FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2037442830> ?p ?o ?g. }

• W2037442830 endingPage "32669" @default.
• W2037442830 startingPage "32663" @default.
• W2037442830 abstract "The global transcription regulator Gal11, a component of RNA polymerase II holoenzyme, is required for full expression of many genes in yeast. We previously reported that Gal11 binds the small (Tfa2) and large (Tfa1) subunits of the general transcription factor (TF) IIE through Gal11 functional domains A and B, respectively. Here we demonstrate that the C-terminal basic region in Tfa2 is responsible for binding to domain A, whereas both the N-terminal hydrophobic and internal glutamic acid-rich regions in Tfa1 are responsible for binding to domain B. Yeast cells bearing a C-terminal deletion encompassing the Gal11-interacting region in each of the two TFIIE subunits, being viable, exhibited no obvious phenotype. In contrast, combination of the two deletions (TFIIE-ΔC) showed phenotypes similar to those of gal11 null mutations. The levels of mRNA from TATA-containing genes, but not from TATA-less genes, decreased in TFIIE-ΔC to an extent comparable to that in the gal11 null mutant. Combination of TFIIE-ΔCwith a gal11 null mutation did not result in an enhanced effect, suggesting that both TFIIE and Gal11 act in a common regulatory pathway. In a reconstituted cell-free system, Gal11 protein stimulated basal transcription in the presence of wild-type TFIIE. Such a stimulation was not seen in the presence of TFIIE-ΔC. The global transcription regulator Gal11, a component of RNA polymerase II holoenzyme, is required for full expression of many genes in yeast. We previously reported that Gal11 binds the small (Tfa2) and large (Tfa1) subunits of the general transcription factor (TF) IIE through Gal11 functional domains A and B, respectively. Here we demonstrate that the C-terminal basic region in Tfa2 is responsible for binding to domain A, whereas both the N-terminal hydrophobic and internal glutamic acid-rich regions in Tfa1 are responsible for binding to domain B. Yeast cells bearing a C-terminal deletion encompassing the Gal11-interacting region in each of the two TFIIE subunits, being viable, exhibited no obvious phenotype. In contrast, combination of the two deletions (TFIIE-ΔC) showed phenotypes similar to those of gal11 null mutations. The levels of mRNA from TATA-containing genes, but not from TATA-less genes, decreased in TFIIE-ΔC to an extent comparable to that in the gal11 null mutant. Combination of TFIIE-ΔCwith a gal11 null mutation did not result in an enhanced effect, suggesting that both TFIIE and Gal11 act in a common regulatory pathway. In a reconstituted cell-free system, Gal11 protein stimulated basal transcription in the presence of wild-type TFIIE. Such a stimulation was not seen in the presence of TFIIE-ΔC. Recent biochemical studies have strongly suggested that Saccharomyces cerevisiae RNA polymerase II exists, at least in part, as a “holoenzyme,” a large complex with a subset of the general transcription factors, various global transcription regulators (such as Srb proteins, Gal11, Sin4, Rgr1, and Rox3), and as yet unknown proteins. Although two forms of the holoenzyme that differ slightly in components have been reported, the TATA-binding protein (TBP) 1The abbreviations used are: TBP, TATA-binding protein; TF, transcription factor; GST, glutathione S-transferase; HA, hemagglutinin; PAGE, polyacrylamide gel electrophoresis. and transcription factor (TF) IIE are consistently missing, whereas Srb proteins and Gal11 are always present in this form of RNA polymerase II. Both types of the holoenzyme stimulate basal as well as activated transcription in vitro (1Kim Y.-J. Bjorklund S. Li Y. Sayre M.H. Kornberg R.D. Cell. 1994; 77: 599-608Abstract Full Text PDF PubMed Scopus (893) Google Scholar, 2Koleske A.J. Young R.A. Nature. 1994; 368: 466-469Crossref PubMed Scopus (533) Google Scholar, 3Li Y. Bjorklund S. Jiang Y.W. Kim Y.-J. Lane W.S. Stillman D.J. Kornberg R.D. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 10864-10868Crossref PubMed Scopus (217) Google Scholar, 4Gustafsson C.M. Myers L.C. Li Y. Redd M.J. Lui M. Erdjument-Bromage H. Tempst P. Kornberg R.D. J. Biol. Chem. 1997; 272: 48-50Abstract Full Text Full Text PDF PubMed Scopus (56) Google Scholar, 5Hengartner C.J. Thompson C.M. Zhang J. Chao D.M. Liao S.