FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2036697811> ?p ?o ?g. }

• W2036697811 endingPage "47778" @default.
• W2036697811 startingPage "47770" @default.
• W2036697811 abstract "The large majority of plastid proteins are nuclear-encoded and, thus, must be imported within these organelles. Unlike most of the outer envelope proteins, targeting of proteins to all other plastid compartments (inner envelope membrane, stroma, and thylakoid) is strictly dependent on the presence of a cleavable transit sequence in the precursor N-terminal region. In this paper, we describe the identification of a new envelope protein component (ceQORH) and demonstrate that its subcellular localization is limited to the inner membrane of the chloroplast envelope. Immunopurification, microsequencing of the natural envelope protein and cloning of the corresponding full-length cDNA demonstrated that this protein is not processed in the N-terminal region during its targeting to the inner envelope membrane. Transient expression experiments in plant cells were performed with truncated forms of the ceQORH protein fused to the green fluorescent protein. These experiments suggest that neither the N-terminal nor the C-terminal are essential for chloroplastic localization of the ceQORH protein. These observations are discussed in the frame of the endosymbiotic theory of chloroplast evolution and suggest that a domain of the ceQORH bacterial ancestor may have evolved so as to exclude the general requirement of an N-terminal plastid transit sequence. The large majority of plastid proteins are nuclear-encoded and, thus, must be imported within these organelles. Unlike most of the outer envelope proteins, targeting of proteins to all other plastid compartments (inner envelope membrane, stroma, and thylakoid) is strictly dependent on the presence of a cleavable transit sequence in the precursor N-terminal region. In this paper, we describe the identification of a new envelope protein component (ceQORH) and demonstrate that its subcellular localization is limited to the inner membrane of the chloroplast envelope. Immunopurification, microsequencing of the natural envelope protein and cloning of the corresponding full-length cDNA demonstrated that this protein is not processed in the N-terminal region during its targeting to the inner envelope membrane. Transient expression experiments in plant cells were performed with truncated forms of the ceQORH protein fused to the green fluorescent protein. These experiments suggest that neither the N-terminal nor the C-terminal are essential for chloroplastic localization of the ceQORH protein. These observations are discussed in the frame of the endosymbiotic theory of chloroplast evolution and suggest that a domain of the ceQORH bacterial ancestor may have evolved so as to exclude the general requirement of an N-terminal plastid transit sequence. Higher plant plastids contain a genome with limited coding capacity. The large majority of plastid proteins are nuclear-encoded and thus, must be imported within these organelles. To this purpose, the two envelope membranes that surround chloroplasts contain a protein import apparatus constituted of the TOC and TIC complexes (translocon at the inner or outer membranes of the chloroplast envelope) (for recent reviews, see Refs. 1Chen X. Schnell D.J. Trends Cell Biol. 1999; 9: 222-227Google Scholar, 2Keegstra K. Cline K. Plant Cell. 1999; 11: 557-570Google Scholar, 3Schleiff E. Soll J. Planta. 2000; 211: 449-456Google Scholar, 4Jackson-Constan D. Keegstra K. Plant Physiol. 2001; 125: 1567-1676Google Scholar). The major element of this translocation complex is Toc75, which is the most abundant protein in the outer envelope membrane. Moreover, Toc75 seems to form the central pore of the outer envelope translocation channel (5Schnell D.J. Kessler F. Blodel G. Science. 1994; 266: 1007-1012Google Scholar, 6Tranel P.J. Froehlich J. Goyal A. Keegstra K. EMBO J. 1995; 14: 2436-2446Google Scholar) and interacts specifically with the N-terminal transit peptide of precursor proteins during the import process toward chloroplast (7Ma Y.K. Kouranov A. LaSala S.E. Schnell D.J. J. Cell. Biol. 1996; 134: 315-327Google Scholar). This cleavable and N-terminal transit peptide was shown to be necessary and sufficient for transport of precursors (i) across the two envelope membranes (8Keegstra K. Olsen L.J. Theg S.M. