FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2038748897> ?p ?o ?g. }

• W2038748897 endingPage "5512" @default.
• W2038748897 startingPage "5505" @default.
• W2038748897 abstract "The sensitivity of μ and δ receptor binding to dithiothreitol and N-ethylmaleimide was examined to probe receptor structure and function. Binding to both receptor types was inhibited by dithiothreitol (IC50 values = 250 mM), suggesting the presence of inaccessible but critical disulfide linkages. μ receptor binding was inhibited with more rapid kinetics and at lower N-ethylmaleimide concentrations than δ receptor binding. Ligand protection against N-ethylmaleimide inactivation suggested that alkylation was occurring within, or in the vicinity of, the receptor binding pocket. Sodium ions dramatically affected the IC50 of N-ethylmaleimide toward both receptor types in a ligand-dependent manner. Analysis of receptor chimeras suggested that the site of N-ethylmaleimide alkylation on the μ receptor was between transmembrane domains 3 and 5. Substitution of cysteines between transmembrane domains 3 and 5 and elsewhere had no effect on receptor binding or sensitivity toward N-ethylmaleimide. Serine substitution of His223 in the putative second extracellular loop linking transmembrane domains 4 and 5 protected against N-ethylmaleimide inactivation. The H223S substitution decreased the affinity of bremazocine 25-fold, highlighting the importance of this residue for the formation of the high affinity bremazocine binding site in the μ opioid receptor. The sensitivity of μ and δ receptor binding to dithiothreitol and N-ethylmaleimide was examined to probe receptor structure and function. Binding to both receptor types was inhibited by dithiothreitol (IC50 values = 250 mM), suggesting the presence of inaccessible but critical disulfide linkages. μ receptor binding was inhibited with more rapid kinetics and at lower N-ethylmaleimide concentrations than δ receptor binding. Ligand protection against N-ethylmaleimide inactivation suggested that alkylation was occurring within, or in the vicinity of, the receptor binding pocket. Sodium ions dramatically affected the IC50 of N-ethylmaleimide toward both receptor types in a ligand-dependent manner. Analysis of receptor chimeras suggested that the site of N-ethylmaleimide alkylation on the μ receptor was between transmembrane domains 3 and 5. Substitution of cysteines between transmembrane domains 3 and 5 and elsewhere had no effect on receptor binding or sensitivity toward N-ethylmaleimide. Serine substitution of His223 in the putative second extracellular loop linking transmembrane domains 4 and 5 protected against N-ethylmaleimide inactivation. The H223S substitution decreased the affinity of bremazocine 25-fold, highlighting the importance of this residue for the formation of the high affinity bremazocine binding site in the μ opioid receptor. INTRODUCTIONThree major types of opioid receptor, δ, κ, and μ, have been cloned and characterized extensively (reviewed in (1.Reisine T. Bell G.I. Trends Pharmacol. Sci. 1993; 16: 506-510Scopus (329) Google Scholar) and (2.Knapp R.J. Malatynska E. Collins N. Fang L. Wang J.Y. Hruby V.J. Roeske W.R. Yamamura H.I. FASEB J. 1995; 9: 516-525Crossref PubMed Scopus (216) Google Scholar)). There is approximately 60% amino acid sequence identity between the opioid receptor types. The δ, κ, and μ opioid receptors have unique ligand specificities, anatomical distributions, and physiological functions(3.Mansour A. Watson S.J. Handb. Exp. Pharmacol. 1993; 104: 79-106Crossref Google Scholar). Morphine, related opioid drugs, and the endogenous opioid peptides activate signal transduction pathways by binding to opioid receptors(4.Simon E.J. Hiller J.M. Siegel G.J. Albers R.W. Agranoff B.W. Katzman R. Basic Neurochemistry: Molecular, Cellular, and Medical Aspects. Raven Press, New York1994: 321-339Google Scholar), which are members of the G protein-coupled receptor family(5.Strader C.D. Fong T.M. Tota M.R. Underwood D. Dixon R.A.F. Annu. Rev. Biochem. 