-M. Koleske A.J. Okamura S. Young R.A. Genes Dev. 1995; 9: 897-910Crossref PubMed Scopus (189) Google Scholar, 6Liao S.-M. Zhang J. Jeffery D.A. Koleske A.J. Thompson C.M. Chao D.M. Viljoen M. van Vuuren H.J.J. Young R.A. Nature. 1995; 374: 193-196Crossref PubMed Scopus (367) Google Scholar, 7Koleske A.J. Young R.A. Trends Biochem. Sci. 1995; 20: 113-116Abstract Full Text PDF PubMed Scopus (267) Google Scholar, 8Bjorklund S. Kim Y.-J. Trends Biochem. Sci. 1996; 21: 327-335Crossref PubMed Scopus (104) Google Scholar). Bulk mRNA synthesis is shut down in temperature-sensitive srb mutant cells upon transfer to the restrictive temperature, suggesting that the holoenzyme is involved in transcription of most RNA polymerase II-transcribed genes in the cell (9Thompson C.M. Young R.A. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 4587-4590Crossref PubMed Scopus (209) Google Scholar). When either Gal11 or Srb proteins are tethered to a gene by fusing these proteins to the DNA-binding domain of LexA, the chimeric molecules become potent activators of the target gene. This observation implies that recruitment of the holoenzyme to a promoter is an important pathway of transcriptional activation (10Himmelfarb H.J. Pearlberg J. Last D.H. Ptashne M. Cell. 1990; 63: 1299-1309Abstract Full Text PDF PubMed Scopus (112) Google Scholar, 11Barberis A. Pearlberg J. Simkovich N. Farrell S. Reinagel P. Bamdad C. Sigal G. Ptashne M. Cell. 1995; 81: 359-368Abstract Full Text PDF PubMed Scopus (236) Google Scholar, 12Farrell S. Simkovich N. Wu Y. Barberis A. Ptashne M. Genes Dev. 1996; 10: 2359-2367Crossref PubMed Scopus (110) Google Scholar, 13Ptashne M. Gann A. Nature. 1997; 386: 569-577Crossref PubMed Scopus (948) Google Scholar). The Swi-Snf complex, which is found in one type of the holoenzyme (14Wilson C.J. Chao D.M. Imbalzano A.N. Schnitzler G.R. Kingston R.E. Young R.A. Cell. 1996; 84: 235-244Abstract Full Text Full Text PDF PubMed Scopus (324) Google Scholar), but not in the other (15Cairns B.R. Lorch Y. Li Y. Zhang M. Lacomis L. Erdjument-Bromage H. Tempst P. Du J. Laurent B. Kornberg R.D. Cell. 1996; 87: 1249-1260Abstract Full Text Full Text PDF PubMed Scopus (584) Google Scholar), has been proposed to function as a chromatin-remodeling factor and therefore to be responsible for the apparent chromatin remodeling activity of the holoenzyme (16Gaudreau L. Schmid A. Blaschke D. Ptashne M. Horz W. Cell. 1997; 89: 55-62Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar). Both the significance of the two forms of the holoenzyme and the role of the known holoenzyme-associated global regulators (such as Srb proteins and Gal11) in regulating transcription remain to be elucidated. The GAL11 gene is not essential for growth of yeast, yet GAL11 loss-of-function mutations cause a variety of phenotypes, such as slow utilization of galactose, sucrose, and nonfermentable carbon sources (17Nogi Y. Fukasawa T. Curr. Genet. 1980; 2: 115-120Crossref PubMed Scopus (45) Google Scholar, 18Suzuki Y. Nogi Y. Abe A. Fukasawa T. Mol. Cell. Biol. 1988; 8 (Correction (1992) Mol. Cell. Biol.12, 4806): 4991-4999Crossref PubMed Scopus (111) Google Scholar, 19Vallier L.G. Carlson M. Genetics. 1991; 129: 675-684Crossref PubMed Google Scholar); sporulation defect (18Suzuki Y. Nogi Y. Abe A. Fukasawa T. Mol. Cell. Biol. 1988; 8 (Correction (1992) Mol. Cell. Biol.12, 4806): 4991-4999Crossref PubMed Scopus (111) Google Scholar); inefficient production of α-pheromone (20Fassler J.S. Winston F. Mol. Cell. Biol. 1989; 9: 5602-5609Crossref PubMed Scopus (77) Google Scholar); suppression of yeast transposon Ty-insertion mutations (20Fassler J.S. Winston F. Mol. Cell. Biol. 1989; 9: 5602-5609Crossref PubMed Scopus (77) Google Scholar); stabilization of minichromosomes (21Kipling D. Tambini C. Kearsey S.E. Nucleic Acids Res. 1991; 19: 1385-1391Crossref PubMed Scopus (52) Google Scholar); and suppression of defective silencing mutations (22Sussel L. Vannier D. Shore D. Genetics. 1995; 141: 873-888Crossref PubMed Google Scholar). Gal11 protein is a component of both forms of the holoenzyme (1Kim Y.