FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2039006670> ?p ?o ?g. }

• W2039006670 endingPage "7077" @default.
• W2039006670 startingPage "7068" @default.
• W2039006670 abstract "With progressive aging, adipocytes are the major cell types that constitute the bulk of thymic microenvironment. Understanding the origin of thymic adipocytes and mechanisms responsible for age-related thymic adiposity is thus germane for the design of long lasting thymic rejuvenation strategies. We have recently identified that ghrelin, an orexigenic anti-inflammatory peptide, can partially reverse age-related thymic involution. Here we demonstrate that Ghrl and ghrelin receptor (growth hormone secretagogue receptor (GHSR)) are expressed in thymic stromal cells and that their expression declines with physiological aging. Genetic ablation of ghrelin and GHSR leads to loss of thymic epithelial cells (TEC) and an increase in adipogenic fibroblasts in the thymus, suggesting potential cellular transitions. Using FoxN1Cre;R26RstopLacZ double transgenic mice, we provide qualitative evidence that thymic epithelial cells can transition to mesenchymal cells that express proadipogenic regulators in the thymus. We found that loss of functional Ghrl-GHSR interactions facilitates EMT and induces thymic adipogenesis with age. In addition, the compromised thymic stromal microenvironment due to lack of Ghrl-GHSR interactions is associated with reduced number of naive T cells. These data suggest that Ghrl may be a novel regulator of EMT and preserves thymic stromal cell microenvironment by controlling age-related adipocyte development within the thymus. With progressive aging, adipocytes are the major cell types that constitute the bulk of thymic microenvironment. Understanding the origin of thymic adipocytes and mechanisms responsible for age-related thymic adiposity is thus germane for the design of long lasting thymic rejuvenation strategies. We have recently identified that ghrelin, an orexigenic anti-inflammatory peptide, can partially reverse age-related thymic involution. Here we demonstrate that Ghrl and ghrelin receptor (growth hormone secretagogue receptor (GHSR)) are expressed in thymic stromal cells and that their expression declines with physiological aging. Genetic ablation of ghrelin and GHSR leads to loss of thymic epithelial cells (TEC) and an increase in adipogenic fibroblasts in the thymus, suggesting potential cellular transitions. Using FoxN1Cre;R26RstopLacZ double transgenic mice, we provide qualitative evidence that thymic epithelial cells can transition to mesenchymal cells that express proadipogenic regulators in the thymus. We found that loss of functional Ghrl-GHSR interactions facilitates EMT and induces thymic adipogenesis with age. In addition, the compromised thymic stromal microenvironment due to lack of Ghrl-GHSR interactions is associated with reduced number of naive T cells. These data suggest that Ghrl may be a novel regulator of EMT and preserves thymic stromal cell microenvironment by controlling age-related adipocyte development within the thymus. The specialized three-dimensional thymic meshwork is composed of cortex and medulla, which is mainly comprised of distinct developing T cell subsets and diverse specialized thymic stromal cell populations (1Rodewald H.R. Annu. Rev. Immunol. 2008; 26: 355-388Crossref PubMed Scopus (196) Google Scholar). At birth, the thymocytes are the predominant cell types in the thymus; however, by the fifth decade of life in healthy humans, greater than 80% of thymic microenvironment is composed of lipid-laden adipocytes (2Steinmann G.G. Curr. Top. Pathol. 