FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2036874807> ?p ?o ?g. }

• W2036874807 endingPage "21628" @default.
• W2036874807 startingPage "21622" @default.
• W2036874807 abstract "Insulin signaling through protein kinase Akt/protein kinase B (PKB), a downstream element of the phosphatidylinositol 3-kinase (PI3K) pathway, regulates diverse cellular functions including metabolic pathways, apoptosis, mitogenesis, and membrane trafficking. To identify Akt/PKB substrates that mediate these effects, we used antibodies that recognize phosphopeptide sites containing the Akt/PKB substrate motif (RXRXX(p)S/T) to immunoprecipitate proteins from insulin-stimulated adipocytes. Tryptic peptides from a 250-kDa immunoprecipitated protein were identified as the protein kinase WNK1 (with no lysine) by matrix-assisted laser desorption ionization time-of-flight mass spectrometry, consistent with a recent report that WNK1 is phosphorylated on Thr60 in response to insulin-like growth factor I. Insulin treatment of 3T3-L1 adipocytes stimulated WNK1 phosphorylation, as detected by immunoprecipitation with antibody against WNK1 followed by immunoblotting with the anti-phosphoAkt substrate antibody. WNK1 phosphorylation induced by insulin was unaffected by rapamycin, an inhibitor of p70 S6 kinase pathway but abolished by the PI3K inhibitor wortmannin. RNA interference-directed depletion of Akt1/PKBα and Akt2/PKBβ attenuated insulin-stimulated WNK1 phosphorylation, but depletion of protein kinase Cλ did not. Whereas small interfering RNA-induced loss of WNK1 protein did not significantly affect insulin-stimulated glucose transport in 3T3-L1 adipocytes, it significantly enhanced insulin-stimulated thymidine incorporation by about 2-fold. Furthermore, depletion of WNK1 promoted serum-stimulated cell proliferation of 3T3-L1 preadipocytes, as evidenced by a 36% increase in cell number after 48 h in culture. These data suggest that WNK1 is a physiologically relevant target of insulin signaling through PI3K and Akt/PKB and functions as a negative regulator of insulin-stimulated mitogenesis. Insulin signaling through protein kinase Akt/protein kinase B (PKB), a downstream element of the phosphatidylinositol 3-kinase (PI3K) pathway, regulates diverse cellular functions including metabolic pathways, apoptosis, mitogenesis, and membrane trafficking. To identify Akt/PKB substrates that mediate these effects, we used antibodies that recognize phosphopeptide sites containing the Akt/PKB substrate motif (RXRXX(p)S/T) to immunoprecipitate proteins from insulin-stimulated adipocytes. Tryptic peptides from a 250-kDa immunoprecipitated protein were identified as the protein kinase WNK1 (with no lysine) by matrix-assisted laser desorption ionization time-of-flight mass spectrometry, consistent with a recent report that WNK1 is phosphorylated on Thr60 in response to insulin-like growth factor I. Insulin treatment of 3T3-L1 adipocytes stimulated WNK1 phosphorylation, as detected by immunoprecipitation with antibody against WNK1 followed by immunoblotting with the anti-phosphoAkt substrate antibody. WNK1 phosphorylation induced by insulin was unaffected by rapamycin, an inhibitor of p70 S6 kinase pathway but abolished by the PI3K inhibitor wortmannin. RNA interference-directed depletion of Akt1/PKBα and Akt2/PKBβ attenuated insulin-stimulated WNK1 phosphorylation, but depletion of protein kinase Cλ did not. Whereas small interfering RNA-induced loss of WNK1 protein did not significantly affect insulin-stimulated glucose transport in 3T3-L1 adipocytes, it significantly enhanced insulin-stimulated thymidine incorporation by about 2-fold. Furthermore, depletion of WNK1 promoted serum-stimulated cell proliferation of 3T3-L1 preadipocytes, as evidenced by a 36% increase in cell number after 48 h in culture. These data suggest that WNK1 is a physiologically relevant target of insulin signaling through PI3K and Akt/PKB and functions as a negative regulator of insulin-stimulated mitogenesis. Protein kinase Akt/PKB 1The abbreviations used are: PKB, protein kinase B; IRS, insulin receptor substrate; KRH, Krebs-Ringer HEPES; PAS, phospho-Akt/PKB substrate; PKC, protein kinase C; PI3K, phosphatidylinositol 3-kinase; MALDI-TOF, matrix-assisted laser desorption ionization time-of-flight; DMEM, Dulbecco's