-J. Bjorklund S. Li Y. Sayre M.H. Kornberg R.D. Cell. 1994; 77: 599-608Abstract Full Text PDF PubMed Scopus (893) Google Scholar,11Barberis A. Pearlberg J. Simkovich N. Farrell S. Reinagel P. Bamdad C. Sigal G. Ptashne M. Cell. 1995; 81: 359-368Abstract Full Text PDF PubMed Scopus (236) Google Scholar) and is also a subunit of another type of RNA polymerase II-containing complex, which contains transcription regulators Cdc73 and Paf1, but not Srb proteins (23Shi X. Chang M. Wolf A.J. Chang C.-H. Frazer-Abel A.A. Wade P.A. Burton Z.F. Jaehning J.A. Mol. Cell. Biol. 1997; 17: 1160-1169Crossref PubMed Scopus (128) Google Scholar). We have recently shown (24Sakurai H. Kim Y.-J. Ohishi T. Kornberg R.D. Fukasawa T. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 9488-9492Crossref PubMed Scopus (30) Google Scholar) that purified Gal11 stimulates basal transcription in a cell-free system of Sayre et al. (25Sayre M.H. Tschochner H. Kornberg R.D. J. Biol. Chem. 1992; 267: 23376-23382Abstract Full Text PDF PubMed Google Scholar) that consists of recombinant or highly purified general transcription factors (TBP, TFIIB, TFIIE, TFIIF, and TFIIH) and RNA polymerase II, and that Gal11 makes contact with TFIIEin vivo as well as in vitro. Each of two domains of Gal11 (domains A and B), which are essential for its in vivo function, participates in the binding to the small (Tfa2) and large (Tfa1) subunits (26Feaver W.J. Henry N.L. Bushnell D.A. Sayre M.H. Brickner J.H. Gileadi O. Kornberg R.D. J. Biol. Chem. 1994; 269: 27549-27553Abstract Full Text PDF PubMed Google Scholar) of TFIIE, respectively (24Sakurai H. Kim Y.-J. Ohishi T. Kornberg R.D. Fukasawa T. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 9488-9492Crossref PubMed Scopus (30) Google Scholar). Although several genetic studies suggested that Gal11 was also involved in transcriptional repression in vivo (20Fassler J.S. Winston F. Mol. Cell. Biol. 1989; 9: 5602-5609Crossref PubMed Scopus (77) Google Scholar, 22Sussel L. Vannier D. Shore D. Genetics. 1995; 141: 873-888Crossref PubMed Google Scholar), no biochemical evidence has so far been available to support direct involvement of Gal11 in the repression. In this study, we have determined which regions of both subunits of TFIIE are involved in the binding to Gal11 by constructing deletion mutants of Tfa1 and Tfa2 that fail to interact with Gal11. Based on genetic as well as biochemical analyses using the mutant forms of TFIIE generated from these genes, we suggest that interaction with TFIIE is essential for the function of Gal11 and that the two factors function in a common regulatory pathway of transcription. The yeast strains used are listed in Table I. Rich glucose (YPD), enriched synthetic, synthetic complete, and 5-fluoroorotic acid-containing media were prepared as described (24Sakurai H. Kim Y.-J. Ohishi T. Kornberg R.D. Fukasawa T. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 9488-9492Crossref PubMed Scopus (30) Google Scholar, 27Sakurai H. Ohishi T. Fukasawa T. FEBS Lett. 1996; 398: 113-119Crossref PubMed Scopus (13) Google Scholar, 28Boeke J.D. Trueheart J. Natsoulis G. Fink G.R. Methods Enzymol. 1987; 154: 164-175Crossref PubMed Scopus (1084) Google Scholar). Galactose utilization of cells was assayed using EBGal medium (18Suzuki Y. Nogi Y. Abe A. Fukasawa T. Mol. Cell. Biol. 1988; 8 (Correction (1992) Mol. Cell. Biol.12, 4806): 4991-4999Crossref PubMed Scopus (111) Google Scholar).Table IYeast strains and plasmids usedStrainGenotypeHS25MATα ade2–1 his3–11 leu2–1,112 trp1–1 ura3–1 can1–100 tfa2::ADE2 (pSK461)1-aPlasmids indicated in parentheses are carried.HS26gal11::LEU2 derivative of HS25HS27HS26 harboring pSK491HS38MATαade2–1 his3–11 leu2–1,112 trp1–1 ura3–1 can1–100 tfa1::ADE2 rfa2::LEU2 (pSK457)HS39MATα ade2–1 his3–11 leu2–1,112 trp1–1 ura3–1 can1–100 tfa1::ADE2 rfa::LEU2(pSK492, pSK711)HS40MATα ade2–1 his3–11 leu2–1,112 trp1–1 ura3–1 can1–100 tfa1::ADE2 rfa2::LEU2 (pSK703, pSK713)HS41gal11::URA3 derivative of HS39HS42gal11::URA3 derivative of HS40PlasmidDescriptionpSK457URA3-marked high copy number plasmid bearing TFA1 and TFA2pSK461URA3-marked centromeric plasmid bearing ADH1-HAHis-TFA2pSK491HIS3-marked centromeric plasmid bearing deletion 48–326 of GAL11pSK492TRP1-marked centromeric plasmid bearing ADH1-HAHis-TFA1pSK703TRP1-marked centromeric plasmid bearing ADH1-HAHis-tfa1-N304pSK711HIS3-marked centromeric plasmid bearing ADH1-HAHis-TFA2pSK713HIS3-marked centromeric plasmid bearing ADH1-HAHis-tfa2-N3021-a Plasmids indicated in parentheses are carried. Open table in a new tab Plasmid shuffling experiments were carried out as described (28Boeke J.D. Trueheart J. Natsoulis G. Fink G.R. Methods Enzymol. 