1986; 75: 43-88Crossref PubMed Scopus (288) Google Scholar). The raison d’être of thymus is to produce naive T cells and establish the T cell arm of immunity, whereas the function of adipocytes is to regulate energy homeostasis (3Dixit V.D. J. Leukoc. Biol. 2008; 84: 882-892Crossref PubMed Scopus (122) Google Scholar). Therefore, the development of adipocytes within a small lymphoid organ like the thymus is puzzling given its unlikely impact on overall energy homeostasis. Nonetheless, considering that the aged thymus is almost entirely replaced with adipocytes, the reconstitution strategies for thymic function in the elderly may be limited by the presence of terminally differentiated adipocytes in thymic space.Given that the thymus lacks a pool of self-renewing lymphoid progenitors and needs to be continually seeded by hematopoietic stem cell from bone marrow (4Bhandoola A. von Boehmer H. Petrie H.T. Zuniga-Pflucker J.C. Immunity. 2007; 26: 678-689Abstract Full Text Full Text PDF PubMed Scopus (215) Google Scholar), the replacement of thymic microenvironment with adipocytes could interfere with T cell generation. Furthermore, the homing of hematopoietic stem cell from bone marrow to thymus is orchestrated by a complex array of chemokines produced by TEC 2The abbreviations used are: TEC, thymic epithelial cell; cTEC, cortical TEC; mTEC, medullary TEC; Ghrl, ghrelin; GH, growth hormone; GHSR, growth hormone secretagogue receptor; TSC, thymic stromal cells; EMT, epithelial-to-mesenchymal transition; PPAR, peroxisome proliferator-activated receptor; DAPI, 4′,6-diamidino-2-phenylindole; RT-PCR, real-time-PCR; EVA, early V antigen; AIRE, autoimmune regulator; IL, interleukin; PVS, perivascular space; PEPCK, phosphoenolpyruvate carboxykinase; MHCII, major histocompatibility complex II; FACS, fluorescence-activated cell sorter. at the cortico-medullary junction, the site of entry of progenitors into thymus (5Petrie H.T. Zuniga-Pflucker J.C. Annu. Rev. Immunol. 2007; 25: 649-679Crossref PubMed Scopus (349) Google Scholar). In addition, the cortical and medullary TECs provide a unique microenvironment and cell-cell contact and produce growth factors required for various aspects of T cell development (5Petrie H.T. Zuniga-Pflucker J.C. Annu. Rev. Immunol. 2007; 25: 649-679Crossref PubMed Scopus (349) Google Scholar). Thus, the success of hematopoietic stem cell-based experimental therapies for thymic restoration requires a functional thymic microenvironment. This is evident as the progenitor cells from the young animals develop into defective naive T cells when introduced in an aging thymic microenvironment (6Clise-Dwyer K. Huston G.E. Buck A.L. Duso D.K. Swain S.L. J. Immunol. 2007; 178: 1321-1331Crossref PubMed Scopus (58) Google Scholar, 7Mackall C.L. Punt J.A. Morgan P. Farr A.G. Gress R.E. Eur. J. Immunol. 1998; 28: 1886-1893Crossref PubMed Scopus (127) Google Scholar). The age-related reduction in thymopoiesis is due to multiple causes including the loss of TEC populations (8Gui J. Zhu X. Dohkan J. Cheng L. Barnes P.F. Su D.M. Int. Immunol. 2007; 19: 1201-1211Crossref PubMed Scopus (86) Google Scholar), defects in lymphoid progenitors (9Min H. Montecino-Rodriguez E. Dorshkind K. J. Immunol. 2004; 173: 245-250Crossref PubMed Scopus (153) Google Scholar, 10Zediak V.P. Maillard I. Bhandoola A. Blood. 