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1989; 40: 471-501Google Scholar, 9De Boer A.D. Weisbeek P.J. Biochim. Biophys. Acta. 1991; 1071: 221-253Google Scholar) and (ii) across the thylakoid membrane if the transit sequence is bipartite (it contains additional targeting information for thylakoid lumen targeting) (9De Boer A.D. Weisbeek P.J. Biochim. Biophys. Acta. 1991; 1071: 221-253Google Scholar). The cleavage of the transit sequence is performed by two proteases, one in the stroma (10VanderVere P.S. Bennett T.M. Oblong J.E. Lamppa G.K. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 7177-7181Google Scholar) and one in the thylakoid lumen for the bipartite transit sequences (11Chaal B.K. Mould R.M. Barbrook A.C. Gray J.C. Howe C.J. J. Biol. Chem. 1998; 273: 689-692Google Scholar). Moreover it is interesting to note that all described inner membrane proteins and intermembrane space proteins possess an N-terminal cleavable transit peptide, while most outer envelope membrane proteins do not have any cleavable transit peptide. In the latter case, the targeting information is contained within the mature protein (12Cline K. Henry R. Annu. Rev. Cell Dev. Biol. 1996; 12: 1-26Google Scholar), and after their cytosolic synthesis, proteins are directly incorporated in the lipid bilayer through unknown interactions with the outer membrane lipids (13Van't Hof R. Demel R.A. Keegstra K. de Kruijff B. FEBS Lett. 1991; 291: 350-354Google Scholar, 14Van't Hof R. Van Klompenburg W. Pilon M. Kozubek A. de Korte-Kool G. Demel R.A. Weisbeek P.J. de Kruijff B. J. Biol. Chem. 1993; 268: 4037-4042Google Scholar, 15Pinaduwage P. Bruce B.D. J. Biol. Chem. 1996; 271: 32907-32915Google Scholar). In this report, we describe the identification of a new component of the inner membrane of the chloroplast envelope, which exhibits similarities with a range of quinone oxidoreductase from various organisms (ceQORH for Chloroplast Envelope Quinone OxidoReductase Homologue). Immunolocalization, purification, and microsequencing of this protein and cloning of the corresponding full-length cDNA revealed the existence of a protein that does not require the presence of a cleavable N-terminal transit peptide to be targeted to the inner membrane of the chloroplast envelope. Transient expression of GFP 1The abbreviations used are: GFP, green fluorescent protein; MOPS, 4-morpholinepropanesulfonic acid; CHAPS, 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid; Q-TOF, quadrupole time-of-flight; RACE, rapid amplification of cDNA ends; UTR, untranslated region-tagged and truncated forms of the ceQORH protein suggests that the localization of this protein into chloroplast is dependent on an essential but not sufficient internal domain located within the ceQORH amino acid sequence. All operations were carried out at 0–5 °C. Crude chloroplasts were obtained from 3–4 kg of spinach (Spinacia oleracea L.) leaves and purified by isopyknic centrifugation using Percoll gradients (16Douce R. Joyard J. Edelman M. Hallick R. Chua N.-H. Methods in Chloroplast Molecular Biology. Elsevier Science Publishers B.V., Amsterdam1982: 239-256Google Scholar). At this step of purification, protease inhibitors (1 mm phenylmethylsulfonyl fluoride, 1 mmbenzamidine, and 0.5 mm amino caproic acid) were added to prevent any protein degradation. Purified intact chloroplasts were lysed in hypotonic medium, and envelope membranes were purified from the lysate by centrifugation on sucrose gradients (16Douce R. Joyard J. Edelman M. Hallick R. Chua N.-H. Methods in Chloroplast Molecular Biology. Elsevier Science Publishers B.V., Amsterdam1982: 239-256Google Scholar). Envelope subfractions respectively enriched in outer and inner membranes were obtained from purified intact spinach chloroplasts as previously described (17Block M.A. Dorne A.-J. Joyard J. Douce R. J. Biol. Chem. 1983; 258: 13273-13280Google Scholar). To study polypeptides localized on the external face of the outer membrane, intact chloroplast were treated with thermolysin from Bacillus thermoproteolyticus as previously described (18Joyard J. Billecocq A. Bartlett S.G. Block M. Chua N.H. Douce R. J. Biol. Chem. 1983; 258: 10000-10006Google Scholar). All types of envelope membranes preparations were stored in liquid nitrogen in 50 mm MOPS-NaOH, pH 7.8, in the presence of protease inhibitors (1 mm benzamidine and 0.5 mm amino caproic acid). Protein contents of membrane fractions were estimated using the BIO-RAD protein assay reagent (19Bradford M. Anal. Biochem. 