FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2036761446> ?p ?o ?g. }

• W2036761446 endingPage "30733" @default.
• W2036761446 startingPage "30725" @default.
• W2036761446 abstract "Inducible p53-independent regulation of the cyclin-dependent kinase inhibitor p21 waf1 transcription is mediated through proximal GC-rich sites. Prior studies have shown that Sp1, Sp3, and the histone acetylase co-activator p300 are components of the complexes binding to these sites. Although Sp1 and Sp3 collaborate with p300, a direct interaction between Sp1 and p300 does not occur. This study sought to determine whether ZBP-89 rather than Sp1 is the direct target of p300 during butyrate induction of p21 waf1 . ZBP-89 (BFCOL1, BERF-1, ZNF 148) is a Krüppel-type zinc finger transcription factor that binds to GC-rich elements and represses or activates known target genes. Adenoviral-mediated expression of ZBP-89 in HT-29 cells revealed that ZBP-89 potentiates butyrate induction of endogenous p21 waf1 gene expression. Further, cotransfection of a ZBP-89 expression vector with a 2.3-kilobase p21 waf1 reporter recapitulated the potentiation by butyrate. DNase I footprinting analysis of the human p21 waf1 promoter with recombinant ZBP-89 identified a binding site at −245 to −215. Electrophoretic mobility shift assays confirmed that both recombinant and endogenous ZBP-89 and Sp1 bind to this element. The potentiation was abolished in the presence of adenoviral protein E1A. Deletion of the N-terminal domain of ZBP-89 abolished the potentiation mediated by butyrate treatment. This same deletion mutant abolished the ZBP-89 interaction with p300. Cotransfection of p300 with ZBP-89 stimulated the p21 waf1 promoter in the absence of butyrate. p300 co-precipitated with ZBP-89 but not with Sp1, whereas ZBP-89 co-precipitated with Sp1. Together, these findings demonstrate that ZBP-89 also plays a critical role in butyrate activation of the p21 waf1 promoter and reveals preferential cooperation of this four-zinc finger transcription factor with p300. Inducible p53-independent regulation of the cyclin-dependent kinase inhibitor p21 waf1 transcription is mediated through proximal GC-rich sites. Prior studies have shown that Sp1, Sp3, and the histone acetylase co-activator p300 are components of the complexes binding to these sites. Although Sp1 and Sp3 collaborate with p300, a direct interaction between Sp1 and p300 does not occur. This study sought to determine whether ZBP-89 rather than Sp1 is the direct target of p300 during butyrate induction of p21 waf1 . ZBP-89 (BFCOL1, BERF-1, ZNF 148) is a Krüppel-type zinc finger transcription factor that binds to GC-rich elements and represses or activates known target genes. Adenoviral-mediated expression of ZBP-89 in HT-29 cells revealed that ZBP-89 potentiates butyrate induction of endogenous p21 waf1 gene expression. Further, cotransfection of a ZBP-89 expression vector with a 2.3-kilobase p21 waf1 reporter recapitulated the potentiation by butyrate. DNase I footprinting analysis of the human p21 waf1 promoter with recombinant ZBP-89 identified a binding site at −245 to −215. Electrophoretic mobility shift assays confirmed that both recombinant and endogenous ZBP-89 and Sp1 bind to this element. The potentiation was abolished in the presence of adenoviral protein E1A. Deletion of the N-terminal domain of ZBP-89 abolished the potentiation mediated by butyrate treatment. This same deletion mutant abolished the ZBP-89 interaction with p300. Cotransfection of p300 with ZBP-89 stimulated the p21 waf1 promoter in the absence of butyrate. p300 co-precipitated with ZBP-89 but not with Sp1, whereas ZBP-89 co-precipitated with Sp1. Together, these findings demonstrate that ZBP-89 also plays a critical role in butyrate activation of the p21 waf1 promoter and reveals preferential cooperation of this four-zinc finger transcription factor with p300. base pair(s) electrophoretic mobility shift assay ornithine decarboxylase trichostatin A kilobase(s) polymerase chain reaction cytomegalovirus DNA affinity precipitation assay(s) glutathione S-transferase The cyclin-dependent kinase inhibitor p21 waf1 controls cell cycle progression through binding to G1cyclin/CDK complexes (1Harper J.W. Adami G.R. Wei N. Keyomarsi K. Elledge S.J. Cell. 1993; 75: 805-816Abstract Full Text PDF PubMed Scopus (5201) Google Scholar, 2Harper J.W. Elledge S.J. Keyomarsi K. Dynlacht B. Tsai L.H. Zhang P. Dobrowolski S. Bai C. Connell-Crowley L. Swindell E. Mol. Biol. Cell. 1995; 6: 387-400Crossref PubMed Scopus (849) Google Scholar, 3Xiong Y. Hannon G.J. Zhang H. Casso D. Kobayashi R. Beach D. Nature. 