2007; 110: 1161-1167Crossref PubMed Scopus (66) Google Scholar), and alteration in growth factors and hormones (11Taub D.D. Longo D.L. Immunol. Rev. 2005; 205: 72-93Crossref PubMed Scopus (303) Google Scholar).Ghrelin is a 28-amino-acid octanoylated peptide that is predominantly produced from the stomach in response to the negative energy balance (12Kojima M. Kangawa K. Physiol. Rev. 2005; 85: 495-522Crossref PubMed Scopus (1324) Google Scholar). Apart from being a potent inducer of GH production, ghrelin is also the only known circulating orexigen (12Kojima M. Kangawa K. Physiol. Rev. 2005; 85: 495-522Crossref PubMed Scopus (1324) Google Scholar). We and others have demonstrated that ghrelin exerts potent effects on immune cell subsets by inhibiting the proinflammatory cytokines in a growth hormone secretagogue receptor (GHSR)-dependent mechanism (13Dixit V.D. Schaffer E.M. Pyle R.S. Collins G.D. Sakthivel S.K. Palaniappan R. Lillard Jr., J.W. Taub D.D. J. Clin. Investig. 2004; 114: 57-66Crossref PubMed Scopus (740) Google Scholar, 14Gonzalez-Rey E. Chorny A. Delgado M. Gastroenterology. 2006; 130: 1707-1720Abstract Full Text Full Text PDF PubMed Scopus (230) Google Scholar). Interestingly, ghrelin and GHSR are also expressed at lower levels in various organs and cell types including thymus (13Dixit V.D. Schaffer E.M. Pyle R.S. Collins G.D. Sakthivel S.K. Palaniappan R. Lillard Jr., J.W. Taub D.D. J. Clin. Investig. 2004; 114: 57-66Crossref PubMed Scopus (740) Google Scholar, 15Gnanapavan S. Kola B. Bustin S.A. Morris D.G. McGee P. Fairclough P. Bhattacharya S. Carpenter R. Grossman A.B. Korbonits M. J. Clin. Endocrinol. Metab. 2002; 87: 2988-2991Crossref PubMed Scopus (1214) Google Scholar). The ghrelin supplementation in old mice increases thymopoiesis, whereas animals lacking ghrelin and GHSR have reduced thymic output with age (16Dixit V.D. Yang H. Sun Y. Weeraratna A.T. Youm Y.H. Smith R.G. Taub D.D. J. Clin. Investig. 2007; 117: 2778-2790Crossref PubMed Scopus (166) Google Scholar). During the course of these studies, we observed that ghrelin infusions led to reduction of adipogenic lipid-expressing cells, whereas the absence of ghrelin signaling was associated with increased thymic adipocytes (16Dixit V.D. Yang H. Sun Y. Weeraratna A.T. Youm Y.H. Smith R.G. Taub D.D. J. Clin. Investig. 2007; 117: 2778-2790Crossref PubMed Scopus (166) Google Scholar). This prompted us to investigate the mechanisms responsible for the generation of adipocytes in the thymus during aging.The adipose tissue is believed to be of mesodermal origin; however, precise lineage of white and brown adipocytes remains to be determined (17Gesta S. Tseng Y.H. Kahn C.R. Cell. 2007; 131: 242-256Abstract Full Text Full Text PDF PubMed Scopus (1064) Google Scholar), and the origin of thymic adipocytes is also unknown. One view is that adipocytes “infiltrate” the perivascular space of the thymus (18Hale L.P. Clark A.G. Li J. Greer P.K. Byers Kraus V. Dev. Comp. Immunol. 2001; 25: 509-518Crossref PubMed Scopus (11) Google Scholar). However, evidence that large lipid-filled adipocytes can migrate and squeeze through tight intercellular spaces in thymic architecture is unavailable. Indeed, it has been speculated that adipogenic progenitors may undergo specific adipogenesis within the thymus and that the prevailing view of adipocyte trafficking in the thymus may be overly simplistic (3Dixit V.D. J. Leukoc. Biol. 2008; 84: 882-892Crossref PubMed Scopus (122) Google Scholar, 11Taub D.D. Longo D.L. Immunol. Rev. 2005; 205: 72-93Crossref PubMed Scopus (303) Google Scholar). Based on the studies of fibroblast cell lines, it is known that differentiation of preadipocytes to adipocytes involves stages of growth arrest, clonal expansion, early differentiation, and terminal differentiation (19Farmer S.R. Cell Metab. 2006; 4: 263-273Abstract Full Text Full Text PDF PubMed Scopus (1351) Google Scholar). It is also known that γ1 and γ2 isoforms of nuclear peroxisome proliferator-activated receptor (PPAR) generated as a result of alternative splicing and promoter usage are induced upon adipogenesis and are required for the maintenance of the differentiated state of the adipocyte (20Rosen E.D. Spiegelman B.M. Nature. 