modified Eagle's medium; RNAi, RNA interference; siRNA, small interfering RNA; TUNEL, terminal deoxynucleotidyl transferase-mediated nick end labeling; Erk, extracellular signal-regulated kinase; mTOR, mammalian target of rapamycin. is phosphorylated and activated by phosphoinositide-dependent protein kinase, downstream of PI3K, in cells stimulated by insulin or growth factors. Numerous studies have demonstrated that activation of Akt/PKB is involved in the metabolic and mitogenic functions of insulin including the regulation of gene expression, cell survival, cell growth, glucose transport, protein synthesis, and glycogen synthesis (1Luo J. Manning B.D. Cantley L. Cancer Cell. 2003; 4: 257-261Abstract Full Text Full Text PDF PubMed Scopus (1173) Google Scholar, 2Brazil D.P. Yang Z.-Z. Hemmings B.A. Trends Biochem. Sci. 2004; 29: 233-242Abstract Full Text Full Text PDF PubMed Scopus (723) Google Scholar, 3Whiteman E.L. Cho H. Birnbaum M.J. Trends Endocrinol. Metab. 2002; 13: 444-451Abstract Full Text Full Text PDF PubMed Scopus (566) Google Scholar, 4Saltiel A.R. Kahn C.R. Nature. 2001; 14: 799-806Crossref Scopus (3973) Google Scholar). Akt/PKB regulates cellular functions through phosphorylation of serine and threonine residues in the motif RXRXXS/T of target proteins (5Alessi D.R. Caudwell F.B. Andjelkovic M. Hemmings B.A. Cohen P. FEBS Lett. 1996; 399: 333-338Crossref PubMed Scopus (552) Google Scholar, 6Obata T. Yaffe M.B. Leparc G.G. Piro E.T. Maegawa H. Kashiwagi A. Kikkawa R. Cantley L.C. J. Biol. Chem. 2000; 275: 36108-36115Abstract Full Text Full Text PDF PubMed Scopus (337) Google Scholar, 7Yaffe M.B. Leparc G.G. Lai J. Obata T. Volinia S. Cantley L.C. Nat. Biotechnol. 2001; 19: 348-353Crossref PubMed Scopus (465) Google Scholar). Multiple Akt/PKB substrates have been discovered, including transcription factor FOXO proteins (8Brunet A. Bonni A. Zimond M.J. Lin M.Z. Juo P. Hu L.S. Anderson M.J. Arden K.C. Blenis J. Greenberg M.E. Cell. 1999; 96: 867-868Abstract Full Text Full Text PDF Scopus (5454) Google Scholar, 9Kops G.J. de Ruiter N.D. De Vries-Smits A.M. Powell D.R. Bos J.L. Burgering B.M. Nature. 1999; 398: 630-634Crossref PubMed Scopus (953) Google Scholar, 10Rena G. Guo S. Cichy S.C. Unterman T.G. Cohen P. J. Biol. Chem. 1999; 274: 17179-17183Abstract Full Text Full Text PDF PubMed Scopus (608) Google Scholar, 11Biggs III, W.H. Meisenhelder J. Hunter T. Vavenee W.K. Arden K.C. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 7421-7426Crossref PubMed Scopus (946) Google Scholar), pro-apoptotic factor Bad (12Datta S.R. Dudek H. Tao X. Masters S. Fu H. Gotoh Y. Greenberg M.E. Cell. 1997; 91: 231-241Abstract Full Text Full Text PDF PubMed Scopus (4957) Google Scholar), IκB kinase (13Ozes O.N. Mayo L.D. Gustin J.A. Pfeffer S.R. Pfeffer L.M. Donner D.B. Nature. 1999; 401: 82-85Crossref PubMed Scopus (1904) Google Scholar, 14Romashkova J.A. Makarov S.S. Nature. 1999; 401: 86-90Crossref PubMed Scopus (1670) Google Scholar), mitogenic factor Raf1 (15Rommel C. Clarke B.A. Zimmermann S. Nunez L. Rossman R. Reid K. Moelling K. Yancopoulos G.D. Glass D.L. Science. 1999; 286: 1738-1741Crossref PubMed Scopus (665) Google Scholar, 16Mayo L.D. Donner D.B. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 11598-11603Crossref PubMed Scopus (960) Google Scholar, 17Zhou B.P. Liao Y. Xia W. Zou Y. Spohn B. Hung M.C. Nat. Cell Biol. 2001; 3: 973-982Crossref PubMed Scopus (788) Google Scholar), p53 negative regulator Mdm2 (16Mayo L.D. Donner D.B. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 11598-11603Crossref PubMed Scopus (960) Google Scholar, 17Zhou B.P. Liao Y. Xia W. Zou Y. Spohn B. Hung M.C. Nat. Cell Biol. 2001; 3: 973-982Crossref PubMed Scopus (788) Google Scholar), cyclin-dependent kinase inhibitors p27kip1 (18Liang J. Zubovitz J. Petrocelli T. Kotchetkov R. Connor M.K. Han K. Lee J.H. Ciarallo S. Catzavelos C. Beniston R. Franssen E. Slingerland J.M. Nat. Med. 2002; 8: 1153-1160Crossref PubMed Scopus (815) Google Scholar, 19Shin I. Yakes F.M. Rojo F. Shin N.Y. Bakin A.V. Baselga J. Arteaga C.L. Nat. Med. 2002; 8: 1145-1152Crossref PubMed Scopus (684) Google Scholar, 20Viglietto G. Motti M.L. Bruni P. Melillo R.M. D'Alessio A. Califano D. Vinci F. Chiappetta G. Tsichlis P. Bellacosa A. Fusco A. Santoro M. Nat. Med. 2002; 8: 1136-1144Crossref PubMed Scopus (608) Google Scholar) and p21cip1 (21Zhou B.P. Liao Y. Xia W. Spohn B. Lee M.N. Hung M.C. Nat. Cell Biol. 2001; 3: 245-252Crossref PubMed Scopus (924) Google Scholar), endothelial nitric-oxide synthase (22Fulton D. Gratton J.P. McCabe T.J. Fontana J. Fujio Y. Walsh K. Franke T.F. Papapetropoulos A. Sessa W.C. Nature. 