1993; 366: 701-704Crossref PubMed Scopus (3141) Google Scholar). DNA damage stimulates p21 waf1 transcription through p53-dependent mechanisms (4Dulic V. Kaufmann W.K. Wilson S.J. Tlsty T.D. Lees E. Harper J.W. Elledge S.J. Reed S.I. Cell. 1994; 76: 1013-1023Abstract Full Text PDF PubMed Scopus (1412) Google Scholar), whereas agents that regulate cellular differentiation may regulate p21 waf1 transcription through p53-independent mechanisms (5Gartel A.L. Tyner A.L. Exp. Cell Res. 1999; 246: 280-289Crossref PubMed Scopus (576) Google Scholar). Many of the studies reporting p53-independent regulation of p21 waf1 transcription demonstrate a requirement for GC-rich sites located within the first 100 bp1 of its promoter (6Owen G.I. Richer J.K. Tung L. Takimoto G. Horwitz K.B. J. Biol. Chem. 1998; 273: 10696-10701Abstract Full Text Full Text PDF PubMed Scopus (314) Google Scholar, 7Prowse D.M. Bolgan L. Molnar A. Dotto G.P. J. Biol. Chem. 1997; 272: 1308-1314Abstract Full Text Full Text PDF PubMed Scopus (125) Google Scholar). These sites have consistently been shown to bind members of the Sp family of transcription factors (8Nakano K. Mizuno T. Sowa Y. Orita T. Yoshino T. Okuyama Y. Fujita T. Ohtani-Fujita N. Matsukawa Y. Tokino T. Yamagishi H. Oka T. Nomura H. Sakai T. J. Biol. Chem. 1997; 272: 22199-22206Abstract Full Text Full Text PDF PubMed Scopus (372) Google Scholar, 9Sowa Y. Orita T. Minamikawa-Hiranabe S. Mizuno T. Nomura H. Sakai T. Cancer Res. 1999; 59: 4266-4270PubMed Google Scholar, 10Billon N. Carlisi D. Datto M.B. van Grunsven L.A. Watt A. Wang X.F. Rudkin B.B. Oncogene. 1999; 18: 2872-2882Crossref PubMed Scopus (121) Google Scholar, 11Moustakas A. Kardassis D. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 6733-6738Crossref PubMed Scopus (319) Google Scholar, 12Li J.M. Datto M.B. Shen X. Hu P.P., Yu, Y. Wang X.F. Nucleic Acids Res. 1998; 26: 2449-2456Crossref PubMed Scopus (91) Google Scholar, 13Kivinen L. Tsubari M. Haapajarvi T. Datto M.B. Wang X.F. Laiho M. Oncogene. 1999; 18: 6252-6261Crossref PubMed Scopus (58) Google Scholar). Several studies have shown that Sp1 or Sp3 mediate activation of the p21 waf1 promoter by these extracellular regulators such as nerve growth factor and transforming growth factor-β; however, these same signals do not stimulate Sp1 binding or gene expression (10Billon N. Carlisi D. Datto M.B. van Grunsven L.A. Watt A. Wang X.F. Rudkin B.B. Oncogene. 1999; 18: 2872-2882Crossref PubMed Scopus (121) Google Scholar). The transcriptional co-activator p300 mediates growth arrest by catalyzing histone acetylation and subsequent chromatin rearrangements through its endogenous acetyltransferase enzyme activity (14Giordano A. Avantaggiati M.L. J. Cell. Physiol. 1999; 181: 218-230Crossref PubMed Scopus (252) Google Scholar). Taken together, these results raised the possibility that Sp1 transcriptional activity may be regulated by its association with a co-activator. As a result, the p300 co-activator was shown to co-precipitate in complexes with Sp1 (10Billon N. Carlisi D. Datto M.B. van Grunsven L.A. Watt A. Wang X.F. Rudkin B.B. Oncogene. 1999; 18: 2872-2882Crossref PubMed Scopus (121) Google Scholar). Moreover, activation of the p21 waf1 promoter by butyrate and nerve growth factor has been shown to require a functional collaboration between Sp1 and p300 (10Billon N. Carlisi D. Datto M.B. van Grunsven L.A. Watt A. Wang X.F. Rudkin B.B. Oncogene. 