1987; 154: 164-175Crossref PubMed Scopus (1084) Google Scholar). Synthesis of the α-factor was tested by the halo assay (29Chan R.K. Otte C.A. Mol. Cell. Biol. 1982; 2: 21-29Crossref PubMed Scopus (161) Google Scholar).MATα cells (105 cells) were spotted onto a lawn (3 × 105 cells) of the α-factor-sensitive strain RC629 (MAT a sst1-2) (29Chan R.K. Otte C.A. Mol. Cell. Biol. 1982; 2: 21-29Crossref PubMed Scopus (161) Google Scholar). A plasmid expressing the domain A polypeptide of Gal11 (pSK720) was constructed by subcloning the HpaII-NruI fragment of GAL11 (amino acids 716–929) into pQE30 (QIAGEN Inc.). The domain B expression construct (pSK721) was created by subcloning the BamHI-SspI fragment (amino acids 1–255 of Gal11) of pGST-G11 (30Sakurai H. Hiraoka Y. Fukasawa T. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 8382-8386Crossref PubMed Scopus (34) Google Scholar) into pQE32 (QIAGEN Inc.). The full-length Gal11 expression construct (pSK722) was created by subcloning the BamHI-BstEII fragment of pGST-G11 into pQE32. Plasmid pSK491, which is a HIS3-marked centromeric plasmid bearing domain B-deleted GAL11, was constructed by subcloning a fragment of GAL11 with deletion between amino acids 48 and 326 (24Sakurai H. Kim Y.-J. Ohishi T. Kornberg R.D. Fukasawa T. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 9488-9492Crossref PubMed Scopus (30) Google Scholar) into pRS313 (31Sikorski R.S. Hieter P. Genetics. 1989; 122: 19-27Crossref PubMed Google Scholar). Plasmids bearing fusions of glutathione S-transferase (GST) and various regions of TFA1 were constructed from pSK492 or its 3′-end deletion derivatives (32Sakurai H. Ohishi T. Fukasawa T. J. Biol. Chem. 1997; 272: 15936-15942Abstract Full Text Full Text PDF PubMed Scopus (21) Google Scholar) and pGEX-2T or pGEX-3X (Pharmacia Biotech Inc.). The derivatives of GST/Tfa2 fusions were constructed from pSK461 (24Sakurai H. Kim Y.-J. Ohishi T. Kornberg R.D. Fukasawa T. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 9488-9492Crossref PubMed Scopus (30) Google Scholar); pSK708, pSK709, or pSK710 (see below); and pGEX-2T or pGEX-3X. Plasmid pSK457 bearing the TFA1 and TFA2 genes was constructed by subcloning the SmaI-XbaI (blunt-ended) fragment of TFA1 (26Feaver W.J. Henry N.L. Bushnell D.A. Sayre M.H. Brickner J.H. Gileadi O. Kornberg R.D. J. Biol. Chem. 1994; 269: 27549-27553Abstract Full Text PDF PubMed Google Scholar) and the SalI-XbaI fragment of TFA2 (26Feaver W.J. Henry N.L. Bushnell D.A. Sayre M.H. Brickner J.H. Gileadi O. Kornberg R.D. J. Biol. Chem. 1994; 269: 27549-27553Abstract Full Text PDF PubMed Google Scholar) into the PvuII and SalI/NheI sites of YEp24 (33Botstein D. Falco S.C. Stewart S.E. Brennan M. Sherer S. Stinchcomb D.T. Struhl K. Davis R.W. Gene (Amst.). 1979; 8: 17-24Crossref PubMed Scopus (550) Google Scholar), respectively (Table I). Other TFA1 and TFA2derivatives listed in Table I contain hemagglutinin (HA) epitope and polyhistidine (HAHis) tags at the N termini and are expressed under the control of the ADH1 promoter (24Sakurai H. Kim Y.-J. Ohishi T. Kornberg R.D. Fukasawa T. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 9488-9492Crossref PubMed Scopus (30) Google Scholar, 26Feaver W.J. Henry N.L. Bushnell D.A. Sayre M.H. Brickner J.H. Gileadi O. Kornberg R.D. J. Biol. Chem. 1994; 269: 27549-27553Abstract Full Text PDF PubMed Google Scholar, 32Sakurai H. Ohishi T. Fukasawa T. J. Biol. Chem. 1997; 272: 15936-15942Abstract Full Text Full Text PDF PubMed Scopus (21) Google Scholar). Plasmid pSK492 was a derivative of the TRP1-marked centromeric plasmid pRS314 (31Sikorski R.S. Hieter P. Genetics. 1989; 122: 19-27Crossref PubMed Google Scholar) bearing ADH1-HAHis-TFA1 (32Sakurai H. Ohishi T. Fukasawa T. J. Biol. Chem. 1997; 272: 15936-15942Abstract Full Text Full Text PDF PubMed Scopus (21) Google Scholar). Plasmids pSK702 and pSK703 were the same as pSK492 except that they contained tfa1-N417 and tfa1-N304 in place of wild-type TFA1, respectively (32Sakurai H. Ohishi T. Fukasawa T. J. Biol. Chem. 1997; 272: 15936-15942Abstract Full Text Full Text PDF PubMed Scopus (21) Google Scholar). Plasmid pSK490, a TRP1-marked centromeric plasmid bearing ADH1-HAHis-TFA2, was constructed by subcloning of the blunt-ended SphI fragment of pSK461 (24Sakurai H. Kim Y.