1999; 399: 597-601Crossref PubMed Scopus (2239) Google Scholar, 23Dimmeler S. Fleming I. Fisslthaler B. Hermann C. Busse R. Zeiher A.M. Nature. 1999; 399: 601-605Crossref PubMed Scopus (3056) Google Scholar), glycogen synthase kinase-3 (24Cross D.A. Alessi D.R. Cohen P. Andjelkovic M. Hemmings B.A. Nature. 1995; 378: 785-789Crossref PubMed Scopus (4397) Google Scholar), and the GTPase-activating proteins tuberous sclerosis complex-2 (25Inoki K. Li Y. Zhu T. Wu J. Guan K.L. Nat. Cell Biol. 2002; 4: 648-657Crossref PubMed Scopus (2421) Google Scholar, 26Potter C.J. Pedraza L.G. Xu T. Nat. Cell Biol. 2002; 4: 658-665Crossref PubMed Scopus (782) Google Scholar, 27Dan H.C. Sun M. Yang L. Feldman R.I. Sui X.M. Ou C.C. Nellist M. Yeung S.R. Halley D.J. Nicosia S.V. Pledger W.J. Cheng J.Q. J. Biol. Chem. 2002; 277: 35364-35370Abstract Full Text Full Text PDF PubMed Scopus (329) Google Scholar) and AS160 (28Kane S. Sano H. Liu S.C. Asara J.M. Lane W.S. Garner C.C. Lienhard G.E. J. Biol. Chem. 2002; 277: 22115-22118Abstract Full Text Full Text PDF PubMed Scopus (424) Google Scholar). However, it is possible that other unknown Akt/PKB effectors regulate important cellular responses to insulin. To search for new Akt/PKB substrates, we applied a mass spectrometry-based proteomics approach to identify potential candidates enriched by immunoprecipitation with a polyclonal antibody against the phospho-Akt/PKB substrate (PAS) motif (RXRXXpS/T) (29Zhang H. Zha X. Tan Y. Hornbeck P.V. Mastrangelo A.J. Alessi D.R. Polakiewicz R.D. Comb M.J. J. Biol. Chem. 2002; 277: 39379-39387Abstract Full Text Full Text PDF PubMed Scopus (230) Google Scholar). In this study, we identified the protein kinase WNK1, a newly described protein kinase lacking lysine in kinase subdomain II and implicated in controlling ion permeability (30Xu B. English J.M. Wilsbacher J.L. Stippec S. Goldsmith E.J. Cobb M.H. J. Biol. Chem. 2000; 275: 16795-16801Abstract Full Text Full Text PDF PubMed Scopus (417) Google Scholar, 31Wilson F.H. Disse-Nicodeme S. Choate K.A. Ishikawa K. Nelson-Williams C. Desitter I. Gunel M. Milford D.V. Lipkin G.W. Achard J.M. Feely M.P. Dussol B. Berland Y. Unwin R.J. Mayan H. Simon D.B. Farfel Z. Jeunemaitre X. Lifton R.P. Science. 2001; 293: 1107-1112Crossref PubMed Scopus (1233) Google Scholar, 32Verissimo F. Jordan P. Oncogene. 2001; 20: 5562-5569Crossref PubMed Scopus (226) Google Scholar). We confirmed WNK1 as a novel Akt/PKB substrate in insulin-stimulated 3T3-L1 adipocytes, extending a recent report that insulin-like growth factor I in other cells caused phosphorylation of this kinase on Thr60, a putative Akt/PKB substrate site (33Vitari A.C. Deak M. Collins B.J. Morrice N. Prescott A.R. Phelan A. Humphreys S. Alessi D.R. Biochem. J. 2004; 378: 257-268Crossref PubMed Scopus (78) Google Scholar). RNAi-mediated gene silencing of WNK1 did not alter insulin-sensitive glucose transport in cultured adipocytes, but it did significantly enhance DNA synthesis and cell growth in 3T3-L1 preadipocytes. This suggests that WNK1 may be a negative regulatory element in the insulin signaling pathway involving Akt/PKB that regulates cell proliferation. Materials—Human insulin was obtained from Eli Lilly Co. Goat polyclonal anti-Akt1/PKBα antibody (antigen human Akt1/PKBα peptide near carboxyl terminus, sc-7126), horseradish peroxidase-conjugated donkey anti-goat IgG, and polyclonal anti-PKCλ/ζ (C-20, sc216) were from Santa Cruz Biotech (Santa Cruz, CA). Rabbit polyclonal antibody against Akt2/PKBβ was kindly provided by Dr. Morris J. Birnbaum (University of Pennsylvania). Polyclonal antibodies against phospho-Akt/PKB serine 473, phospho-Erk1/2, and insulin receptor substrate (IRS)-1 were from Cell Signaling Technology (Beverly, MA). Monoclonal phosphotyrosine antibody (4G10) was from Upstate (Charlottesville, VA). Polyclonal antibody against phosphorylated Akt/PKB substrate motif was generated as described previously (29Zhang H. Zha X. Tan Y. Hornbeck P.V. Mastrangelo