1976; 72: 248-254Google Scholar). Solubilization of envelope membrane proteins with CHAPS or Triton X-100 were performed as follows. Envelope proteins (0.8 mg) were diluted in 1 ml of 50 mm MOPS, pH 7.8, containing 0.2% (v/v) Triton X-100 or 6 mm CHAPS. After incubation at 4 °C for 30 min, the mix was centrifuged (130,000 ×g, 20 min, 4 °C) to separate (i) a supernatant containing membrane proteins solubilized by the treatment and (ii) a pellet containing the insoluble proteins. SDS-PAGE analyses of chloroplast subfractions or chloroplast envelope subfractions were performed as described by Chua (20Chua N.H. Methods Enzymol. 1980; 69: 434-436Google Scholar). For Western blotting experiments, gels were transferred electrophoretically to a nitrocellulose membrane (BA85, Schleicher & Schuell). The immunoblot assay was performed according to the protocol from BIO-RAD Laboratories except that 5% non-fat dry milk was used to saturate the membrane. The ceQORH protein was detected using the polyclonal antibodies raised against the recombinantArabidopsis protein at a 1/5000 dilution using alkaline phosphatase detection. After SDS-PAGE, protein bands were excised from the Coomassie Blue-stained gel. Conditions for in-gel tryptic digestion and peptide elution were described previously (21Ferro M. Salvi D. Rivière-Rolland H. Vermat T. Seigneurin-Berny D. Garin J. Joyard J. Rolland N. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 11487-11492Google Scholar). The peptide solution was introduced into a glass capillary (Protana) for nanoelectrospray ionization. Tandem mass spectrometry experiments were carried out on a Q-TOF (quadrupole orthogonal acceleration time-of-flight) hybrid mass spectrometer (Micromass) to obtain sequence information. Collision-induced dissociation of selected precursor ions was performed using argon as the collision gas and with collision energies of 40–60 eV. Tandem mass spectrometry sequence information were used for data base searching using the programs MS-Edman located at the University of California San Francisco (prospector.ucsf.edu/) and BLAST located at the NCBI (www.ncbi.nlm.nih.gov/BLAST/). Prediction for membrane-spanning regions was achieved using the software programs TMpred (www.ch.embnet.org/software/TMPRED_form.html) (22Hofmann K. Stoffel W. Biol. Chem. Hoppe-Seyler. 1993; 347: 166Google Scholar). Purification of total RNAs from spinach orArabidopsis leave were performed using the RNeasy Plant Mini Kit from Qiagen Laboratories. Purification of mRNA from the total RNA fraction was performed using the mRNA Direct Kit from Dynal Laboratories. Constructions of the spinach andArabidopsis cDNA libraries were performed using the Marathon cDNA Amplification Kit from Clontech Laboratories. All RACE-PCR experiments were performed using the Advantage cDNA Polymerase Mix from Clontech Laboratories. Cloning of the ArabidopsiscDNA coding the ceQORH from Arabidopsis was performed by PCR, on an Arabidopsis cDNA library using primers designed on the basis of the Arabidopsis genome sequence (AGI accession number AT4G13010) encoding the putative ceQORH protein (TrEMBL accession number Q9SV68). Two primers TCACATATGGCTGGAAAACTCAATGCAC and ATGGATCCAACGCTCTTATGGCTCGAC were designed respectively to introduce NdeI and BamHI recognition sites (underlined residues) at the 5′ and 3′ ends of the ceQORH cDNA. The amplified fragment was cloned in pBlueScript SK−. The insert was then digested withNdeI and BamHI and inserted into the expression vector pET-15b (Novagen). The resulting expression plasmid was used to express the N-terminal His-tagged ceQORH protein in E. coli strain BLR(DE3) (Novagen). The recombinant protein was purified by metal affinity chromatography (His-Bind resin, Novagen) and desalted (PD-10 column, Amersham Biosciences). This purified ceQORH from Arabidopsis was used (i) to raise a rabbit polyclonal antibodies against this protein (obtained from theElevage Scientifique des Dombes, F-01400 Châtillon sur Chalaronne, France) and (ii) as a tool in the immunopurification of the ceQORH from spinach chloroplast envelope membranes. Envelope proteins (1 mg) were solubilized in 1 ml of 50 mm Tris/HCl, 150 mm NaCl, and 6 mm CHAPS and incubated 1 h