1999; 18: 2872-2882Crossref PubMed Scopus (121) Google Scholar, 15Xiao H. Hasegawa T. Isobe K. J. Biol. Chem. 2000; 275: 1371-1376Abstract Full Text Full Text PDF PubMed Scopus (157) Google Scholar). Yet, p300 does not interact directly with Sp1 or Sp3 (15Xiao H. Hasegawa T. Isobe K. J. Biol. Chem. 2000; 275: 1371-1376Abstract Full Text Full Text PDF PubMed Scopus (157) Google Scholar). Thus, although p300 and Sp1 are components of the complex activating p21 waf1 , the interaction is indirect raising the possibility that other factors are likely to participate in this transcriptional regulatory complex. Presumably, at least one or more of these other factors are capable of direct contact with p300. ZBP-89 (BFCOL1, BERF1, ZNF 148) is a widely expressed four-zinc finger transcription factor that binds to GC-rich DNA elements in a variety of promoters involved in growth regulation, e.g. promoters for gastrin, T-cell α- and β- receptors, ornithine decarboxylase (ODC), enolase, type I procollagen, cyclin-dependent inhibitor p21 waf1 , vimentin, and stromelysin (16Merchant J.L. Iyer G.R. Taylor B.R. Kitchen J.R. Mortensen E.R. Wang Z. Flintoft R.J. Michel J. Bassel-Duby R. Mol. Cell. Biol. 1996; 16: 6644-6653Crossref PubMed Scopus (114) Google Scholar, 17Wang Y. Kobori T.A. Hood L. Mol. Cell. Biol. 1993; 13: 5691-5701Crossref PubMed Google Scholar, 18Reizis B. Leder P. J. Exp. Med. 1999; 189: 1669-1678Crossref PubMed Scopus (48) Google Scholar, 19Law G.L. Itoh H. Law D.J. Mize G.J. Merchant J.L. Morris D.R. J. Biol. Chem. 1998; 273: 19955-19964Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar, 20Passantino R. Antona V. Barbieri G. Rubino P. Melchionna R. Cossu G. Feo S. Giallongo A. J. Biol. Chem. 1998; 273: 484-494Abstract Full Text Full Text PDF PubMed Scopus (54) Google Scholar, 21Hasegawa T. Takeuchi A. Miyaishi O. Isobe K. de Crombrugghe B. J. Biol. Chem. 1997; 272: 4915-4923Abstract Full Text Full Text PDF PubMed Scopus (71) Google Scholar, 22Wieczorek E. Lin S. Perkins E.B. Law D.J. Merchant J.L. Zehner Z.E. J. Biol. Chem. 2000; 275: 12879-12888Abstract Full Text Full Text PDF PubMed Scopus (56) Google Scholar, 23Ye S. Whatling C. Watkins H. Henney A. FEBS Lett. 1999; 450: 268-272Crossref PubMed Scopus (54) Google Scholar). In many instances, ZBP-89 appears to repress promoter activity by opposing the effect of Sp1, which also binds to the same or overlapping DNA element. Thus, competitive binding to the shared promoter elements may mediate transcriptional regulation by Sp1 and ZBP-89 (16Merchant J.L. Iyer G.R. Taylor B.R. Kitchen J.R. Mortensen E.R. Wang Z. Flintoft R.J. Michel J. Bassel-Duby R. Mol. Cell. Biol. 1996; 16: 6644-6653Crossref PubMed Scopus (114) Google Scholar, 19Law G.L. Itoh H. Law D.J. Mize G.J. Merchant J.L. Morris D.R. J. Biol. Chem. 1998; 273: 19955-19964Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar). ZBP-89 and Sp1 may also regulate transcription cooperatively because it has been shown that ZBP-89 directly binds Sp1 in co-precipitation assays (22Wieczorek E. Lin S. Perkins E.B. Law D.J. Merchant J.L. Zehner Z.E. J. Biol. Chem. 2000; 275: 12879-12888Abstract Full Text Full Text PDF PubMed Scopus (56) Google Scholar). Studies by Hasegawa et al. (24Hasegawa T. Xiao H. Isobe K.-i. Biochem. Biophys. Res. Commun. 1999; 256: 249-254Crossref PubMed Scopus (37) Google Scholar) showed binding of ZBP-89 to a proximal Sp1 element from the mouse p21 waf1 promoter. We hypothesized that ZBP-89 may be present in the p300/Sp1 activation complex and participate in the activation of p21 waf1 transcription. p21 waf1 is required for butyrate-mediated growth inhibition in HT-29 colorectal adenocarcinoma cells (25Archer S.Y. Meng S. Shei A. Hodin R.A. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 6791-6796Crossref PubMed Scopus (497) Google Scholar, 26Siavoshian S. Segain J.P. Kornprobst M. Bonnet C. Cherbut C. Galmiche J.P. Blottiere H.M. Gut. 2000; 46: 507-514Crossref PubMed Scopus (235) Google Scholar). Thus the goals of this study were to examine the role of ZBP-89 in p21 waf1 activation by butyrate. The results demonstrate that both ZBP-89 and Sp1 recognize the same p21 waf1 regulatory sequences and that ZBP-89-dependent activation depends upon elevated histone acetyltransferase activity. We also found that Sp1, as reported (15Xiao H. Hasegawa T. Isobe K. J. Biol. Chem. 2000; 275: 1371-1376Abstract Full Text Full Text PDF PubMed Scopus (157) Google Scholar), does not directly bind p300. Instead, we find that p300 cooperates directly with ZBP-89. The human p21 waf1 reporter construct p21 waf1 /2300-Luc, which contains the human p21 waf1 promoter from −2326 to +16 ligated upstream of the luciferase cDNA, was a kind gift from Dr. W. El-Deiry (University of Pennsylvania). The pRcRSV/E1A-12S, pRcRSV/E1A-RG2, and pcDNA3/p300 expression vector, were gifts from Dr. Roland Kwok (University of Michigan). pBL9 E1A 12S ΔCR2 is