2006; 444: 847-853Crossref PubMed Scopus (1573) Google Scholar). A preadipocyte expressing lipid and PPARγ is thus committed to an adipocyte fate; however, it is unknown whether a similar transcriptional program is initiated during ectopic adipocyte development in the thymus. In addition, cellular origin and mechanisms regulating adipogenic programming in the thymus remain to be ascertained.In this report, we investigated a role for ghrelin-ghrelin receptor expression in TSC differentiation into adipogenic cells in the aging thymus. By genetically marking the TECs and fate-mapping experiments, we provide evidence that epithelial-to-mesenchymal transition (EMT) may be one potential source of adipocytes in the aging thymus. We found that disruption of ghrelin signaling accelerated EMT and increased thymic adiposity, which was correlated with reduced naive T cells.EXPERIMENTAL PROCEDURESMice-The FoxN1-Cre mice were generated and bred to ROSA26RlacZ mice as described previously (21Gordon J. Xiao S. Hughes III, B. Su D.M. Navarre S.P. Condie B.G. Manley N.R. BMC Dev. Biol. 2007; 7: 69Crossref PubMed Scopus (87) Google Scholar). The generation of Ghrl and GHSR mice has been described previously (22Sun Y. Wang P. Zheng H. Smith R.G. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 4679-4684Crossref PubMed Scopus (585) Google Scholar). A cohort of 12-month-old female C57/B6 mice (n = 12) mice and ad libitum fed (n = 20) mice was purchased from the NIA-aging rodent colony (Harlan Sprague-Dawley, Indianapolis, IN). All mice were maintained under pathogen-free conditions and fed normal chow diet. All protocols were approved by the Institutional Animal Care and Use Committee of Baylor College of Medicine, University of Georgia, and Pennington Biomedical Research Center.Thymic Stromal Cell Culture-Thymic lobes were cleaned of fat and connective tissue, and the capsule was nicked with scissors. Then thymi were flush out as thymocytes in RPMI 1640. Thymi were then treated for 10 min at 37 °C with an enzymatic mixture containing 0.125% collagenase D (Roche Diagnostics), 0.1% DNase type I (Roche Diagnostics) in RPMI 1640. The supernatant was collected, and the digestion was repeated thrice. Thereafter, the thymic fragments were treated with 0.125% collagenase/Dispase (Roche Diagnostics), 0.1% DNase I in RPMI 1640. Cells were filtered through 100-μm mesh and spun at 13,000 rpm for 5 min. The CD45-positive cells were depleted using magnetic beads and CD45- cells were seeded in 24-well culture plates and cultured for 14 days in Dulbecco’s modified Eagle’s medium nutrient F12 (with 15 mm HEPES, NaHCO3, l-glutamine, Invitrogen) supplemented with 3 μg/ml insulin, 20 ng/ml epidermal growth factor, 100 units/ml penicillin-streptomycin, and 10% fetal bovine serum. Cultures were maintained at 37 °C and 5% CO2, and the medium was changed twice a week. On day 14, cells were induced to differentiate by changing the medium to Dulbecco’s modified Eagle’s medium/F12 containing 10% fetal bovine serum, 0.5 mm 3-isobutylmethylxanthine, 1 μm dexamethasone, and 1.7 μm insulin (MDI). After 48 h, the cells were collected to extract total RNA.Cell Preparations and FACS Analysis-The thymi were enzymatically digested as described (23Gray D.H. Seach N. Ueno T. Milton M.K. Liston A. Lew A.M. Goodnow C.C. Boyd R.L. Blood. 