at 4 °C with 33 μl of serum raised against the purifiedArabidopsis recombinant ceQORH. Protein A-agarose (50 μg; Boehringer) was added, and the mix was incubated for 3 h at 4 °C. After three successive washings by centrifugation (Eppendorf 5415D, 16,000 × g, 20 min, 4 °C) of the protein A-agarose and pellet suspension in 1 ml of solubilization buffer (20 mm MOPS, pH 7.8, 150 mm NaCl, 6 mmCHAPS), 50 μg of His-tagged recombinant Arabidopsisprotein, incubated in 200 μl of solubilization buffer, was added. The mix was incubated for 1 h at 4 °C and centrifuged for 20 min at 16,000 × g (Eppendorf 5415D). Supernatant was incubated for 1 h with Ni-NTA resin (Qiagen), previously equilibrated in the solubilization buffer to remove the majority of the His-tagged recombinant Arabidopsis protein. After centrifugation (Eppendorf 5415D, 16,000 × g, 20 min, 4 °C) the supernatant was analyzed by SDS-PAGE. To isolate the spinach ceQORH cDNA, RACE-PCR were performed using degenerated primers synthesized on the basis of the spinach protein microsequences. Primers Rev (GCNCCYTCNGGNGTYTTRTARTC) and Fwd (GAYTAYAARACNCCNGARGGNGC) were designed respectively for 5′ or 3′ RACE-PCR amplifications. Positive amplification was obtained from 5′ RACE-PCR amplification performed with the primer Rev and the Adaptator Primer AP1 (CTAATACGACTCACTATAGGGCTCGAGCGGCCGCCCGGGCAGGT) provided with the Marathon cDNA Amplification Kit (Clontech Laboratories). Amplified fragments were inserted into the pBlueScript SK− vector and sequenced from both ends with standard T3 and T7 primers as well as with insert-specific primers (the 5′ sequence revealed the ceQORH translation start codon and a stop codon in frame with this ATG in the 5′-UTR). The complete cDNA sequence coding for the spinach ceQORH was obtained from 5′ and 3′ RACE-PCR performed with primers AP1 and non-degenerated primers D (CAGCAACATCAGTTCCAGGTATAG) and A (ACACGCATGTAACAGCAACATGTG), respectively. Note that the existence of the stop codon localized within the 5′-UTR and in frame with the translation start codon was confirmed with this new 5′ RACE-PCR using primers D and AP1. The GFP reporter plasmid 35Ω-sGFP(S65T) and the plasmid containing the transit peptide (TP) sequence from RBCS fused to GFP [35Ω-TP-sGFP(S65T)] were described previously (23Chiu W. Niwa Y. Zeng W. Hirano T. Kobayashi H. Sheen J. Curr. Biol. 1996; 6: 325-330Google Scholar). Construction of the plasmids for expression of truncated Arabidopsis ceQORH protein fused to GFP were performed as follows. The 35Ω-ceQORH-sGFP(S65T) plasmid corresponding to the coding region of Arabidopsis ceQORH was PCR-amplified using the two flanking primers XhoI-N-ter (CCTCTCGAGATGGCTGGAAAACTCATGCAC) and NcoI-C-ter (CAACCCATGGATGGCTCGACAATGATCTTC), and the PCR product was cloned into the pBlueScript SK− Vector. TheXhoI-NcoI fragment cleaved from this plasmid was inserted into the SalI-NcoI digested GFP reporter plasmid 35Ω-sGFP(S65T) to create the 35Ω-ceQORH-sGFP(S65T) vector. The protocol was similar for the other constructions. The 35Ω-Δ(1–31)ceQORH-sGFP(S65T) plasmid corresponding to ceQORH lacking the first 31 amino acids was PCRamplified using the two flanking primers SalI-N-ter (CGGTTGTCGACATGAAGAGTAATGAGGTTTGCCTG) andNcoI-C-ter (CAACCCATGGATGGCTCGACAATGATCTTC). The 35Ω-Δ(1–59)ceQORH-sGFP(S65T) plasmid corresponding to ceQORH lacking the first 59 amino acids was PCR-amplified using the two flanking primers SalI-N-ter (GAATGGTCGACATGTTTCTGCCCCGCAAGTTC) andNcoI-C-ter (CAACCCATGGATGGCTCGACAATGATCTTC). The 35Ω-Δ(1–99)ceQORH-sGFP(S65T) plasmid corresponding to ceQORH lacking the first 99 amino acids was PCR-amplified using the two flanking primers SalI-N-ter (GGTTGTCGACATGCTAGGTGGAGGTGGACTTG) andNcoI-C-ter (CAACCCATGGATGGCTCGACAATGATCTTC). The 35Ω-(6–100)ceQORH-sGFP(S65T) plasmid containing the first six to 100 amino acids of ceQORH was PCR-amplified using the two flanking primersXhoI-N-ter (CCTCTCGAGATGGCTGGAAAAACTCATGCAC) andNcoI-C-ter (ACCCATGGCTAGATGGCTAAGAACCGCTAC). The 35Ω-(60–100)ceQORH-sGFP(S65T) plasmid containing the first 60–100 amino acids of ceQORH was PCR-amplified using the two flanking primers SalI-N-ter (GAATGGTCGACATGTTTCTGCCCCGCAAGTTC) andNcoI-C-ter (ACCCATGGCTAGATGGCTAAGAACCGCTAC). The 35Ω-QORECOLI-sGFP(S65T) plasmid containing the QOR protein fromE. coli (accession number P28304) was PCR-amplified using the two flanking primers XhoI-QORNter (GTTCTCGAGGACACATGGCAACAC) and NcoI-QORCter (CTATTCCATGGATGGAATCAGCAGGCTGGAAC). Correct orientation and sequences of the inserted fragments were controlled. The plasmids used for tissue bombardment were prepared using the QIAfilter Plasmid Midi Kit (Qiagen Laboratories). Arabidopsis cells were grown in light for 3 days in a Gamborg's B5 media (Sigma, pH 5.8) complemented with 1.5% sucrose and 1 μm naphthalene acetic acid. 15 ml of cell suspension (corresponding approximately to 0.5 g of fresh weight) were applied in Petri dishes containing the same growth media with 0.8% bacto-agar (Invitrogen) and were incubated for 18–36 h in light. BY2 tobacco cells were grown for 5 days at 27 °C in a Murashige and Skoog medium (Duchefa, pH 5.8) complemented with 3% sucrose, 0.2% KH2PO4, 0.2% myo-inositol, 1 μm2.4-dichlorophenoxy acetic acid, and 3 μm thiamin. Cell suspension (2.5 ml, corresponding approximately to 0.3 g of fresh weight) were applied in Petri dishes containing the same growth media with 1% bacto-agar and stored at 27 °C during 18–24 h. Plasmids of appropriate constructions (1 μg) were introduced intoArabidopsis and BY2 cells using a pneumatic particle gun (PDS-1000/He; Bio-Rad). The condition of bombardment was helium pressure of 1350 p.s.i., 1100 p.s.i. rupture disks (Bio-Rad), 10-cm target distance using 1 μm of gold microcarriers (Bio-Rad). After bombardment, cells were incubated on the plates for 18–36 h (in light for the Arabidopsis cells). Cells were transferred to glass slides before fluorescence microscopy. Localization of GFP and GFP fusions was analyzed in transformed cells by fluorescence microscopy using a Zeiss Axioplan2 fluorescence microscope, and the image was captured with a digital charge-coupled devices camera (Hamamatsu). The filter sets used were Zeiss filter set 13, 488013–0000 (exciter BP 470/20, beamsplitter FT 493, emitter BP 505–530) and Zeiss filter set 15, 488015–0000 (exciter BP 546/12, beamsplitter FT 580, emitter LP 590) for GFP and autofluorescence of chlorophylls, respectively. Cells were observed with a 400× magnification. During the course of the identification of new chloroplast envelope protein components (21Ferro M. Salvi D. Rivière-Rolland H. Vermat T. Seigneurin-Berny D. Garin J. Joyard J. Rolland N. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 11487-11492Google Scholar,24Seigneurin-Berny D. Rolland N. Garin J. Joyard J. Plant J. 1999; 19: 217-228Google Scholar) some peptide sequences were obtained, which shared homology with a putative Arabidopsis protein (AGI accession number At4g13010; TrEMBL accession number Q9SV68). Whereas most of the envelope proteins identified during these early publications were highly hydrophobic, this putative protein was structurally related to soluble bacterial, fungal, and animal proteins of known quinone oxidoreductase function. Because of its possible function and since this ceQORH protein could participate in the redox chains previously detected in the chloroplast envelope membranes (25Jager-Vottero P. Dorne A.-J. Jordanov J. Douce R. Joyard J. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 1597-1602Google Scholar), we decided to further investigate the subcellular localization of this ceQORH protein. To obtain a polyclonal antibody raised against this protein the corresponding Arabidopsis cDNA was cloned and the full-length protein was overexpressed in E. coli. The recombinant ceQORH protein overexpressed in E. coli (Fig.1 A) was recovered in two distinct fractions: a soluble fraction in the E. colicytosol (Fig. 1 A, lane S) and an insoluble fraction (Fig. 1 A, lane I). As a high (0.5%) concentration of Triton X-100 did not release the insoluble fraction of the recombinant protein in the soluble phase, this fraction (Fig.1 A, lane I) is likely to correspond to aggregated protein (inclusion bodies). The soluble fraction of the N-terminal His-tagged recombinant protein was further purified by metal affinity chromatography. During this purification process, the ceQORH protein still behaved as a soluble protein (Fig. 1 B) as expected for a member of this quinone oxidoreductase family (26Rao P.V. Krishna C.M. Zigler J.S. J. Biol. Chem. 1992; 267: 96-102Google Scholar). Since the recombinant ceQORH protein appeared to be, at least in part, soluble in the E. colicytosol (Fig. 1 A), actual association of this protein with the chloroplast envelope remained to be demonstrated. Western blots performed on chloroplast subfractions demonstrated that this protein is only present within the chloroplast envelope (Fig.2 A, lane E) and not detected in other chloroplast subfractions (Fig. 2 A,lanes S, T). From these data, it can be concluded that the ceQORH protein is associated exclusively with the envelope membrane and is not a soluble stroma protein contaminating the envelope preparations. It is generally accepted that Percoll-purified intact chloroplasts are free from cytosolic contaminants (16Douce R. Joyard J. Edelman M. Hallick R. Chua N.