-J. Ohishi T. Kornberg R.D. Fukasawa T. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 9488-9492Crossref PubMed Scopus (30) Google Scholar) into the PvuII sites of pRS314 (31Sikorski R.S. Hieter P. Genetics. 1989; 122: 19-27Crossref PubMed Google Scholar). Plasmids bearing 3′-end deletion derivatives of TFA2 were constructed from pSK490 by digestion with exonuclease III from the 3′-end of the Tfa2 coding region. The derivatives containing the N-terminal 318, 302, and 288 amino acids of Tfa2 were designated as pSK708, pSK709, and pSK710, respectively. Plasmids pSK711, pSK712, pSK713, and pSK714 were the same as pSK490, pSK708, pSK709, and pSK710, respectively, except that they contained HIS3 in place of TRP1. 2Details of plasmid construction are available upon request. Full-length or variously deleted forms of Tfa1 or Tfa2 were produced in Escherichia coli JM109 cells as fusions with GST and purified on glutathione-agarose (Sigma) as described (24Sakurai H. Kim Y.-J. Ohishi T. Kornberg R.D. Fukasawa T. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 9488-9492Crossref PubMed Scopus (30) Google Scholar). Each of the fusion proteins was immobilized on the resin, and the resin was equilibrated with buffer A (20 mm Hepes-KOH, pH 7.6, 1 mmEDTA, 1 mm dithiothreitol, 20% glycerol, and 1 mm phenylmethylsulfonyl fluoride) containing 0.1m potassium acetate (buffer A-0.1). Extracts containing the domain A or B polypeptide of Gal11 were prepared from JM109 cells harboring pSK720 or pSK721, respectively. The extracts were mixed with the fusion protein-immobilized resin for 1 h on ice. After washing the resin with buffer A-0.1, bound proteins were extracted and subjected to SDS-polyacrylamide gel electrophoresis (PAGE) followed by immunoblot analysis (24Sakurai H. Kim Y.-J. Ohishi T. Kornberg R.D. Fukasawa T. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 9488-9492Crossref PubMed Scopus (30) Google Scholar, 30Sakurai H. Hiraoka Y. Fukasawa T. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 8382-8386Crossref PubMed Scopus (34) Google Scholar). Whole cell extracts were prepared by disruption of cells with glass beads in a buffer containing 0.1 m Hepes-KOH, pH 7.6, 0.4 m potassium acetate, 10 mm EDTA, 1 mm dithiothreitol, 20% glycerol, and 1 mm phenylmethylsulfonyl fluoride. The extracts were diluted to 2 mg of protein/ml with buffer A, and 3 mg of protein were incubated with anti-HA antibody-immobilized protein A-Sepharose (Pharmacia Biotech Inc.) in buffer A-0.1 for 5 h on a rotating wheel. After washing the resin with buffer A-0.1 containing 0.1% Nonidet P-40, bound proteins were eluted with 0.2 mglycine HCl, pH 2.3. The proteins were subjected to SDS-PAGE and analyzed by immunoblotting using the ECL system (Amersham Life Science, Inc.). Total RNA was isolated as described (27Sakurai H. Ohishi T. Fukasawa T. FEBS Lett. 1996; 398: 113-119Crossref PubMed Scopus (13) Google Scholar, 32Sakurai H. Ohishi T. Fukasawa T. J. Biol. Chem. 1997; 272: 15936-15942Abstract Full Text Full Text PDF PubMed Scopus (21) Google Scholar) and quantified by the absorbance at 260 nm. The integrity of the RNA sample was confirmed by methylene blue staining after agarose gel electrophoresis. Primer extension analysis was carried out with specific primers for the ACT1,CYH2, GAL4, GAL80, and MFα1 genes as described (27Sakurai H. Ohishi T. Fukasawa T. FEBS Lett. 1996; 398: 113-119Crossref PubMed Scopus (13) Google Scholar, 32Sakurai H. Ohishi T. Fukasawa T. J. Biol. Chem. 1997; 272: 15936-15942Abstract Full Text Full Text PDF PubMed Scopus (21) Google Scholar). The nucleotide sequences of primers for CTS1 and HIS4 are TGAGTTTTGACCCCAATAAACAGC and TCCTTCTTACTATTCCATGAGGCC, respectively. The relative amount of accurate transcripts was determined by densitometric analysis of the autoradiograms (Shimadzu Model CS-9000). Full-length Gal11 protein was expressed in JM109 cells harboring pSK722 by addition of 1 mm isopropyl-β-d-thiogalactopyranoside for 5 h at 25 °C. The following manipulations were performed below 4 °C, and all buffers contained 1 mmphenylmethylsulfonyl fluoride. The cells (from a 2-liter culture) were suspended in 20 ml of Tris-buffered saline (20 mm Tris-Cl, pH 7.6, and 150 mm NaCl) and lysed