A.J. Alessi D.R. Polakiewicz R.D. Comb M.J. J. Biol. Chem. 2002; 277: 39379-39387Abstract Full Text Full Text PDF PubMed Scopus (230) Google Scholar). Cell Culture and Transfection of siRNAs—The 3T3-L1 preadipocytes were grown in DMEM supplemented with 10% fetal bovine serum, 50 μg/ml streptomycin, and 50 units/ml penicillin and differentiated into adipocytes as described previously (34Harrison S.A. Buxton J.M. Clancy B.M. Czech M.P. J. Biol. Chem. 1990; 265: 20106-20116Abstract Full Text PDF PubMed Google Scholar). Small interfering RNA duplexes were synthesized and purified by Dharmacon Research, Inc. (Lafayette, CO) and transfected into the 3T3-L1 preadipocytes and adipocytes by electroporation as described previously (35Jiang Z.Y. Zhou Q.L. Colman K.A. Chouinard M. Boese Q. Czech M.P. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 7569-7574Crossref PubMed Scopus (312) Google Scholar). The targeting sequences of each gene are as follows: Akt1/PKBα, AACCAGGACCACGAGAAGCUG; Akt2/PKBβ, GAGAGGACCUUCCAUGUAG and UGCCAUUCUACAACCAGGA; PKCλ (36Zhou Q.L. Park J.G. Jiang Z.Y. Holik J.J. Mitra P. Semiz S. Guilherme A. Powelka A.M. Tang X. Virbasius J. Czech M.P. Biochem. Soc. Trans. 2004; 32: 817-821Crossref PubMed Scopus (74) Google Scholar), GCAGUGAGGUUCGAGAUAU and GCAAACUGCUGGUUCAUAA; WNK1, AAGAUCUUGAUGCUCAGUUGA and AGACGUUGCUUCUGGUAUGA. Immunoprecipitation and Immunoblotting—After experimental treatments, the cells were solubilized in ice-cold lysis buffer containing 50 mm HEPES (pH 7.4), 5 mm sodium pyrophosphate, 5 mm β-glycerophosphate, 10 mm sodium fluoride, 2 mm EDTA, 2 mm Na3VO4, 1 mm phenylmethylsulfonyl fluoride, 10 μg/ml aprotinin, 10 μg/ml leupeptin, and 1% Triton X-100. Total cell lysates of 1–2 mg of protein were immunoprecipitated with antibodies against phospho-Akt/PKB substrates (1:100 dilution) or WNK1 (1:200 dilution) for 2 h followed by incubation with 80 μl of protein A-Sepharose 6MB for 2 h at 4 °C. The beads were then washed four times with lysis buffer before boiling for 5 min in Laemmli buffer. To detect phospho-Akt/PKB substrates, phosphorylation of Akt/PKB serine 473 and tyrosine/threonine phosphorylation of Erk1/2 total cell lysates (50 μg of protein) were resolved with SDS-PAGE and electro-transferred to nitrocellulose membranes, which were incubated with rabbit polyclonal anti-phospho-specific antibodies (1:1000 dilution) overnight at 4 °C. Primary rabbit polyclonal antibodies against Akt2/PKBβ (1:1000 dilution) and PKCλ/ζ (1:500 dilution) were used to detect their antigens using 25 μg of protein from total cell lysates. Tyrosine phosphorylation of IRS proteins was detected with monoclonal phosphotyrosine antibody (clone 4G10, 1 μg/ml). Akt1/PKBα was detected with primary goat polyclonal antibody (1:750 dilution). All the membranes were then incubated with the appropriate horseradish peroxidase-linked secondary antibodies (1:10,000 dilution each) for 1 h at room temperature. The membranes were washed with wash buffer (phosphate-buffered saline, pH 7.4, 0.1% Tween 20) for 1 h at room temperature after incubation with each antibody before detection with ECL™ kit. Mass Spectrometry—Proteins immunoprecipitated with PAS antibody were resolved in 5–15% gradient SDS-PAGE and visualized with a Silver-plus kit according to the procedure recommended by the manufacturer (Bio-Rad). The 250-kDa band was excised from the silver-stained gel and digested with sequencing grade porcine-modified trypsin (Promega). The tryptic peptides were analyzed by MALDI-TOF mass spectrometer. The peptide mass spectrum was acquired over a range 500–3500 Da. Peptide mass mapping was carried out against the National Center for Biotechnology Information data base using the MS-FIT program (University of California, San Francisco, CA; www-.prospector.ucsf.edu). To further verify the MS-FIT identification, selected peptides were fragmented via Post-Source-Decay and searched against the National Center for Biotechnology Information data base using the MSTag program. Deoxyglucose Uptake Assay—To detect the effect of specific gene silencing on insulin-stimulated glucose transport, [3H]deoxyglucose uptake assays were carried out in 3T3-L1 adipocytes as described previously (35Jiang Z.Y. Zhou Q.L. Colman K.A. Chouinard M. Boese Q. Czech M.P. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 7569-7574Crossref PubMed Scopus (312) Google Scholar). Briefly, 5 million adipocytes (day 5 of differentiation) were transfected with siRNA by electroporation, and this procedure usually leads to about 30% cell loss. The cells were reseeded for 60 h before serum starvation for 3 h with Krebs-Ringer HEPES (KRH) buffer (130 mm NaCl, 5 mm KCl, 1.3 mm CaCl2, 1.3 mm MgSO4, and 25 mm HEPES, pH 7.4) supplemented with 0.5% bovine serum albumin and 2 mm sodium pyruvate. Cells were then stimulated with insulin for 30 min at 37 °C. Glucose uptake was initiated by addition of [1,2-3H]2-deoxy-d-glucose to a final assay concentration of 100 μm for 5 min at 37 °C. Assays were terminated by four washes with ice-cold KRH buffer, and the cells were solubilized with 0.4 ml of 1% Triton X-100, and 3H was determined by scintillation counting. Nonspecific deoxyglucose uptake was measured in the presence of 20 μm cytochalasin B and subtracted from each determination to obtain specific uptake. Thymidine Incorporation Assay and Assessment of Cell Growth—To detect the effect of gene silencing on insulin-stimulated DNA synthesis, [3H]thymidine incorporation assays were carried out in 3T3-L1 preadipocytes. Briefly, preadipocytes were transfected with siRNA by electroporation as described previously (35Jiang Z.Y. Zhou Q.L. Colman K.A. Chouinard M. Boese Q. Czech M.P. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 7569-7574Crossref PubMed Scopus (312) Google Scholar), and this procedure kills about 15% of the cells. The electroporated cells were reseeded into 6-well plates for 36 h before serum starvation with DMEM containing 0.5% bovine serum albumin for 5 h. Cells were then incubated with or without insulin for 16 h in the starvation media before adding 0.1 μCi/ml [methyl-3H]thymidine (in the presence of 5 μm cold thymidine) for an additional 2 h at 37 °C. The cells were washed four times with ice-cold phosphate-buffered saline and lysed by incubation with 0.5 ml of 300 mm NaOH and 100 μl of 10% SDS for 30 min. Macromolecules were precipitated by 20% trichloroacetic acid using 100 μl of 1 mg/ml DNA as carrier. The resulting trichloroacetic acid-insoluble pellet was washed two times with 5% trichloroacetic acid and then washed with 75% ethanol prior to dissolution in 0.4 ml of formic acid. [3H]Thymidine incorporation into DNA was measured by scintillation counting. To assess cell growth rate, the preadipocytes were transfected with designed siRNAs by electroporation and reseeded for up to 72 h in normal DMEM containing 10% fetal bovine serum. The phase-contrast images (10 random flames for each group) were taken at 3, 24, 48, and 72 h after reseeding, and cell numbers were counted on each flame. RNAi-based Depletion of Akt/PKB Proteins in 3T3-L1 Adipocytes Inhibits Insulin-stimulated Phosphorylation of Proteins Detected by PAS Antibodies—PAS antibody has been reported to recognize the Akt/PKB substrate motif RXRXXS/T in the target proteins of the kinase (28Kane S. Sano H. Liu S.C. Asara J.M. Lane W.S. Garner C.C. Lienhard G.E. J. Biol. Chem. 2002; 277: 22115-22118Abstract Full Text Full Text PDF PubMed Scopus (424) Google Scholar, 37Berwick D.C. Hers I. Heesom K.J. Moule S.K. Tavare J.M. J. Biol. Chem. 2002; 277: 33895-33900Abstract Full Text Full Text PDF PubMed Scopus (284) Google Scholar, 38Kovacina K.S. Park G.Y. Bae S.S. Guzzetta A.W. Schaefer E. Birnbaum M.J. Roth R.A. J. Biol. Chem. 2003; 278: 10189-10194Abstract Full Text Full Text PDF PubMed Scopus (288) Google Scholar). However, this polyclonal antibody may also cross-react with phosphoproteins that are not Akt/PKB substrates. In preliminary experiments we tested whether insulin-stimulated protein phosphorylation in cultured adipocytes could be detected with PAS antibody. Analysis of lysates from control or insulin-treated 3T3-L1 adipocytes by SDS-PAGE and Western blotting with PAS antibody revealed multiple phosphoprotein bands (Fig. 1). The intensity of many of the insulin-sensitive bands was markedly diminished by treatment of the cells with wortmannin, indicating that their phosphorylation is downstream of the PI3K pathway. To identify Akt/PKB-specific targets in insulin-stimulated 3T3-L1 adipocytes, we compared the insulin-stimulated protein phosphorylations detectable by PAS antibody in