a gift from Dr. Tony Kouzarides (Wellcome/CRC Institute, Cambridge University). An ODC reporter construct was prepared by inserting the 2.3-kb KpnI-HindIII fragment from the p2.3SK6.1 plasmid (a gift from M. A. Flanagan, Merrill Dow) into pGL2 Basic (Promega, Madison, WI). The resulting ODC promoter construct pODC2300-Luc contained ∼1.5 kb of 5′ flanking sequence and 0.8 kb of downstream sequences including the first exon. The rat ZBP-89 construct subcloned into pBKCMV (pCMV/rZBP-89) (Stratagene, La Jolla, CA) has been previously reported (16Merchant J.L. Iyer G.R. Taylor B.R. Kitchen J.R. Mortensen E.R. Wang Z. Flintoft R.J. Michel J. Bassel-Duby R. Mol. Cell. Biol. 1996; 16: 6644-6653Crossref PubMed Scopus (114) Google Scholar). A Tet-on inducible ZBP-89 expression vector (pBI-G/rZBP-89) was prepared by subcloning the full-length rat ZBP-89 cDNA as a blunt PCR fragment into the filled-in SalI site of the pBI-G vector (CLONTECH, Palo Alto, CA). Deletions of pCMV/rZBP-89 expression vectors were prepared using PCR-generated fragments containing 5′NheI and 3′NotI sites followed by cohesive ligation into the pBKCMV vector. The C-terminal deletion (ΔC-ter) containing residues 1 to 521 of rZBP-89 in pBKCMV (Stratagene) has been previously reported (16Merchant J.L. Iyer G.R. Taylor B.R. Kitchen J.R. Mortensen E.R. Wang Z. Flintoft R.J. Michel J. Bassel-Duby R. Mol. Cell. Biol. 1996; 16: 6644-6653Crossref PubMed Scopus (114) Google Scholar). Deletion of the acidic domain (Δ2–112); basic domain 2 and C terminus (Δ301–794); the acidic domain and basic domain 1 (Δ2–153); the acidic domain and basic domain 2 (Δ2–112 and Δ 301–794) and deletion of both amino and C-terminal domains leaving the zinc finger domain (Δ2–153 and Δ301–794) were all generated by PCR amplification and subsequent subcloning. Deletion of BD1 (Δ142–146 residues KKKKR) was accomplished using the QuickChange Mutation Kit (Stratagene) and the following primers: 5′-CAAGTGAGAGAGCCAGTAGACTTACTCGAGAAACAACGCTCTCCTGCAAAAATC and 5′-GATTTTTGCAGGAGAGCGTTGTTTCTCGAGTAAGTCTACTGGCTCTCTCACTTG-3′. The deletion was confirmed by DNA sequencing. A consensus Kozak sequence (ACCATG) and two tandem repeats of the Myc epitope tag were added to the N terminus. The Myc tag sequence used was: 5′-GAACAAAAACTCATCTCAGAAGAGGATCTGGAACAAAAACTCATCTCAGAAGAGGATCTG-3′. The mutations were confirmed by sequencing, and their expression was confirmed by immunoblot using either rabbit polyclonal ZBP-89 antibody or monoclonal anti-c-Myc antibody (9E10 Santa Cruz, Santa Cruz, CA). The N-terminal Myc-tagged and C-terminal FLAG-tagged full-length rat ZBP-89 expression vector was prepared using the following primers: 5′-TATACCATGGAACAAAAACTCATCTCAGAAGAGGATCTGGAACAAAAACTCATCTCAGAAGAGGATCTGAACATTGACGACAAACTGG-3′ as the forward primer and 5′-ATACTCGAGTCACTTGTCATCGTCGTCCTTGTAGTCCTTGTCATCGTCGTCCTTGTAGTCGCCAAAAGTCTGGCCAG -3′ as the reverse primer. This Myc-ZBP-89-FLAG PCR fragment was blunt end-ligated into the EcoRV and NotI sites of pcDNA3 (Invitrogen, Carlsbad, CA). The orientation was verified by restriction analysis, and the expression was confirmed by anti- FLAG antibody. The resulting plasmid was labeled as pCMV/Myc-ZBP-89-FLAG. To construct a ZBP-89 expressing recombinant adenovirus, the 3.5-kb DNA fragment that contains the ZBP-89 cDNA, CMV promoter, and bovine growth hormone poly(A) signal sequence was excised from pCMV/Myc-ZBP-89-FLAG with NruI and PvuII and then blunt end-ligated into the EcoRV site of the shuttle plasmid pAdMCSloxP (obtained from the University of Michigan Cancer Center Vector Core) (27Aoki K. Barker C. Danthinne X. Imperiale M.J. Nabel G.J. Mol. Med. 1999; 5: 224-231Crossref PubMed Google Scholar). Recombinant replication-deficient adenovirus was produced by the Vector Core using the method of Aoki et al. (27Aoki K. Barker C. Danthinne X. Imperiale M.J. Nabel G.J. Mol. Med. 1999; 5: 224-231Crossref PubMed Google Scholar). Briefly, the ZBP-89 adenoviral shuttle plasmid was recombined with the adenovirus type 5 cosmid, and then transfected into 293T cells. The resultant recombinant adenoviral particles were harvested from the cells and called Ad5-ZBP-89. The Ad5-ZBP-89 viral particles were purified by CsCl centrifugation and titered. The HT-29 human colorectal adenocarcinoma (HTB-38) and HeLa human cervix adenocarcinoma cell lines (CCL-2) were purchased from American Type Culture Collection (Manassas, VA) and cultured in Dulbecco's modified Eagle's medium (Life Technologies, Inc.) containing 10% fetal calf serum, 100 μg/ml penicillin, and 100 μg/ml streptomycin in a humidified atmosphere of 5% CO2 and 95% air at 37 °C. The 293/Tet-on cells were purchased from CLONTECH. Sodium butyrate and trichostatin A (TSA) were purchased from Sigma and used at final concentrations of 5 mm and 0.3 μm, respectively. The cells were plated in six-well plates and transiently transfected using FuGENE 6 (Roche Molecular Biochemicals). The p21 waf1 reporter plasmid p21 waf1 /2300-Luc and ODC reporter plasmid pODC2300-Luc were cotransfected with the pCMV/rZBP-89 expression vector (16Merchant J.L. Iyer G.R. Taylor B.R. Kitchen J.R. Mortensen E.R. Wang Z. Flintoft R.J. Michel J. Bassel-Duby R. Mol. Cell. Biol. 1996; 16: 6644-6653Crossref PubMed Scopus (114) Google Scholar). 48 h after transfection, the cells were harvested for luciferase, β-galactosidase, and protein assays. At least three transfections in triplicate were performed with each promoter construct. In experiments using butyrate or TSA, the luciferase activity was normalized to cell protein because these treatments stimulated the CMV promoter expressing β-galactosidase. However, in the absence of butyrate or TSA treatment, β-galactosidase was used to normalize transfections, and no significant differences in plasmid transfection efficiency were detected. Induction of the Tet-on promoter was accomplished with 2 μg/ml doxycycline. HT-29 cells were cultured in McCoy's 5A medium, grown to 50% confluence, and then infected with the recombinant adenoviral particles (Ad5 vector or Ad5-ZBP-89) in F12 serum-free medium (Life Technologies, Inc.) at 5 × 107 viral particles/5 × 106cells/100-mm plate (equivalent to 10 multiplicities of infection) for 6 h. The Ad5 vector, which contains the CMV promoter alone and the poly(A) sequence, was used as a control at the same multiplicity of infection. After infection, the viral particles were washed off, and fresh medium containing serum was added. 36 h later, the cells were treated with or without 5 mm sodium butyrate for another 12 h before they were processed for immunoblot analysis. 50 μg of whole cell extracts were separated on a 4–12% NuPAGE Bis-Tris gradient gel (Novex) and then transferred to polyvinylidene fluoride membrane for immunoblot analysis with designated antibodies. Enhanced chemiluminescence was used to detect the antigen-antibody complexes. The anti-FLAG M1 monoclonal antibody was purchased from Sigma, and the anti-actin (C-2) and anti-p21 waf1 (F-5) monoclonal antibodies were purchased from Santa Cruz Biotechnology. Riboprobes were generated from antisense templates for human ZBP-89 and human cyclophilin. The human ZBP-89 antisense template was constructed using the human ZBP-89 cDNA fragment (28Law D.J. Tarle S.A. Merchant J.L. Mamm. Genome. 1998; 9: 165-167Crossref PubMed Scopus (32) Google Scholar), from +382 to +639 amplified with 5′-GATGAGAGACAAAAAACAAATCAGAGAGCCAGTAGAC-3′ as the forward primer and 5′-GGTACTTCTGTATGAAACGCATGTACAATTGACTAC-3′ as the reverse primer. The PCR product generated was inserted into the pCR2.1 vector (InVitrogen) and sequenced to confirm the orientation. The template was linearized with AccI and used to transcribe a 290-nucleotide ZBP-89 antisense riboprobe that protected a 257-nucleotide fragment. The human pTRI-cyclophilin template (Ambion) generated a 165-nucleotide probe and a 103-nucleotide protected fragment. All riboprobes were prepared using MAXIscript In Vitro Transcription Kit (Ambion). Total RNA was isolated from butyrate-treated HT-29 cells using TRIZOL reagent (Life Technologies, Inc.) and then mRNA extracted using poly(A)Ttract mRNA Isolation System (Promega). Total RNA was hybridized for 16 h with riboprobes at 45 °C in hybridization buffer (1 mm EDTA, 300 mm sodium acetate, pH 6.4, 100 mm sodium citrate, pH 6.4, 80% deionized formamide). After hybridization, the samples were digested at 37 °C for 30 min in an RNase A/T1 mixture containing 60 units/ml RNase A, 250 units RNase T1 (Ambion) in digestion buffer (300 mm NaCl, 10 mm Tris, pH 7.4, 5 mmEDTA). The protected fragment was precipitated in isopropanol, dissolved in loading buffer (95% formamide, 0.025% xylene