by sonication. After addition of 2 ml of 10% Triton X-100, the lysate was cleared by centrifugation and incubated with 1 ml of Ni2+-nitrilotriacetic acid-agarose (QIAGEN Inc.) for 3.5 h. The slurry was washed in a column with wash buffer (20 mm imidazole, 0.1 m Hepes-KOH, pH 7.6, 0.1m potassium acetate, and 0.1% Nonidet P-40), and then bound proteins were eluted with elution buffer (200 mmimidazole, 0.1 m Hepes-KOH, pH 7.6, 0.5 mpotassium acetate, 10% glycerol, and 0.1% Nonidet P-40). The pooled fraction was diluted 3-fold with buffer B (10 mm Hepes-KOH, pH 7.6, 1 mm EDTA, 10% glycerol, 1 mmdithiothreitol, and 0.1% Nonidet P-40) and loaded onto a 0.5-ml S-Sepharose column (Pharmacia Biotech Inc.) equilibrated with buffer B containing 0.1 m potassium acetate (buffer B-0.1). After washing with buffer B-0.3, Gal11 protein was eluted with buffer B-0.5. The pooled fraction was diluted 3-fold with buffer B and loaded onto a 0.5-ml Q-Sepharose column (Pharmacia Biotech Inc.) equilibrated with buffer B-0.15. The flow-through fraction was loaded onto a 20-ml Sepharose CL-4B column (Pharmacia Biotech Inc.) equilibrated with buffer B-0.3, and Gal11-containing fractions were pooled. The yield was ∼0.1 mg/liter of starting culture. The recombinant proteins Tfa1, Tfa2, Tfa1-N304, and Tfa2-N302 were produced in BL21(DE3) cells and purified by Ni2+-nitrilotriacetic acid-agarose chromatography as described (26Feaver W.J. Henry N.L. Bushnell D.A. Sayre M.H. Brickner J.H. Gileadi O. Kornberg R.D. J. Biol. Chem. 1994; 269: 27549-27553Abstract Full Text PDF PubMed Google Scholar). The pooled fractions of Tfa1, Tfa2, and Tfa2-N302 were dialyzed against buffer A-0.1. The Ni2+-nitrilotriacetic acid-agarose fraction of Tfa1-N304 was loaded onto a Q-Sepharose column equilibrated with buffer A-0.1. After washing with buffer A-0.25, Tfa1-N304 was eluted with buffer A-0.4. The in vitrotranscription reaction was reconstituted with the following components in a 20-μl reaction mixture as described (24Sakurai H. Kim Y.-J. Ohishi T. Kornberg R.D. Fukasawa T. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 9488-9492Crossref PubMed Scopus (30) Google Scholar) at 180 mmpotassium acetate. The transcription proteins were recombinant yeast TBP (60 ng), recombinant TFIIB (30 ng), TFIIH (0.5 μl; Mono Q fraction, gift from Drs. Jesper Svejstrup and Roger Kornberg) (34Svejstrup J.Q. Feaver W.J. LaPointe J. Kornberg R.D. J. Biol. Chem. 1994; 269: 28044-28048Abstract Full Text PDF PubMed Google Scholar), RNA polymerase II holoenzyme (1 μg; Mono Q fraction) (1Kim Y.-J. Bjorklund S. Li Y. Sayre M.H. Kornberg R.D. Cell. 1994; 77: 599-608Abstract Full Text PDF PubMed Scopus (893) Google Scholar) prepared from a gal11 null strain (HS301) (30Sakurai H. Hiraoka Y. Fukasawa T. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 8382-8386Crossref PubMed Scopus (34) Google Scholar), recombinant TFIIE or TFIIE-ΔC (20 ng), and recombinant Gal11 (20 ng). The proteins TBP, TFIIB, and RNA polymerase II holoenzyme were a gift from Drs. Young-Joon Kim and Roger Kornberg. The template DNA (40 ng) contained the core promoter region of GAL7 (pSK164), and the transcripts were analyzed by primer extension as described (35Sakurai H. Ohishi T. Amakasu H. Fukasawa T. FEBS Lett. 1994; 351: 176-180Crossref PubMed Scopus (10) Google Scholar). The relative amount of transcripts was measured by a Fuji BAS-1000 imaging analyzer. We have previously shown that two domains of Gal11 from amino acids 866 to 929 (domain A) and from amino acids 116 to 255 (domain B) are required for the normal function of Gal11 in vivo (24Sakurai H. Kim Y.-J. Ohishi T. Kornberg R.D. Fukasawa T. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 9488-9492Crossref PubMed Scopus (30) Google Scholar). Domains A and B are involved in the interaction with the Tfa2 (43-kDa subunit) and Tfa1 (66-kDa subunit) proteins (26Feaver W.J. Henry N.L. Bushnell D.A. Sayre M.H. Brickner J.H. Gileadi O. Kornberg R.D. J. Biol. Chem. 1994; 269: 27549-27553Abstract Full Text PDF PubMed Google Scholar) of the yeast TFIIE subunits, respectively (24Sakurai H. Kim Y.-J. Ohishi T. Kornberg R.D. Fukasawa T. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 9488-9492Crossref PubMed Scopus (30) Google Scholar). To dissect Tfa1 and Tfa2 for regions that mediate the binding to Gal11, we constructed various deletion derivatives of the TFIIE subunits, which were then subjected to protein affinity chromatography with Gal11. First, Tfa1 was prepared as a fusion with GST in E. coli and immobilized on glutathione-agarose. A bacterial extract containing the domain B polypeptide of Gal11 (amino acids 1–255) (Fig.1 A) was incubated with resin immobilizing GST/Tfa1 fusion protein. After extensive washing with buffer containing 0.1 m potassium acetate, bound proteins were extracted and subjected to SDS-PAGE and then analyzed by immunoblotting with anti-Gal11 antibody. As shown in Fig.1 B, the domain B polypeptide was retained on the GST/Tfa1 resin (lane 3). The domain B polypeptide was not detected in the bound fraction prepared from the control GST resin (lane 2). Both N-terminal deletion derivatives, GST1/200C and GST1/322C, showed a modest binding to the domain B polypeptide, whereas no trace amount of the domain B polypeptide was detected in the bound fraction from the GST1/409C-immobilized resin (lanes 4–6). A C-terminal deletion derivative, GST1/N417, captured the domain B polypeptide as efficiently as full-length Tfa1 (lane 7). Further deletions extending to the N terminus (GST1/N304, GST1/N189, GST1/N122, and GST1/N55) resulted in a decrease in the binding activity (lanes 8–11). The fusion protein bearing the region from residues 322 to 406 (GST1/322–406) captured the domain B polypeptide as efficiently as GST1/200C and GST1/322C (lane 12). These results indicate that both the N-terminal (residues 1–55) and internal (residues 322–406) amino acids of Tfa1 are involved in the binding to domain B of Gal11. The former is characterized by the abundance of hydrophobic residues (isoleucine, leucine, and valine), and the latter by the presence of a long stretch of glutamic acid (Fig.1 A). When the protein-immobilized resin was washed with 0.5m potassium acetate, the domain B polypeptide remained bound to the resin of full-length Tfa1 (Fig. 1 B, lane 14) or of GST1/N417 (data not shown). In contrast, neither GST1/200C nor GST1/N304 could retain the domain B polypeptide under these conditions (lanes 15 and 16). These results led us to conclude that both the N-terminal hydrophobic and internal glutamic acid-rich regions of Tfa1 are required for the normal interaction with domain B of Gal11 and that either one is capable of mediating a weak binding. Next we analyzed Tfa2 for the region involved in the interaction with domain A of Gal11. Various fusion derivatives of GST/Tfa2 and a bacterial extract containing the domain A polypeptide of Gal11 (amino acids 716–929) (Fig. 2 A) were used for the binding assay as described above. As shown in Fig.2 B, the domain A polypeptide was retained on the GST/Tfa2 resin, but not on the control resin (lanes 2 and 3). The results of the N- and C-terminal deletion analyses indicated that the C-terminal 51 amino acids (GST2/278C) were sufficient for interaction with domain A (lanes 4–9). The fusion GST2/215–316, but neither GST2/215–290 nor GST2/215–277, captured the domain A polypeptide (lanes 10–12). We thus conclude that the minimal region required for interaction with domain A of Gal11 resides between amino acids 278 and 316 of Tfa2, a domain rich in basic amino acids (Fig. 2 A). Deletion in domain B of Gal11 (from amino acids 48 to 326), which mediates the interaction with TFIIE at subunit Tfa1, is known to cause a partial loss of the Gal11 function in the cell (24Sakurai H. Kim Y.-J. Ohishi T. Kornberg R.D. Fukasawa T. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 9488-9492Crossref PubMed Scopus (30) Google Scholar). In a strain containing such a deletion (gal11-ΔB), the interaction between Gal11 and TFIIE should be mediated through domain A and Tfa2. If the domain A-binding region of Tfa2 was also deleted in the gal11-ΔB mutant, the interaction between Gal11 and TFIIE should be totally abolished. Such a yeast mutant should exhibit phenotypes similar to those of gal11 null mutations (gal11 Δ). Cells carrying a gal11 Δ mutation were able to grow on rich glucose medium (YPD) at 30 °C, but not at 37 °C or on galactose medium (EB" @default.
• W2037442830 created "2016-06-24" @default.
• W2037442830 creator A5024928773 @default.
• W2037442830 creator A5089479974 @default.
• W2037442830 date "1997-12-01" @default.
• W2037442830 modified "2023-09-30" @default.