1994; 63: 101-132Crossref PubMed Scopus (991) Google Scholar). G protein-coupled receptors are seven-transmembrane domain (TM) ( 1The abbreviations used are: TMtransmembrane domain(s)DAMGO[D-Ala2,MePhe4,Gly-ol5]enkephalinDSLET[D-Ser2,Leu5] enkephalin-Thr6DTTdithiothreitolNEMN-ethylmaleimide.) proteins that mediate signal transduction across the plasma membrane. The ligands approach and engage the receptor from the extracellular side, and receptor activation results in the coupling to heterotrimeric G proteins on the intracellular face of the membrane. Opioid receptor types interact with multiple G proteins (6.Laugwitz K-L. Ofermanns S. Spicher K. Schultz G. Neuron. 1993; 10: 233-242Abstract Full Text PDF PubMed Scopus (155) Google Scholar, 7.Carter B.D. Medzihradsky F. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 4062-4066Crossref PubMed Scopus (96) Google Scholar, 8.Prather P.L. McGinn T.M. Erickson L.J. Evans C.J. Loh H.H. Law P.Y. J. Biol. Chem. 1994; 269: 21293-21302Abstract Full Text PDF PubMed Google Scholar) to regulate adenylyl cyclase, Ca2⁺ channels, and K⁺ channels.It has been known from early studies on the characterization of opioid receptors that specific binding is inhibited by sulfhydryl reagents, such as iodoacetamide, N-ethylmaleimide (NEM), and p-hydroxymercuribenzoate(9.Simon E.J. Hiller J.M. Edelman I. Proc. Natl. Acad. Sci. U. S. A. 1973; 70: 1947-1949Crossref PubMed Scopus (846) Google Scholar, 10.Simon E.J. Groth J. Proc. Natl. Acad. Sci. U. S. A. 1975; 72: 2404-2407Crossref PubMed Scopus (127) Google Scholar, 11.Pasternak G.W. Wilson H.A. Snyder S.H. Mol. Pharmacol. 1975; 11: 340-351PubMed Google Scholar). Preincubation with opioid ligands protected against receptor inactivation, suggesting that the sensitive sulfhydryl group was located within or near the binding site. Evidence has been obtained that analogs of Leu-enkephalin and morphine, containing activated sulfhydryl groups, form mixed disulfide linkages with opioid receptors(12.Kodama H. Shimohigashi Y. Ogasawara T. Koshizaki T. Kurono M. Matsueda R. Soejima K. Kondo M. Yagi K. Biochem. Int. 1989; 19: 1159-1164PubMed Google Scholar, 13.Kanematsu K. Naito R. Shimohigashi Y. Ohno M. Ogasawara T. Kurono M. Yagi K. Chem. Pharm. Bull. 1990; 38: 1438-1440Crossref PubMed Scopus (12) Google Scholar). The covalently bound agonists caused receptor activation that persisted following extensive washing, yet was naloxone-reversible. The results suggested that the agonists became tethered to the receptor via a mixed disulfide linkage that was in the vicinity of the receptor binding site. Other studies provided evidence that NEM affected opioid agonist binding by at least two mechanisms, direct inhibition (as mentioned above) and indirect inhibition due to uncoupling of receptors from G proteins(14.Mullikin-Kilpatrick D. Larsen N.E. Blume A.J. J. Neurosci. 1983; 3: 145-152Crossref PubMed Google Scholar, 15.Childers S.R. J. Pharmacol. Exp. Ther. 1984; 230: 684-691PubMed Google Scholar).Several other, but not all, G protein-coupled receptors are also sensitive to sulfhydryl reagents. Susceptible receptors include the thyrotropin-releasing hormone(16.Sharif N.A. Burt D.R. J. Neurochem. 1984; 42: 209-214Crossref PubMed Scopus (12) Google Scholar), D1 and D2 dopamine(17.Sidhu A. Kassis S. Kebabian J. Fishman P.H. Biochemistry. 1986; 25: 6695-6701Crossref PubMed Scopus (45) Google Scholar, 18.Chazot P.L. Strange P.G. Biochem. J. 1992; 281: 377-380Crossref PubMed Scopus (7) Google Scholar), substance P(19.Sharma P.M. Musacchio J.M. Eur. J. Pharmacol. 1987; 138: 9-19Crossref PubMed Scopus (11) Google Scholar), α1 and α2 adrenoreceptor(20.Reader T.A. Brière R. Grondin L. Neurochem. Res. 1986; 11: 9-27Crossref PubMed Scopus (20) Google Scholar), platelet-activating factor(21.Ng D.S. Wong K. Eur. J. Pharmacol. 1988; 154: 47-52Crossref PubMed Scopus (6) Google Scholar), leukotriene B4(22.Falcone R.C. Aharony D. J. Pharmacol. Exp. Ther. 1990; 255: 565-571PubMed Google Scholar), vasopressin(23.Pavo I. Fahrenholz F. FEBS Lett. 1990; 272: 205-208Crossref PubMed Scopus (18) Google Scholar), follicle-stimulating hormone(24.Santa-Coloma T.A. Grasso P. Reichert L.E. Biochem. Biophys. Res. Commun. 1991; 176: 1256-1261Crossref PubMed Scopus (13) Google Scholar), and cannabinoid receptors(25.Lu R. Hubbard J.R. Martin B.R. Kalimi M.Y. Mol. Cell. Biochem. 