-H. Methods in Chloroplast Molecular Biology. Elsevier Science Publishers B.V., Amsterdam1982: 239-256Google Scholar). However, the ceQORH protein could be a soluble protein specifically interacting with the outer membrane of the chloroplast envelope thus, co-purifying with the purified chloroplast envelope membranes. To test this hypothesis, intact chloroplasts were treated with the thermolysin ofBacillus thermoproteolyticus as previously described (18Joyard J. Billecocq A. Bartlett S.G. Block M. Chua N.H. Douce R. J. Biol. Chem. 1983; 258: 10000-10006Google Scholar). As presented in the Fig. 2 B, the ceQORH protein remained unaffected by the thermolysin treatment performed on intact plastids. In contrast, complete degradation of the ceQORH protein was observed when the same proteolytic treatment was performed on solubilized envelope proteins, thus demonstrating the sensitivity of the ceQORH protein to thermolysin treatment (Fig. 2 C). This result indicates that the ceQORH protein is not accessible to thermolysin from the cytosolic surface of the chloroplast, thus ruling out the hypothesis that the ceQORH protein could be a soluble cytosolic contaminant of the chloroplast envelope preparations or an envelope component associated with the outer face of the outer envelope membrane. Finally, immunodetection of the ceQORH protein demonstrated that this protein is only present in the inner membrane of the chloroplast envelope (Fig. 2 D, lane IM). The purity of the envelope subfractions was controlled using antibodies raised against IE18 and OEP24 proteins, which serve as marker molecules for inner and outer envelope membrane proteins respectively (24Seigneurin-Berny D. Rolland N. Garin J. Joyard J. Plant J. 1999; 19: 217-228Google Scholar, 27Rohl T. Motzkus M. Soll J. FEBS Lett. 1999; 460: 491-494Google Scholar). Thus, unlike the other members of this quinone oxidoreductase family (26Rao P.V. Krishna C.M. Zigler J.S. J. Biol. Chem. 1992; 267: 96-102Google Scholar), the ceQORH protein behaves as a genuine membrane protein. At this stage, the apparent solubility of the recombinant ceQORH produced inE. coli and its exclusive localization in the inner membrane of the chloroplast envelope were contradictory. One hypothesis was that ceQORH could be a soluble protein localized in the intermembrane space between the inner and the outer membrane of the chloroplast envelope. This protein could be copurified with inner envelope preparations, sequestrated in membrane vesicles. Some major soluble stroma proteins, which are sequestrated in the envelope vesicles, are known to contaminate envelope fractions (e.g. large Rubisco subunit). These proteins can be released from envelope preparations by opening/closing of the membrane vesicles after sonication (Fig.3 A, lane 2 andRbcL). Since the ceQORH protein was not solubilized after sonication of membrane vesicles (Fig. 3 A, lane 2), it is likely to physically interact with the inner envelope membrane. To test the nature of the association between ceQORH and the inner envelope membrane, membranes were washed by application of salt and alkaline treatments (28Liu M. Spremulli L. J. Biol. Chem. 2000; 275: 29400-29406Google Scholar). One of the standard method to determine the interaction of a protein with a membrane is to examine the effects of an alkaline Na2CO3 solution, which strips peripheral membrane proteins leaving intrinsic proteins associated with the lipid bilayer. Alkaline extractions using Na2CO3 (0.1 m, pH 11) induced a release in the soluble phase of a major part of the protein, and all the protein was solubilized using NaOH (0.1 m) treatment (Fig. 3 A, lanes 5, 6). These observations indicate that ceQORH is not a transmembrane protein, bound to membrane through strong hydrophobic interactions (in contrast with IE18, which is not solubilized using Na2CO3treatment; Fig. 3 A, lane 5). Indeed, these observations are consistent with the predicted hydrophobicity of the ceQORH protein, since no membrane-spanning domain could be predicted from its hydropathy profile (Fig. 1 C). Moreover, salt treatments of envelope vesicles with NaCl (0.5 m) or KI (0.5 m) also induced a partial release of the ceQORH protein in the soluble phase (Fig. 3 A, lanes 3,4). Because ceQORH binding to the membrane is sensitive to high salt concentrations, this suggests that electrostatic interactions play an important role in the ceQORH ability to bind to membranes. Moreover, complete release of the ceQORH protein was achieved with a relatively low (0.2%) concentration of Triton X-100 (Fig.3 B), whereas high concentrations are required to release intrinsic membrane proteins (e.g. release of the intrinsic protein IE18 requires a detergent concentration of 2% Triton X-100, see Ref. 24Seigneurin-Berny D. Rolland N. Garin J. Joyard J. Plant J. 1999; 19: 217-228Google Scholar). Taken together, these results indicate that ceQORH is a genuine inner envelope membrane protein. It might be peripherally associated with the membrane via electrostatic interactions, with an intrinsic component of the inner envelope membrane or with the polar surface of this membrane. Moreover, since the recombinant ceQORH protein was, at least in part, soluble when produced in E. coli, this electrostatic interaction might occur via a plant specific posttranslational modification or via interaction with a specific envelope membrane component. Surprisingly, while localized in the inner membrane of the chloroplast envelope, the ceQORH protein does not contain a classical N-terminal additional sequence when compared with bacterial or animal homologues (see later). This observation raised the possibility that, conversely to all other known inner envelope proteins, the ceQORH could be targeted to the inner envelope of the chloroplast without classical cleavage of an N-terminal transit sequence. To test this hypothesis, new peptide sequence informations were required in the N-terminal part of the envelope ceQORH protein. Because the purest chloroplast envelope preparations are obtained from spinach and due to requirement of large amounts of envelope protein to perform this experiment, the natural protein was purified from spinach envelope preparations. Immunopurification of the native spinach ceQORH protein was performed (see supplemental data at http://www.jbc.org) using the polyclonal antibody raised against the Arabidopsis ceQORH and mass spectrometry analyses allowed obtaining several new peptide sequences from this purified protein. These peptide sequences were used to clone the spinach cDNA (1179 nucleotides) coding the ceQORH protein (329 amino acids). Identity of the clone was confirmed, since the nine different peptide sequences were identical to the primary sequence deduced from the spinach cDNA (Fig.4). The spinach ceQORH protein presents 75.1% identity and 88.8% similarity with the ArabidopsisceQORH protein. From screening all available databases, no otherArabidopsis protein was found that presents more than 35% identity with the ceQORH from Arabidopsis or spinach. This strongly suggests that orthologous Arabidopsis and spinach genes encode the two plant proteins. A stop codon, localized in the 5′-UTR of the cDNA and in frame with the spinach ceQORH translation start codon (Fig. 4), was identified by two independent 5′ RACE-PCR amplifications performed with two independent primers, thus suggesting that the 5′-part of the cDNA was complete (Fig. 4). Finally, peptide sequences were obtained that correspond to the N-terminal region of the primary sequence" @default.
• W2036697811 created "2016-06-24" @default.
• W2036697811 creator A5034399082 @default.
• W2036697811 creator A5036769802 @default.
• W2036697811 creator A5040268366 @default.
• W2036697811 creator A5041302589 @default.
• W2036697811 creator A5062001619 @default.
• W2036697811 creator A5072574847 @default.
• W2036697811 creator A5089962591 @default.
• W2036697811 date "2002-12-01" @default.
• W2036697811 modified "2023-10-11" @default.
• W2036697811 title "Non-canonical Transit Peptide for Import into the Chloroplast" @default.
• W2036697811 cites W1035342878 @default.
• W2036697811 cites W1480167546 @default.
