConcept C86803240 @default.

• next