samples from cells transfected with the scrambled, nonspecific siRNA versus siRNA duplexes directed against mouse Akt1/PKBα plus Akt2/PKBβ. As shown in Fig. 1 (bottom panels), both Akt1/PKBα and Akt2/PKBβ protein levels were significantly reduced in cells transfected with siRNA species against Akt1/PKBα plus Akt2/PKBβ for 48 h as compared with the cells transfected with the scrambled siRNA. Interestingly, depletion of both Akt1/PKBα and Akt2/PKBβ significantly reduced phosphorylation of several proteins (indicated by arrowheads in Fig. 1), suggesting that Akt/PKB protein kinases are required for insulin-induced phosphorylation of those proteins. It is possible that those proteins are potential physiological target substrates of Akt/PKB in the adipocytes. However, insulin-induced phosphorylation of several other proteins (indicated by asterisks in Fig. 1) was not altered by the loss of Akt1/PKBα and Akt2/PKBβ, suggesting that those insulin-sensitive phosphoproteins are not substrates of Akt/PKB. Identification of a 250-kDa Phosphoprotein as Protein Kinase WNK1—To identify potential Akt/PKB targets, total cell lysates from control and insulin-stimulated 3T3-L1 adipocytes were immunoprecipitated with PAS antibody and separated by SDS-PAGE, followed by silver staining. As shown in Fig. 2A, PAS antibody immunoprecipitated several proteins from insulin-stimulated cells including 250-, 220-, 160-, 140-, 120-, 100-, 90-, 75-, 40-, and 32-kDa proteins. Protein bands were excised and subjected to in-gel trypsin digestion. The peptides produced were analyzed by MALDI-TOF mass spectrometry. We identified the 32-kDa protein as S6 ribosomal protein, which is likely phosphorylated by the insulin-activated pp70 S6 kinase, based on previous reports that its phosphorylation can be recognized by PAS antibody (28Kane S. Sano H. Liu S.C. Asara J.M. Lane W.S. Garner C.C. Lienhard G.E. J. Biol. Chem. 2002; 277: 22115-22118Abstract Full Text Full Text PDF PubMed Scopus (424) Google Scholar, 29Zhang H. Zha X. Tan Y. Hornbeck P.V. Mastrangelo A.J. Alessi D.R. Polakiewicz R.D. Comb M.J. J. Biol. Chem. 2002; 277: 39379-39387Abstract Full Text Full Text PDF PubMed Scopus (230) Google Scholar). It is interesting to note that the 140-kDa phosphoprotein was identified as ATP-citrate lyase, as reported previously from its isolation by fractionation with Mono-Q chromatography (37Berwick D.C. Hers I. Heesom K.J. Moule S.K. Tavare J.M. J. Biol. Chem. 2002; 277: 33895-33900Abstract Full Text Full Text PDF PubMed Scopus (284) Google Scholar). Initially, we focused on the 250-kDa phosphoprotein for several reasons. First, the tryptic peptide mass fingerprinting from this protein was identical to human and rat protein kinase WNK1 (30Xu B. English J.M. Wilsbacher J.L. Stippec S. Goldsmith E.J. Cobb M.H. J. Biol. Chem. 2000; 275: 16795-16801Abstract Full Text Full Text PDF PubMed Scopus (417) Google Scholar, 31Wilson F.H. Disse-Nicodeme S. Choate K.A. Ishikawa K. Nelson-Williams C. Desitter I. Gunel M. Milford D.V. Lipkin G.W. Achard J.M. Feely M.P. Dussol B. Berland Y. Unwin R.J. Mayan H. Simon D.B. Farfel Z. Jeunemaitre X. Lifton R.P. Science. 2001; 293: 1107-1112Crossref PubMed Scopus (1233) Google Scholar, 32Verissimo F. Jordan P. Oncogene. 2001; 20: 5562-5569Crossref PubMed Scopus (226) Google Scholar). This was confirmed by tandem mass spectrometry peptide mapping in two separate experiments. Second, a Blast search for the mouse homologue within the Celera data base identified the mouse WNK1 as similar to rat and human WNK1 in the National Center for Biotechnology Information data base. Motif scanning in the Scansite (www.scansite.mit.edu) identified that WNK1, from all three species, had a conserved putative Akt phosphorylation motif at the amino-terminal region (RRRRHTM). In addition, depletion of both Akt1/PKBα and Akt2/PKBβ abolished insulin-stimulated phosphorylation of the 250-kDa protein in total lysates from adipocytes (indicated by the top arrowhead in Fig. 1). To confirm that the 250-kDa protein was indeed WNK1 and was phosphorylated in insulin-stimulated cells, PAS antibody was used to immunoprecipitate endogenous phosphoproteins from 3T3-L1 adipocytes, and the enriched pool was immunoblotted with rabbit polyclonal antibody against the amino-terminal peptide of mouse WNK1. As shown