1993; 121: 119-126Crossref PubMed Scopus (26) Google Scholar). Recently, a cysteine in TM3 of the D2 dopamine receptor has been identified that reacts with sulfhydryl reagents and results in inhibition of binding(26.Javitch J.A. Li X. Kaback J. Karlin A. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 10355-10359Crossref PubMed Scopus (132) Google Scholar).The goals of this study were 1) to examine the sensitivity of μ and δ receptor binding to reduction with dithiothreitol (DTT), in order to determine whether disulfide linkages were necessary for maintenance of the binding site, and 2) to characterize the sensitivity of μ and δ receptor binding to alkylation with NEM and identify the reactive groups involved. Due to the proximity of the NEM-reactive group to the ligand binding site of the receptor, knowledge of its location is essential for construction of accurate molecular models of the binding pocket.EXPERIMENTAL PROCEDURESTransfection and Radioligand Binding AssaysHuman embryonic kidney 293 cells (ATCC CRL 1573) were transfected with μ and δ opioid receptor expression plasmids (obtained from Drs. L. Yu and C. Evans, respectively) using the calcium phosphate method, as described (27.Shahrestanifar M. Howells R.D. Regul. Peptides. 1994; 54: 269-270Crossref Scopus (4) Google Scholar). Cells stably expressing opioid receptors were selected in media containing 0.5 mg/ml G418 (Life Technologies, Inc.). Opioid receptor binding assays (28.Howells R.D. Gioannini T. Hiller J.M. Simon E.J. J. Pharmacol. Exp. Ther. 1982; 222: 629-634PubMed Google Scholar) were conducted in duplicate or quadruplicate on membrane preparations resuspended in 50 mM Tris-HCl, 1 mM Na4EDTA buffer, pH 7.4, utilizing [9-3H](-)bremazocine (DuPont NEN; specific activity, 20-30 Ci/mmol) and 10 μM naloxone to define specific binding. Following a 1-h incubation at 22°C, binding assays were terminated by filtration through Whatman GF/B filters that had been presoaked in 0.1% bovine serum albumin. Filters were soaked in BCS liquid scintillation mixture (Amersham Corp.) prior to determination of filter-bound radioactivity using a Beckman LS 1701 scintillation counter. Receptor binding data was analyzed by nonlinear regression using the Prism program (GraphPad Software, San Diego, CA). Protein concentrations were determined by the method of Bradford(29.Bradford M.M. Anal. Biochem. 1982; 72: 248-254Crossref Scopus (213510) Google Scholar), using bovine serum albumin as the standard.Treatment of Membranes with DTT and NEMTo determine the effect of disulfide bond reduction on μ and δ receptor binding, DTT (1-100 mM) was added immediately prior to performing radioligand binding assays. The effect of NEM alkylation on μ and δ receptor binding was generally determined by preincubating membranes in the absence and presence of varying concentrations of NEM (0.5 μM to 5 mM) at 37°C for 15 min, followed by the addition of 5 mM reduced glutathione to all samples to quench the reaction. Initially, membranes were washed by centrifugation in order to remove the NEM and glutathione prior to the start of the radioligand binding assays; however, the washes were subsequently found to have no effect on the outcome of the assay. Protection of μ and δ receptor binding against NEM inactivation was assessed by preincubating membranes in the absence and presence of ligands (100 nM or 1 μM) for 10 min at 37°C, prior to reaction with 0.5 mM NEM for 15 min at 37°C. Samples were chilled on ice, and glutathione was added to 5 mM. Ligands were removed by centrifugation at 35,000 × g for 20 min. Membranes were resuspended in 50 mM Tris-HCl, 1 mM Na4EDTA buffer, pH 7.4, incubated for 10 min at 37°C to promote ligand dissociation, and then centrifuged and resuspended two more times prior to initiating the radioligand binding assay.Construction of Receptor ChimerasReceptor chimeras were constructed using a two-step polymerase chain reaction process followed by direct subcloning into the pCR3 expression vector, as described previously(30.Wang W.W. Shahrestanifar M. Jin J. Howells R.D. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 12436-12440Crossref PubMed Scopus (85) Google Scholar). Receptor chimeras D2M, D3M, D5M, and the reciprocal chimeras M2D and M5D were used in these studies. Designations for chimeras indicate the origin of the amino-terminal domain on the left and the carboxyl-terminal domain on the right (M represents μ, and D represents δ), separated by a number, which refers to the transmembrane helix that is the site of the junction. Thus, the chimera referred to as D2M contains the amino terminus derived from the δ receptor, the site of the δ/μ junction is in TM2, and the carboxyl terminus is derived from the μ receptor. All chimeric receptor constructs were fully sequenced to verify the location of the junction site and to ensure that no mutations were introduced during synthesis.Site-directed MutagenesisThe two-step polymerase chain reaction technique used for site-directed mutagenesis has been described previously(30.Wang W.W. Shahrestanifar M. Jin J. Howells R.D. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 12436-12440Crossref PubMed Scopus (85) Google Scholar). Individual μ receptor variants were produced containing serine substitution of cysteines at positions 159, 190, 235, 292, and 321 and histidine at position 223. Mutant receptors are named with the wild-type residue, the position number of the residue, and the substituted residue, using single letter abbreviations for amino acids. The following complementary oligonucleotide pairs were synthesized (Operon Technologies, Inc., Alameda, CA) to accomplish the mutagenesis (nucleotide sequences are in the 5′ to 3′ direction, + signifies the sense DNA strand, and - signifies the antisense DNA strand): C159S+, ATTCACCCTCAGCACCATGAGCGT; C159S-, ACGCTCATGGTGCTGAGGGTGAAT; C190S+, CGTCAACGTCAGCAACTGGAT; C190S-, ATCCAGTTGCTGACGTTGACG; C235S+, CTCAAAATCAGTGTCTTTAT; C235S-, ATAAAGACACTGATTTTGAG; C292S+, GTATTTATCGTCTCCTGGACCCCCA; C292S-, TGGGGGTCCAGGAGACGATAAATAC; C321S+, TCCTGGCACTTCTCCATTGCTTTGG; C321S-, CCAAAGCAATGGAGAAGTGCCAGGA; H223S+, CACGTTCTCCTCCCCAACCTGGT; H223S-, ACCAGGTTGGGGAGGAGAACGTG.The ΔN 64 amino-terminal deletion was generated in a similar manner, with the following sense strand oligonucleotide, ATGGTCACAGCCATTACC. The ΔN 89 amino-terminal deletion was an unexpected byproduct of the polymerase chain reaction reaction used to generate the C321S mutation.RESULTSEffect of DTT on μ and δ Opioid Receptor BindingThe importance of disulfide bonds for the maintenance of active opioid receptor conformations was studied by comparing the effect of the disulfide reducing agent, DTT, on μ and δ opioid receptor binding. [3H]Bremazocine, a ligand of the benzomorphan series with high affinity for μ and δ opioid receptors(30.Wang W.W. Shahrestanifar M. Jin J. Howells R.D. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 12436-12440Crossref PubMed Scopus (85) Google Scholar), was used to measure specific binding to both receptor types in the absence and presence of varying concentrations (1-100 mM) of dithiothreitol. Binding to both opioid receptor types was inhibited to approximately 60% of control levels, but only at relatively high concentrations of the disulfide reducing agent (Fig. 1). Nonlinear regression analysis of the DTT inhibition curves yielded extrapolated IC50 values of 230-250 mM for inhibition of both μ and δ opioid receptor binding.In the course of determining the optimal concentration of glutathione to use to quench NEM reactions, we were surprised to observe that [3H]bremazocine binding to μ and δ receptors was considerably more sensitive to incubation with reduced glutathione than with DTT. The IC50 of glutathione was approximately 15 mM for inhibition of [3H]bremazocine binding to μ and δ receptors, and the slopes of the inhibition curves were very steep (data not shown). Similar results were reported for binding to μ opioid, neurokinin-1, and kainic acid receptors(31.Liu Y.F. Quirion R. J. Neurochem. 