• W2037442830 title "Yeast Gal11 and Transcription Factor IIE Function through a Common Pathway in Transcriptional Regulation" @default.
• W2037442830 cites W1498217517 @default.
• W2037442830 cites W1538598346 @default.
• W2037442830 cites W1559808711 @default.
• W2037442830 cites W1561181474 @default.
• W2037442830 cites W1577115462 @default.
• W2037442830 cites W1606986928 @default.
• W2037442830 cites W1780849736 @default.
• W2037442830 cites W1791227751 @default.
• W2037442830 cites W1965652496 @default.
• W2037442830 cites W1972303909 @default.
• W2037442830 cites W1982307936 @default.
• W2037442830 cites W2001208673 @default.
• W2037442830 cites W2008892995 @default.
• W2037442830 cites W2009523975 @default.
• W2037442830 cites W2014902004 @default.
• W2037442830 cites W2016736163 @default.
• W2037442830 cites W2017777009 @default.
• W2037442830 cites W2018159372 @default.
• W2037442830 cites W2018447274 @default.
• W2037442830 cites W2026238009 @default.
• W2037442830 cites W2026715418 @default.
• W2037442830 cites W2028919668 @default.
• W2037442830 cites W2030509081 @default.
• W2037442830 cites W2035718514 @default.
• W2037442830 cites W2040249554 @default.
• W2037442830 cites W2047049388 @default.
• W2037442830 cites W2047723385 @default.
• W2037442830 cites W2054396191 @default.
• W2037442830 cites W2063358703 @default.
• W2037442830 cites W2066575037 @default.
• W2037442830 cites W2070271010 @default.
• W2037442830 cites W2073601693 @default.
• W2037442830 cites W2080669907 @default.
• W2037442830 cites W2087950896 @default.
• W2037442830 cites W2090594487 @default.
• W2037442830 cites W2123477328 @default.
• W2037442830 cites W2127533921 @default.
• W2037442830 cites W2129560423 @default.
• W2037442830 cites W2147808841 @default.
• W2037442830 cites W2149920358 @default.
• W2037442830 cites W2153110406 @default.
• W2037442830 cites W2169333620 @default.
• W2037442830 cites W2289674306 @default.
• W2037442830 cites W4237570448 @default.
• W2037442830 cites W4254483562 @default.
• W2037442830 doi "https://doi.org/10.1074/jbc.272.51.32663" @default.
• W2037442830 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9405484" @default.
• W2037442830 hasPublicationYear "1997" @default.
• W2037442830 type Work @default.
• W2037442830 sameAs 2037442830 @default.
• W2037442830 citedByCount "15" @default.
• W2037442830 countsByYear W20374428302013 @default.
• W2037442830 countsByYear W20374428302021 @default.
• W2037442830 crossrefType "journal-article" @default.
• W2037442830 hasAuthorship W2037442830A5024928773 @default.
• W2037442830 hasAuthorship W2037442830A5089479974 @default.
• W2037442830 hasBestOaLocation W20374428301 @default.
• W2037442830 hasConcept C104317684 @default.
• W2037442830 hasConcept C138885662 @default.
• W2037442830 hasConcept C14036430 @default.
• W2037442830 hasConcept C179926584 @default.
• W2037442830 hasConcept C27153228 @default.
• W2037442830 hasConcept C2777576037 @default.
• W2037442830 hasConcept C2779222958 @default.
• W2037442830 hasConcept C41895202 @default.
• W2037442830 hasConcept C54355233 @default.
• W2037442830 hasConcept C55493867 @default.
• W2037442830 hasConcept C70721500 @default.
• W2037442830 hasConcept C86339819 @default.
• W2037442830 hasConcept C86803240 @default.
• W2037442830 hasConcept C95444343 @default.
• W2037442830 hasConceptScore W2037442830C104317684 @default.
• W2037442830 hasConceptScore W2037442830C138885662 @default.
• W2037442830 hasConceptScore W2037442830C14036430 @default.
• W2037442830 hasConceptScore W2037442830C179926584 @default.
• W2037442830 hasConceptScore W2037442830C27153228 @default.
• W2037442830 hasConceptScore W2037442830C2777576037 @default.
• W2037442830 hasConceptScore W2037442830C2779222958 @default.
• W2037442830 hasConceptScore W2037442830C41895202 @default.
• W2037442830 hasConceptScore W2037442830C54355233 @default.
• W2037442830 hasConceptScore W2037442830C55493867 @default.
• W2037442830 hasConceptScore W2037442830C70721500 @default.
• W2037442830 hasConceptScore W2037442830C86339819 @default.
• W2037442830 hasConceptScore W2037442830C86803240 @default.
• W2037442830 hasConceptScore W2037442830C95444343 @default.
• W2037442830 hasIssue "51" @default.
• W2037442830 hasLocation W20374428301 @default.
• W2037442830 hasOpenAccess W2037442830 @default.
• W2037442830 hasPrimaryLocation W20374428301 @default.
• W2037442830 hasRelatedWork W1985480577 @default.
• W2037442830 hasRelatedWork W2009810460 @default.

• next