in Fig. 3, left panel, the amount of WNK1 precipitated by PAS antibody was dramatically increased in insulin-stimulated cells as compared with control adipocytes, whereas pretreatment of the cells with wortmannin completely demolished the effect of insulin. In addition, immunoprecipitation was also carried out with anti-WNK1 antibody followed by immunoblotting with PAS antibody. As expected, higher phosphorylation of WNK1 detected by PAS antibody was also observed in insulin-stimulated cells, although equal amounts of WNK1 were present in control and insulin-stimulated cells (Fig. 3, bottom right panel). Again, wortmannin totally inhibited insulin-stimulated WNK1 phosphorylation. These data confirm that insulin stimulates PAS-detectable phosphorylation of WNK1 through a wortmannin-sensitive PI3K pathway in adipocytes. A similar conclusion was reached in another study, which was published after we collected the data presented in Figs. 1, 2, 3, with respect to insulin-like growth factor I signaling (33Vitari A.C. Deak M. Collins B.J. Morrice N. Prescott A.R. Phelan A. Humphreys S. Alessi D.R. Biochem. J. 2004; 378: 257-268Crossref PubMed Scopus (78) Google Scholar). This published study (33Vitari A.C. Deak M. Collins B.J. Morrice N. Prescott A.R. Phelan A. Humphreys S. Alessi D.R. Biochem. J. 2004; 378: 257-268Crossref PubMed Scopus (78) Google Scholar) showed that the regulated phosphorylation site on WNK1 is Thr60. Insulin Induces WNK1 Phosphorylation through the Akt/PKB Pathway—Because insulin signaling through the PI3K pathway leads to the activation of multiple downstream serine/threonine kinases in addition to Akt/PKB, including atypical PKC, mTOR, and p70 S6 kinase, we further investigated whether any of those kinases may be required for insulin-induced WNK1 phosphorylation. In this study, rapamycin, a specific inhibitor of mTOR, was used to examine whether the mTOR-p70 S6 kinase pathway is involved in WNK1 phosphorylation in cultured adipocytes. As shown in Fig. 4A, incubation of the adipocytes with rapamycin prior to insulin treatment did not alter insulin-induced phosphorylation of Akt/PKB and WNK1, detected by phospho-Akt/PKB Ser473-specific antibody and PAS antibody, respectively. However, rapamycin effectively blocked insulin-stimulated threonine 389 phosphorylation of p70 S6 kinase mediated by mTOR (Fig. 4A). In contrast, wortmannin inhibited not only phosphorylation of threonine 389 of the p70 S6 kinase but also phosphorylation of Akt/PKB and WNK1. These data indicate that the mTOR-p70 S6 kinase pathway is not involved in insulin-stimulated WNK1 phosphorylation. We next tested whether protein kinases Akt/PKB and atypical protein kinase C, both downstream of the PI3K pathway, are required for the phosphorylation of WNK1. In these studies, siRNA duplexes against Akt1/PKBα and Akt2/PKBβ or PKCλ, the major form of atypical PKC in the adipocytes, were electroporated into 3T3-L1 adipocytes (31Wilson F.H. Disse-Nicodeme S. Choate K.A. Ishikawa K. Nelson-Williams C. Desitter I. Gunel M. Milford D.V. Lipkin G.W. Achard J.M. Feely M.P. Dussol B. Berland Y. Unwin R.J. Mayan H. Simon D.B. Farfel Z. Jeunemaitre X. Lifton R.P. Science. 2001; 293: 1107-1112Crossref PubMed Scopus (1233) Google Scholar, 32Verissimo F. Jordan P. Oncogene. 2001; 20: 5562-5569Crossref PubMed Scopus (226) Google Scholar). As shown in Fig. 4B, depletion of both Akt/PKB proteins by siRNA almost abolished insulin-stimulated phosphorylation of WNK1 detected by PAS antibody, whereas equal amounts of WNK1 were precipitated by WNK1 antibody. However, RNAi-directed depletion of PKCλ had no effect on insulin-stimulated WNK1 phosphorylation (Fig. 4C). These data strongly suggest that insulin induces phosphorylation of WNK1 through an Akt/PKB protein kinase-specific pathway. WNK1 Is Not Involved in the Regulation of Upstream Signaling of the Insulin Receptor—No data are available on the function of WNK1 in adipocytes. Multiple studies have suggested that cellular stress and prolonged incubation of adipocytes with insulin lead to desensitization of insulin signaling through protein kinase-dependant phosphorylation and the decrease of IRS protein level (39Sun X.J. Goldberg J.L. Qiao L.-Y. Mit" @default.
• W2036874807 created "2016-06-24" @default.
• W2036874807 creator A5001742278 @default.