1992; 59: 1024-1032Crossref PubMed Scopus (17) Google Scholar). We found, however, that the inhibition of binding by glutathione was due to lowering the pH of the buffer solution, due to the acidic nature of the tripeptide. We suggest, therefore, that the results on glutathione inhibition of binding to neurokinin-1 and kainic acid receptors be interpreted with caution.Comparison of the Effect of NEM on Wild-type μ and δ Opioid Receptor Binding and Protection by LigandThe kinetics of NEM inactivation were significantly more rapid for μ receptor binding than for δ receptor binding (Fig. 2). Half-lives of inactivation were calculated by nonlinear regression analysis to be 8 and 56 min for μ and δ opioid receptor binding, respectively. Pseudo-first-order rate constants were 0.09 min⁻1 and 0.01 min⁻1 for inactivation of μ and δ opioid receptor binding, respectively. The inhibitory effect of NEM on receptor binding was due primarily to an 8-fold reduction in the maximum number of binding sites, with little change in the affinity of the remaining receptors for bremazocine (Table 1).Figure 2:Kinetics of NEM inactivation of μ and δ opioid receptor binding. Membrane preparations from cells stably expressing either μ or δ receptors were incubated at 37°C in the absence and presence of 0.5 mM NEM. All samples were quenched with 5 mM glutathione at the indicated times and then assayed for specific binding of 2 nM [3H]bremazocine. Data points are the means ± S.E. from three or four independent experiments.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Tabled 1 Open table in a new tab The ability of agonist and antagonist ligands to protect against NEM inactivation of μ and δ opioid receptor binding was determined. Both receptor types were protected against NEM inactivation by preincubation with ligands, although protection of μ receptor binding was more complete (Fig. 3). All ligands tested were capable of protection, including type-selective peptide agonists (DAMGO and DSLET), alkaloid agonists (morphine and etorphine), and the antagonist, naloxone. The data indicated that the NEM-reactive group on both receptor types resided within, or in the vicinity of, the ligand binding crevice.Figure 3:Protection against NEM inactivation of [3H]bremazocine binding to μ and δ opioid receptors by opioid ligands. A, protection of μ opioid receptor binding. B, protection of δ opioid receptor binding. Membrane preparations from cells stably expressing either μ or δ receptors were preincubated at 37°C for 10 min in the absence and presence of opioid ligands (either 100 nM or 1 μM) and then incubated either for 15 min in the absence or presence of 0.5 mM NEM (for μ opioid receptor binding) or for 30 min in the absence or presence of 2.5 mM NEM (for δ opioid receptor binding). Glutathione (5 mM) was added to all samples, and then ligands were removed by centrifugation at 35,000 × g for 20 min. Membranes were resuspended in 50 mM Tris-HCl, 1 mM Na4EDTA buffer, pH 7.4, incubated for 10 min at 37°C to promote ligand dissociation, and then rewashed twice by centrifugation prior to initiating the radioligand binding assay using 2 nM [3H]bremazocine. Values are the means ± S.E. of four independent experiments.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Sodium Ions Differentially Affect the NEM Sensitivity of Peptide and Bremazocine Binding to μ and δ Opioid ReceptorsThe specific binding of [3H]DAMGO to the μ receptor was slightly more susceptible to inactivation by NEM than the specific binding of [3H]bremazocine when assayed in Tris-EDTA buffer (Fig. 4). The presence of 100 mM NaCl in the buffer, however, differentially altered the sensitivity of DAMGO and bremazocine binding to NEM inactivation. The IC50 of NEM toward inactivation of DAMGO binding to the μ receptor decreased significantly in the presence of 100 mM NaCl from 32 to 3 μM, while the IC50 of NEM toward inactivation of bremazocine increased from 85 to 330 μM (Fig. 4).Figure 4:NEM inactivation of [3H]DAMGO and [3H]bremazocine binding to the μ opioid receptor in the presence and absence of NaCl. Membrane preparations from cells stably expressing μ opioid receptors were incubated for 15 min at 37°C with various concentrations of NEM in Tris-EDTA buffer with or without 100 mM NaCl and then assayed for specific binding of [3H]DAMGO (4 nM) or [3H]bremazocine (2 nM). The presence of NaCl caused the NEM inactivation curve of [3H]DAMGO binding to shift to the left and the NEM inactivation curve of [3H]bremazocine binding to shift to the right. The curves are from one data set that is representative of four independent experiments.