cyanol, 0.025% bromphenol blue, 0.5 mm EDTA, 0.025% SDS), and then resolved on a 6% polyacrylamide, 8 m urea gel. Protected fragments were quantified on a PhosphorImager and normalized to cyclophilin mRNA levels. Coprecipitation of ZBP-89 with p300, CBP, E1A, or Sp1 antibody was performed in 293T cells stably transfected with the pTet-on repressor (CLONTECH) and then transiently transfected with pBI-G/rZBP-89 using FuGENE6. The cells were treated with or without 2 μg/ml doxycycline to induce ZBP-89 production. The 293T cells were lysed in RIPA buffer (1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS, 1 mmdithiothreitol in phosphate-buffered saline), and the protein concentration was determined. Whole cell extracts were precleared with rabbit preimmune serum and protein A/G-agarose (Santa Cruz) at 4 °C for 30 min. The supernatant was incubated with the primary antibody (5–10 μg) for 1 h at 4 °C followed by the addition of 20 μl of Protein A/G-Agarose for another 16 h. The pellets were collected and washed with RIPA buffer three times. The proteins were separated on a 4–12% NuPAGE Bis-Tris gel (Novex) and then transferred to polyvinylidene fluoride membrane for immunoblot analysis with designated antibodies. Enhanced chemiluminescence was used to detect the antigen-antibody complex. E1A, p300, CBP, and Sp1 antibodies were purchased from Santa Cruz Biotechnology. Recombinant ZBP-89 protein was prepared as described previously (16Merchant J.L. Iyer G.R. Taylor B.R. Kitchen J.R. Mortensen E.R. Wang Z. Flintoft R.J. Michel J. Bassel-Duby R. Mol. Cell. Biol. 1996; 16: 6644-6653Crossref PubMed Scopus (114) Google Scholar). Protein concentration was determined by the method of Bradford (29Bradford M.M. Anal. Biochem. 1976; 72: 248-254Crossref PubMed Scopus (211983) Google Scholar). To footprint ZBP-89-binding sites from −556 to +6, the 560-bp fragment was PCR amplified from p21 waf1 /2300-Luc with forward primer 5′-TTCTGGGAGAGGTGACCTAGT-3′ and reverse primer 5′-CTTCGGCAGCTGCTCACACC-3′. The fragment was end labeled with T4 polynucleotide kinase then digested with BstEII to make the labeled antisense strand. To footprint the proximal p21 waf1 promoter elements, p21 waf1 /300-Luc corresponding to −291 to +16 was digested with XbaI, end labeled with T4 polynucleotide kinase at +16, and digested with HindIII. The resulting probe was used to footprint the antisense strand. To footprint the sense strand, the same DNA fragment was restricted with SacI and HindIII, end-labeled with T4 polynucleotide kinase, and then digested with XbaI. Footprinting assays were performed with recombinant ZBP-89 prepared as described above. Recombinant ZBP-89 was incubated first with probe on ice for 20 min in the binding buffer (25 mm Tris-HCl, pH 8.0, 50 mm KCl, 6.25 mm MgCl2, 0.5 mm EDTA, 10% glycerol, 0.5 mm dithiothreitol, 5% polyvinyl alcohol, 2 μg/ml poly(dI-dC). DNase I digestion was then carried out for 1 min, and phenol/chloroform was extracted prior to resolving on 6% polyacrylamide, 8 m urea gel. The Maxim-Gilbert G+A ladder was prepared using the probe DNA fragments (30Ausubel F.M. Brent R. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Current Protocols in Molecular Biology. Greene Publishing Associates, New York1991: 7.5.1-7.5.9Google Scholar). HT-29 nuclear extract was prepared by the Dignam method without dialysis (31Dignam J.D. Lebovitz R.M. Roeder R.G. Nucleic Acids Res. 1983; 11: 1475-1489Crossref PubMed Scopus (9132) Google Scholar). A double-stranded oligonucleotide probe corresponding to the p21 waf1 promoter −245 to −215 (5′-GAGGGACTGGGGGAGGAGGGAAGTGCCCTC-3′) was end labeled with T4 polynucleotide kinase. The probe was purified using Quick Spin G-25 columns (Roche Molecular Biochemicals). Recombinant ZBP-89, affinity-purified Sp1 (Promega), or nuclear extract was incubated with radiolabeled probe (30,000 cpm/0.2–1 ng) in a final volume of 20 μl containing 10 mm Tris-HCl, pH 8.0, 1 mmZnCl2, 120 mm KCl, 1 mm EDTA, 1 μg poly(dI-dC), 1 μg of bovine serum albumin, 1 mmdithiothreitol, 5 mm MgCl2, 10% glycerol at room temperature for 15 min before resolving on a 4% nondenaturing polyacrylamide gel containing 45 mm Tris base, 45 mm boric acid, and 1 mm EDTA. The EMSAs were resolved at 200 V for 2–6 h at 4 °C. To perform supershift EMSAs, the protein was incubated first with each antibody for 30 min on ice followed by the addition of probe and incubation for 15 min at room temperature. Antibodies to Sp1 were purchased from Santa Cruz Biotechnology. Rabbit ZBP-89 antiserum was prepared as described previously (32Taniuchi T. Mortensen E.R. Ferguson A. Greenson J. Merchant J.L. Biochem. Biophys. Res. Commun. 