• W2036874807 creator A5031610305 @default.
• W2036874807 creator A5060346815 @default.
• W2036874807 creator A5061430640 @default.
• W2036874807 creator A5081702993 @default.
• W2036874807 creator A5082215676 @default.
• W2036874807 creator A5083130810 @default.
• W2036874807 creator A5085687728 @default.
• W2036874807 date "2005-06-01" @default.
• W2036874807 modified "2023-10-16" @default.
• W2036874807 title "Identification of WNK1 as a Substrate of Akt/Protein Kinase B and a Negative Regulator of Insulin-stimulated Mitogenesis in 3T3-L1 Cells" @default.
• W2036874807 cites W1493799579 @default.
• W2036874807 cites W1500729563 @default.
• W2036874807 cites W1509669696 @default.
• W2036874807 cites W1580441940 @default.
• W2036874807 cites W1607892649 @default.
• W2036874807 cites W1617532721 @default.
• W2036874807 cites W1625966995 @default.
• W2036874807 cites W1678800844 @default.
• W2036874807 cites W1964211866 @default.
• W2036874807 cites W1973047212 @default.
• W2036874807 cites W1978625554 @default.
• W2036874807 cites W1979147887 @default.
• W2036874807 cites W1981517713 @default.
• W2036874807 cites W1988472050 @default.
• W2036874807 cites W1989294105 @default.
• W2036874807 cites W1993216157 @default.
• W2036874807 cites W1995482311 @default.
• W2036874807 cites W1996695017 @default.
• W2036874807 cites W2005901295 @default.
• W2036874807 cites W2006423155 @default.
• W2036874807 cites W2011282245 @default.
• W2036874807 cites W2013044317 @default.
• W2036874807 cites W2013829707 @default.
• W2036874807 cites W2014887370 @default.
• W2036874807 cites W2017292900 @default.
• W2036874807 cites W2017882961 @default.
• W2036874807 cites W2019305336 @default.
• W2036874807 cites W2042916215 @default.
• W2036874807 cites W2045201777 @default.
• W2036874807 cites W2046976278 @default.
• W2036874807 cites W2050875396 @default.
• W2036874807 cites W2053073281 @default.
• W2036874807 cites W2053936821 @default.
• W2036874807 cites W2054683873 @default.
• W2036874807 cites W2055855110 @default.
• W2036874807 cites W2058138221 @default.
• W2036874807 cites W2059898400 @default.
• W2036874807 cites W2062390485 @default.
• W2036874807 cites W2068912983 @default.
• W2036874807 cites W2070119291 @default.
• W2036874807 cites W2076075378 @default.
• W2036874807 cites W2079156404 @default.
• W2036874807 cites W2089127518 @default.
• W2036874807 cites W2093529069 @default.
• W2036874807 cites W2097767970 @default.
• W2036874807 cites W2101400542 @default.
• W2036874807 cites W2102683312 @default.
• W2036874807 cites W2108958930 @default.
• W2036874807 cites W2114189030 @default.
• W2036874807 cites W2117263216 @default.
• W2036874807 cites W2123208560 @default.
• W2036874807 cites W2137035181 @default.
• W2036874807 cites W2138391708 @default.
• W2036874807 cites W2142766228 @default.
• W2036874807 cites W2144938841 @default.
• W2036874807 cites W2159630851 @default.
• W2036874807 cites W2165044377 @default.
• W2036874807 cites W2165863663 @default.
• W2036874807 cites W2166324877 @default.
• W2036874807 cites W2166525118 @default.
• W2036874807 doi "https://doi.org/10.1074/jbc.m414464200" @default.
• W2036874807 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15799971" @default.
• W2036874807 hasPublicationYear "2005" @default.
• W2036874807 type Work @default.
• W2036874807 sameAs 2036874807 @default.
• W2036874807 citedByCount "79" @default.
• W2036874807 countsByYear W20368748072012 @default.
• W2036874807 countsByYear W20368748072013 @default.
• W2036874807 countsByYear W20368748072014 @default.
• W2036874807 countsByYear W20368748072015 @default.
• W2036874807 countsByYear W20368748072016 @default.
• W2036874807 countsByYear W20368748072017 @default.
• W2036874807 countsByYear W20368748072018 @default.
• W2036874807 countsByYear W20368748072019 @default.
• W2036874807 countsByYear W20368748072020 @default.
• W2036874807 countsByYear W20368748072021 @default.
• W2036874807 countsByYear W20368748072022 @default.
• W2036874807 countsByYear W20368748072023 @default.
• W2036874807 crossrefType "journal-article" @default.
• W2036874807 hasAuthorship W2036874807A5001742278 @default.
• W2036874807 hasAuthorship W2036874807A5031610305 @default.
• W2036874807 hasAuthorship W2036874807A5060346815 @default.
• W2036874807 hasAuthorship W2036874807A5061430640 @default.
• W2036874807 hasAuthorship W2036874807A5081702993 @default.
• W2036874807 hasAuthorship W2036874807A5082215676 @default.

• next