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Binding to the δ receptor was considerably less sensitive to NEM inactivation than was binding to the μ receptor. [3H] DSLET and [3H]bremazocine binding to the δ receptor were also differentially affected by inclusion of 100 mM NaCl in the buffer (Fig. 5), in a similar manner to that observed with μ receptor binding. The IC50 of NEM toward inactivation of DSLET binding to the δ receptor decreased markedly in the presence of 100 mM NaCl from 450 to 8 μM, while the IC50 of NEM toward inactivation of bremazocine increased from 660 μM to 3.6 mM.Figure 5:NEM inactivation of [3H]DSLET and [3H]bremazocine binding to the δ opioid receptor in the presence and absence of NaCl. Membrane preparations from cells stably expressing δ opioid receptors were incubated for 15 min at 37°C with various concentrations of NEM in Tris-EDTA buffer with or without 100 mM NaCl and then assayed for specific binding of [3H]DSLET (4 nM) or [3H]bremazocine (2 nM). The presence of NaCl caused the NEM inactivation curve of [3H]DSLET binding to shift to the left and the NEM inactivation curve of [3H]bremazocine binding to shift to the right. The curves are from one data set that is representative of four independent experiments.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Utilization of μ/δ Receptor Chimeras to Search for the Site of NEM Alkylation on the μ Opioid ReceptorThe μ receptor contains 17 cysteines (Fig. 6). A strategy utilizing μ/δ receptor chimeras was devised to determine the location of the NEM alkylation site on the μ receptor, based on the large difference in sensitivity of [3H]bremazocine binding to μ and δ receptors toward NEM inactivation. A panel of chimeric receptors was generated, utilizing junction sites shown in Fig. 6. A schematic illustration of the structures of the μ/δ receptor chimeras is displayed in Fig. 7. D2M, D3M, and D5M contain δ receptor sequences from the amino termini to junction sites in TM2, TM3, and TM5, respectively, followed by sequences derived from the μ receptor from the junction site to the carboxyl termini. M2D and M5D are reciprocal chimeras, with amino-terminal domains derived from the μ receptor, junction sites in TM2 or TM5, respectively, followed by δ receptor-derived sequences to the carboxyl termini.Figure 6:The amino acid sequence and proposed transmembrane topology of the rat μ opioid receptor. The amino terminus is on the extracellular side and the carboxyl terminus is on the intracellular side of the plasma membrane. Transmembrane helices 1-7 are shown from left to right. Cys residues and His223 are shaded. Cysteines that were substituted with serine and His223 are numbered. Sites of amino-terminal deletions (ΔN 64 and ΔN 89) are indicated. The presumed disulfide bond between Cys140 and Cys217, in putative extracellular loops 2 and 3, respectively, is indicated with a connecting bar. One of the two cysteines in the carboxyl-terminal tail is shown with a schematic palmitoyl group inserted into the cytoplasmic side of the plasma membrane. Junction sites used to construct μ/δ receptor chimeras are indicated with boldface circles. These amino acids are encoded by contiguous homologous nucleotide sequences. Possible sites of N-linked glycosylation (NX(S/T), where X is any amino acid except P) in the amino-terminal domain are shown schematically with core oligosaccharides.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Figure 7:Schematic illustration of the structures of μ/δ receptor chimeras used in these studies along with the wild-type receptors. DOR, wild-type δ opioid receptor; MOR, wild-type μ opioid receptor. Designations for chimeras indicate the origin of the amino-terminal domain on the left and the carboxyl-terminal domain on the right (μ = M, δ = D), separated by a number which refers to the transmembrane helix that is the site of the junction. δ opioid receptor sequences are shown in white; μ opioid receptor sequences are shaded; junction sites are depicted as black boxes.View Large Image Figure ViewerDownload Hi-res image Download (PPT)The ability of NEM to inactivate [3H]bremazocine binding to wild-type μ and δ receptors and μ/δ receptor chimeras was compared (Table 2). [3H]Bremazocine binding to wild-type μ receptors was 10 times more sensitive to NEM inactivation when compared with binding to δ receptors (NEM IC50 values were 0.16 and 1.6 mM, respectively). Binding to the D2M receptor chimera was inactivated by NEM at similar concentrations as binding to the μ receptor (IC50 = 0.29 mM), while the sensitivity of the D5M chimera was even greater than the wild-type δ receptor (IC50 = 4.3 mM). These data suggested than the NEM-reactive groups in the μ and δ receptor resided between TM2 and TM5. Data from the reciprocal M2D and M5D chimeras were consistent with this assumption; the M2D chimera behaved like the δ receptor, and the M5D chimera was even more sensitive than the μ receptor with respect to the NEM IC50 for inactivation of [3H]bremazocine binding (Table 2). Analysis of the NEM sensitivity of the D3M chimera (with a μ receptor-like IC50 = 0.05 mM) led to the more focused prediction that the NEM-reactive group in the μ receptor was in the region between the junction sites in TM3 and TM5.Tabled 1 Open table in a new tab Utilization of Truncated and Site-specific μ Receptor Mutants to Determine the Site of NEM Alkylation on the μ Opioid ReceptorBased on the results regarding the NEM sensitivity of [3H]bremazocine binding to μ/δ receptor chimeras, cysteines in TM3, TM4, and TM5 of the μ receptor were individually substituted with Ser and then evaluated for their ability to bind [3H]bremazocine and for their sensitivity toward NEM inhibition of binding. The Ser for Cys substitutions did not affect the affinity of the mutated receptors for bremazocine (data not shown). Furthermore, the NEM IC50 values of the three Ser-substituted μ receptors (0.11-0.28 mM) were all in the same range as that of the wild-type μ receptor (0.16 mM, Table 3). These data indicated that Cys159, Cys190, and Cys235 were not the sites of NEM alkylation that resulted in inhibition of [3H]bremazocine binding.Tabled 1 Open table in a new tab Based on these results, Ser was substituted for other cysteines residing outside of the region between TM3 and TM5, and the mutant receptors were tested for sensitivity to NEM. Ser substitution of either Cys292 or Cys321, located in TM6 and TM7, respectively, did not affect the ability to bind [3H]bremazocine or the sensitivity toward NEM inhibition of binding (Table 3). Deletion of 64 amino acids from the amino-terminal domain (ΔN 64), which contains four cysteines at positions 13, 22, 43, and 57 (see Fig. 6), did not affect the affinity of the truncated receptor for [3H]bremazocine (KD = 1.3 nMversus 0.8 nM for the wild-type μ receptor). It has also been reported previously that this deletion did not affect the binding of [3H]naloxone and [3H]DAMGO to the μ receptor(32.Surratt C.K. Johnson P.S. Moriwaki A. Seidleck B.K. Blaschak C.J. Wang J.B. Uhl G.R. J. Biol. Chem. 1994; 269: 20548-20553Abstract Full Text PDF PubMed Google Scholar). The concentration of NEM required for inactivation of bremazocine binding to the truncated receptor was increased 3-fold relative to the wild-type μ receptor (Table 3); however, the IC50 was still in the submillimolar range (0.57 mM). We also tested the effect of removal of 89 amino acids from the amino terminus of the C321S mutant receptor. The deleted region of this construct, referred to as ΔN 89, included the amino-terminal domain and most of putative TM1, including Cys79 (Fig. 6) The affinity of [3H]bremazocine for the ΔN 89 construct decreased" @default.
• W2038748897 created "2016-06-24" @default.
• W2038748897 creator A5011134089 @default.
• W2038748897 creator A5029656745 @default.
• W2038748897 creator A5073897448 @default.
• W2038748897 date "1996-03-01" @default.
• W2038748897 modified "2023-10-07" @default.
• W2038748897 title "Studies on Inhibition of μ and δ Opioid Receptor Binding by Dithiothreitol and N-Ethylmaleimide" @default.
• W2038748897 cites W1482251675 @default.
• W2038748897 cites W1544947217 @default.
• W2038748897 cites W1549281008 @default.
• W2038748897 cites W1550501528 @default.
• W2038748897 cites W1581994435 @default.
• W2038748897 cites W1585778217 @default.
• W2038748897 cites W1606876786 @default.
• W2038748897 cites W1643360359 @default.
• W2038748897 cites W1686581241 @default.
• W2038748897 cites W1968977890 @default.
• W2038748897 cites W1973646755 @default.
• W2038748897 cites W1977710785 @default.