1997; 233: 154-160Crossref PubMed Scopus (37) Google Scholar), and the IgG fraction was prepared using protein A-agarose (Santa Cruz). Quantitation of the changes in ZBP-89 and Sp1 binding to the p21 waf1 promoter element was achieved by DNA affinity precipitation assays (DAPA) according to the method of Billon et al. (10Billon N. Carlisi D. Datto M.B. van Grunsven L.A. Watt A. Wang X.F. Rudkin B.B. Oncogene. 1999; 18: 2872-2882Crossref PubMed Scopus (121) Google Scholar). Briefly, oligonucleotides biotinylated at the 5′-termini and corresponding to the sense −242 to −212 (5′-GGACTGGGGGAGGAGGGAAGTGCCCTCCCT), and antisense strands of the p21 waf1 element were annealed. The DAPA was performed by incubating 2 μg of biotinylated DNA probe with 300 μg of HT-29 whole cell extracts in binding buffer containing 20 mmHEPES, pH 7.9, 10% glycerol, 50 mm KCl, 0.2 mmEDTA, 1.5 mm MgCl2, 20 μmZnCl2, 1 mm dithiothreitol, and 0.25% Triton X-100. The mixture was incubated on ice for 30 min prior to adding 100 μl of streptavidin-agarose (Novagen). 2 h later, the agarose beads were collected and rinsed with binding buffer three times. Protein was eluted from the DNA probe by adding Laemmli loading buffer and heating to 90 °C for 5 min. The eluted protein was resolved on a SDS 4–12% polyacrylamide gel (Novex) transferred to polyvinylidene fluoride membrane followed by immunoblot analysis for ZBP-89 or Sp1 protein levels. To analyze changes in ZBP-89 and Sp1 protein after butyrate treatment over 1 h, immunoblot analysis was performed on the same extracts used for the DAPA. Whole cell or nuclear extracts were prepared from HT-29 cells, separated on a 4–12% NuPAGE Bis-Tris gel (Novex), and transferred to polyvinylidene fluoride membrane. The membrane was blocked for 1 h in 0.5× UniBlock (Analytical Genetic Testing Center) at room temperature. ZBP-89 and Sp1 antibodies were used to detect the respective proteins. Butyrate stimulates expression of the cyclin-dependent inhibitor, p21 waf1 , within the first 24 h of treatment (25Archer S.Y. Meng S. Shei A. Hodin R.A. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 6791-6796Crossref PubMed Scopus (497) Google Scholar, 26Siavoshian S. Segain J.P. Kornprobst M. Bonnet C. Cherbut C. Galmiche J.P. Blottiere H.M. Gut. 2000; 46: 507-514Crossref PubMed Scopus (235) Google Scholar). To examine whether butyrate stimulates ZBP-89 gene expression, HT-29 cells were treated with 5 mm butyrate over 5 days (Fig.1). The results show that ZBP-89 mRNA increased within 24 h but was maximal (10-fold) after 5 days of treatment. This time course correlated with the expected morphologic and biochemical changes previously described for HT-29 cells (33Barnard J.A. Warwick G. Cell Growth Differ. 1993; 4: 495-501PubMed Google Scholar). Therefore butyrate activates both p21 waf1 and ZBP-89 gene expression. A potential mechanism of ZBP-89 growth repression may be due to direct binding to the p21 waf1 promoter. To determine whether ZBP-89 stimulates endogenous p21 waf1 gene expression, HT-29 cells were infected with adenoviral particles expressing ZBP-89 (Fig.2 A). Anti-FLAG antibody was used to distinguish transfected ZBP-89 expression from endogenous ZBP-89 protein. The same membrane was reprobed with antibodies to ZBP-89, p21 waf1 and actin. There was little effect of ZBP-89 on the endogenous level of p21 waf1 protein in the absence of butyrate. However, in the presence of butyrate, there was a 3-fold enhancement of elevated p21 waf1 protein levels in the presence of elevated ZBP-89 protein expression. Cotransfection of the p21 waf1 promoter with a ZBP-89 expression vector slightly repressed basal promoter activity (Fig. 2 B). However, in the presence of sodium butyrate, ZBP-89 potentiated the induction of p21" @default.
• W2036761446 created "2016-06-24" @default.
• W2036761446 creator A5042603101 @default.
• W2036761446 creator A5049458323 @default.
• W2036761446 date "2000-09-01" @default.
• W2036761446 modified "2023-10-16" @default.