• W2036697811 cites W1566157309 @default.
• W2036697811 cites W1660143940 @default.
• W2036697811 cites W1677318110 @default.
• W2036697811 cites W1791589681 @default.
• W2036697811 cites W188565921 @default.
• W2036697811 cites W1950877953 @default.
• W2036697811 cites W1962620463 @default.
• W2036697811 cites W1987184389 @default.
• W2036697811 cites W1989644766 @default.
• W2036697811 cites W1990537473 @default.
• W2036697811 cites W1991963818 @default.
• W2036697811 cites W1991980135 @default.
• W2036697811 cites W1992877362 @default.
• W2036697811 cites W1994224604 @default.
• W2036697811 cites W1995630780 @default.
• W2036697811 cites W2000910904 @default.
• W2036697811 cites W2001150129 @default.
• W2036697811 cites W2011858193 @default.
• W2036697811 cites W2015642465 @default.
• W2036697811 cites W2018169147 @default.
• W2036697811 cites W2025380691 @default.
• W2036697811 cites W2026803445 @default.
• W2036697811 cites W2028266323 @default.
• W2036697811 cites W2032358826 @default.
• W2036697811 cites W2068874557 @default.
• W2036697811 cites W2074330027 @default.
• W2036697811 cites W2083674148 @default.
• W2036697811 cites W2088860711 @default.
• W2036697811 cites W2089823139 @default.
• W2036697811 cites W2093387754 @default.
• W2036697811 cites W2095891553 @default.
• W2036697811 cites W2096152337 @default.
• W2036697811 cites W2098998842 @default.
• W2036697811 cites W2116918100 @default.
• W2036697811 cites W2123145280 @default.
• W2036697811 cites W2133431557 @default.
• W2036697811 cites W2141584092 @default.
• W2036697811 cites W2144283041 @default.
• W2036697811 cites W2145778276 @default.
• W2036697811 cites W2152735008 @default.
• W2036697811 cites W2169575504 @default.
• W2036697811 cites W2412176163 @default.
• W2036697811 cites W4293247451 @default.
• W2036697811 doi "https://doi.org/10.1074/jbc.m207477200" @default.
• W2036697811 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12368288" @default.
• W2036697811 hasPublicationYear "2002" @default.
• W2036697811 type Work @default.
• W2036697811 sameAs 2036697811 @default.
• W2036697811 citedByCount "164" @default.
• W2036697811 countsByYear W20366978112012 @default.
• W2036697811 countsByYear W20366978112013 @default.
• W2036697811 countsByYear W20366978112014 @default.
• W2036697811 countsByYear W20366978112015 @default.
• W2036697811 countsByYear W20366978112016 @default.
• W2036697811 countsByYear W20366978112017 @default.
• W2036697811 countsByYear W20366978112018 @default.
• W2036697811 countsByYear W20366978112019 @default.
• W2036697811 countsByYear W20366978112020 @default.
• W2036697811 countsByYear W20366978112021 @default.
• W2036697811 countsByYear W20366978112022 @default.
• W2036697811 countsByYear W20366978112023 @default.
• W2036697811 crossrefType "journal-article" @default.
• W2036697811 hasAuthorship W2036697811A5034399082 @default.
• W2036697811 hasAuthorship W2036697811A5036769802 @default.
• W2036697811 hasAuthorship W2036697811A5040268366 @default.
• W2036697811 hasAuthorship W2036697811A5041302589 @default.
• W2036697811 hasAuthorship W2036697811A5062001619 @default.
• W2036697811 hasAuthorship W2036697811A5072574847 @default.
• W2036697811 hasAuthorship W2036697811A5089962591 @default.
• W2036697811 hasBestOaLocation W20366978111 @default.
• W2036697811 hasConcept C104317684 @default.
• W2036697811 hasConcept C127413603 @default.
• W2036697811 hasConcept C185592680 @default.
• W2036697811 hasConcept C22212356 @default.
• W2036697811 hasConcept C2778022998 @default.
• W2036697811 hasConcept C2779281246 @default.
• W2036697811 hasConcept C2909256915 @default.
• W2036697811 hasConcept C3018844941 @default.
• W2036697811 hasConcept C539828613 @default.
• W2036697811 hasConcept C55493867 @default.
• W2036697811 hasConcept C69305403 @default.
• W2036697811 hasConcept C70721500 @default.
• W2036697811 hasConcept C86803240 @default.
• W2036697811 hasConcept C93829228 @default.

• next