• W2038748897 cites W1979667747 @default.
• W2038748897 cites W1981493631 @default.
• W2038748897 cites W1984414350 @default.
• W2038748897 cites W1990923433 @default.
• W2038748897 cites W1991315547 @default.
• W2038748897 cites W1992754535 @default.
• W2038748897 cites W1993620919 @default.
• W2038748897 cites W1995105490 @default.
• W2038748897 cites W1996215570 @default.
• W2038748897 cites W2014765305 @default.
• W2038748897 cites W2019202192 @default.
• W2038748897 cites W202219468 @default.
• W2038748897 cites W2023057828 @default.
• W2038748897 cites W2023750079 @default.
• W2038748897 cites W2025497876 @default.
• W2038748897 cites W2025528306 @default.
• W2038748897 cites W2027197361 @default.
• W2038748897 cites W2059703259 @default.
• W2038748897 cites W2061327263 @default.
• W2038748897 cites W2063069392 @default.
• W2038748897 cites W2064265171 @default.
• W2038748897 cites W2065219516 @default.
• W2038748897 cites W2068731902 @default.
• W2038748897 cites W2069281854 @default.
• W2038748897 cites W2071087516 @default.
• W2038748897 cites W2080287723 @default.
• W2038748897 cites W2081502394 @default.
• W2038748897 cites W2094408039 @default.
• W2038748897 cites W2163865126 @default.
• W2038748897 cites W2235671932 @default.
• W2038748897 cites W2314049691 @default.
• W2038748897 cites W245031103 @default.
• W2038748897 cites W35264894 @default.
• W2038748897 cites W4293247451 @default.
• W2038748897 cites W2065061072 @default.
• W2038748897 doi "https://doi.org/10.1074/jbc.271.10.5505" @default.
• W2038748897 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/8621408" @default.
• W2038748897 hasPublicationYear "1996" @default.
• W2038748897 type Work @default.
• W2038748897 sameAs 2038748897 @default.
• W2038748897 citedByCount "41" @default.
• W2038748897 countsByYear W20387488972012 @default.
• W2038748897 countsByYear W20387488972013 @default.
• W2038748897 crossrefType "journal-article" @default.
• W2038748897 hasAuthorship W2038748897A5011134089 @default.
• W2038748897 hasAuthorship W2038748897A5029656745 @default.
• W2038748897 hasAuthorship W2038748897A5073897448 @default.
• W2038748897 hasBestOaLocation W20387488971 @default.
• W2038748897 hasConcept C12554922 @default.
• W2038748897 hasConcept C170493617 @default.
• W2038748897 hasConcept C181199279 @default.
• W2038748897 hasConcept C185592680 @default.
• W2038748897 hasConcept C2777646807 @default.
• W2038748897 hasConcept C2777824588 @default.
• W2038748897 hasConcept C2779886867 @default.
• W2038748897 hasConcept C2781063702 @default.
• W2038748897 hasConcept C55493867 @default.
• W2038748897 hasConcept C86803240 @default.
• W2038748897 hasConceptScore W2038748897C12554922 @default.
• W2038748897 hasConceptScore W2038748897C170493617 @default.
• W2038748897 hasConceptScore W2038748897C181199279 @default.
• W2038748897 hasConceptScore W2038748897C185592680 @default.
• W2038748897 hasConceptScore W2038748897C2777646807 @default.
• W2038748897 hasConceptScore W2038748897C2777824588 @default.
• W2038748897 hasConceptScore W2038748897C2779886867 @default.
• W2038748897 hasConceptScore W2038748897C2781063702 @default.
• W2038748897 hasConceptScore W2038748897C55493867 @default.
• W2038748897 hasConceptScore W2038748897C86803240 @default.
• W2038748897 hasIssue "10" @default.
• W2038748897 hasLocation W20387488971 @default.
• W2038748897 hasOpenAccess W2038748897 @default.
• W2038748897 hasPrimaryLocation W20387488971 @default.
• W2038748897 hasRelatedWork W1966498680 @default.
• W2038748897 hasRelatedWork W2019847518 @default.
• W2038748897 hasRelatedWork W2038748897 @default.
• W2038748897 hasRelatedWork W2058989860 @default.
• W2038748897 hasRelatedWork W2091877118 @default.
• W2038748897 hasRelatedWork W2104160967 @default.

• next