• W2036761446 title "Transcription Factor ZBP-89 Cooperates with Histone Acetyltransferase p300 during Butyrate Activation of p21 Transcription in Human Cells" @default.
• W2036761446 cites W1511815964 @default.
• W2036761446 cites W1643056575 @default.
• W2036761446 cites W1969526991 @default.
• W2036761446 cites W1978743225 @default.
• W2036761446 cites W1984400784 @default.
• W2036761446 cites W1989142029 @default.
• W2036761446 cites W1990743609 @default.
• W2036761446 cites W1993243592 @default.
• W2036761446 cites W1997759424 @default.
• W2036761446 cites W1998931004 @default.
• W2036761446 cites W2009616940 @default.
• W2036761446 cites W2038146865 @default.
• W2036761446 cites W2045294448 @default.
• W2036761446 cites W2049986428 @default.
• W2036761446 cites W2050198431 @default.
• W2036761446 cites W2062809474 @default.
• W2036761446 cites W2070061120 @default.
• W2036761446 cites W2072088194 @default.
• W2036761446 cites W2072487136 @default.
• W2036761446 cites W2079102916 @default.
• W2036761446 cites W2081085542 @default.
• W2036761446 cites W2082451220 @default.
• W2036761446 cites W2085195718 @default.
• W2036761446 cites W2088713375 @default.
• W2036761446 cites W2089218510 @default.
• W2036761446 cites W2092722802 @default.
• W2036761446 cites W2096654038 @default.
• W2036761446 cites W2102065925 @default.
• W2036761446 cites W2108048093 @default.
• W2036761446 cites W2108723275 @default.
• W2036761446 cites W2108954781 @default.
• W2036761446 cites W2113210499 @default.
• W2036761446 cites W2123687793 @default.
• W2036761446 cites W2135206918 @default.
• W2036761446 cites W2147242002 @default.
• W2036761446 cites W2149401540 @default.
• W2036761446 cites W2157742504 @default.
• W2036761446 cites W2160759942 @default.
• W2036761446 cites W2166091854 @default.
• W2036761446 cites W2166749754 @default.
• W2036761446 cites W2331676402 @default.
• W2036761446 cites W4238956259 @default.
• W2036761446 cites W4293247451 @default.
• W2036761446 cites W61556301 @default.
• W2036761446 doi "https://doi.org/10.1074/jbc.m004249200" @default.
• W2036761446 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10899165" @default.
• W2036761446 hasPublicationYear "2000" @default.
• W2036761446 type Work @default.
• W2036761446 sameAs 2036761446 @default.
• W2036761446 citedByCount "109" @default.
• W2036761446 countsByYear W20367614462012 @default.
• W2036761446 countsByYear W20367614462013 @default.
• W2036761446 countsByYear W20367614462014 @default.
• W2036761446 countsByYear W20367614462015 @default.
• W2036761446 countsByYear W20367614462016 @default.
• W2036761446 countsByYear W20367614462017 @default.
• W2036761446 countsByYear W20367614462018 @default.
• W2036761446 countsByYear W20367614462019 @default.
• W2036761446 countsByYear W20367614462020 @default.
• W2036761446 countsByYear W20367614462022 @default.
• W2036761446 countsByYear W20367614462023 @default.
• W2036761446 crossrefType "journal-article" @default.
• W2036761446 hasAuthorship W2036761446A5042603101 @default.
• W2036761446 hasAuthorship W2036761446A5049458323 @default.
• W2036761446 hasBestOaLocation W20367614461 @default.
• W2036761446 hasConcept C101762097 @default.
• W2036761446 hasConcept C104317684 @default.
• W2036761446 hasConcept C111936080 @default.
• W2036761446 hasConcept C138885662 @default.
• W2036761446 hasConcept C150194340 @default.
• W2036761446 hasConcept C153911025 @default.
• W2036761446 hasConcept C179926584 @default.
• W2036761446 hasConcept C185592680 @default.
• W2036761446 hasConcept C191163429 @default.
• W2036761446 hasConcept C20291555 @default.
• W2036761446 hasConcept C2778001298 @default.
• W2036761446 hasConcept C41895202 @default.
• W2036761446 hasConcept C54355233 @default.
• W2036761446 hasConcept C57467964 @default.
• W2036761446 hasConcept C64927066 @default.
• W2036761446 hasConcept C86339819 @default.
• W2036761446 hasConcept C86803240 @default.
• W2036761446 hasConcept C95444343 @default.
• W2036761446 hasConceptScore W2036761446C101762097 @default.
• W2036761446 hasConceptScore W2036761446C104317684 @default.
• W2036761446 hasConceptScore W2036761446C111936080 @default.
• W2036761446 hasConceptScore W2036761446C138885662 @default.
• W2036761446 hasConceptScore W2036761446C150194340 @default.
• W2036761446 hasConceptScore W2036761446C153911025 @default.
• W2036761446 hasConceptScore W2036761446C179926584 @default.
• W2036761446 hasConceptScore W2036761446C185592680 @default.

• next