2006; 108: 3777-3785Crossref PubMed Scopus (337) Google Scholar). The following monoclonal antibodies were directly coupled to phycoerythrin, fluorescein isothiocyanate, allophycocynanin, or phycoerythrin-CyT and commercially purchased from eBiosciences: CD3, MHCII, Ly5.1, CD45, CD44, CD62L, CD4, and CD8. The CD45 cells were gated out, and lipid-containing cells were analyzed using LipidTox-fluorescein isothiocyanate (Invitrogen). The FACS-Calibur was used for analysis, and all data were analyzed by post-collection compensation using the FlowJO (Tree Star Inc.) software.Immunohistochemistry-The thymi obtained from mice were flash-frozen and subsequently embedded in Stephens Scientific frozen section medium (Riverdale, NJ) and cut into 5–10-μm-thick cryostat sections. At least three serial sections were utilized for each staining. Tissue sections were then fixed with 4% buffered paraformaldehyde and stained with various combinations of the following primary antibodies to mouse antigens: unconjugated rat antibody to ERTR7 (HM1086, Cell Sciences); unconjugated mouse monoclonal antibody to PPARγ (E-8, Santa Cruz); unconjugated rabbit polyclonal anti-aP2 (2120S, Cell signaling); unconjugated rat monoclonal antibody to TROMA-1 (Developmental Studies Hybridoma Bank (DSHB), University of Iowa); biotin-conjugated mouse monoclonal antibody to UEA-1 (Vector Laboratories); unconjugated rabbit antibody to FSP1 (ab27957, AbCam), CD31 (12-0311-82, eBiosciences); or unconjugated mouse antibody to β-galactosidase (Z378B, Promega). Slides were incubated with the following secondary regents: Alexa Fluor 488- or Alexa Fluor 594-conjugated polyclonal chicken anti-mouse IgG; Alexa Fluor 488-conjugated polyclonal donkey anti-rat IgG; Alexa Fluor 488- or Alexa Fluor 594-conjugated polyclonal chicken anti-rabbit IgG; of Alexa Fluor 594-conjugated streptavidin (Molecular Probes). Nuclei were visualized with 4′,6-diamidine-2′phenylindole dihydrochloride (DAPI, Sigma). Negative controls as obtained by occulting the primary antibody or by using an unrelated IgG displayed no specific labeling. Fluorescence mounting solution (Vector Laboratories) was applied to slides and observed with a Zeiss Axioplan 2 and Zeiss confocal microscope. In addition, for the visualization of lipid droplet, frozen thymic sections were fixed with 4% buffered paraformaldehyde and then stained with LipidTox-Green (Invitrogen) for 20 min. Images were captured using laser scanning confocal microscope (LSM 510, Carl Zeiss Inc).Real-time RT-PCR-Total RNA was prepared with RNAzol (Isotex Diagnostics). The samples were DNase digested to remove any potential genomic DNA contamination, and the cDNA synthesis and real-time RT-PCR were performed as described previously (13Dixit V.D. Schaffer E.M. Pyle R.S. Collins G.D. Sakthivel S.K. Palaniappan R. Lillard Jr., J.W. Taub D.D. J. Clin. Investig. 2004; 114: 57-66Crossref PubMed Scopus (740) Google Scholar, 16Dixit V.D. Yang H. Sun Y. Weeraratna A.T. Youm Y.H. Smith R.G. Taub D.D. J. Clin. Investig. 2007; 117: 2778-2790Crossref PubMed Scopus (166) Google Scholar). Real-time RT-PCR analyses were done in duplicate on the ABI PRISM 7900 sequence detector TaqMan system with the SYBR Green PCR kit as instructed by the manufacturer (Applied Biosystems). The primer pairs used for RT-PCR are shown in Tables 1 and 2.TABLE 1Sequences of conventional RT-PCR primer pairsGeneForward 5′ → 3′Reverse 5′ → 3′18SUniversal 18S internal standardGhrlGGCATTCCAGGTCATCTGTCGCCTGTCCGTGGTTACTTGTGHSRCTCCTCAGGGGACCAGATTTCTTCCTCCCGATGAGACTGT Open table in a new tab TABLE 2Sequences of real-time PCR primer pairsGeneForward 5′ → 3′Reverse (5′ → 3′)18SGTCTGTGATGCCCTTAGATGAGCTTATGACCCGCACTTACGhrlCTGAGCTCCTGACAGCTTGAACCCAGAGGACAGAGGACAAGHSRGGAAAACAGATATCTTCCCACGGGGACCAGAACCACAAACAGEVAGGCTGGCTTTCCCTGATGTATTTAACCGAACATCTGTCCCGTAireGGTTCTGTTGGACTCTGCCCTGTGTGCCACGACGGAGGTGAGIL-7GGGAGTGATTATGGGTGGTGAGTGCGGGAGGTGGGTGTAGKGFTTGACAAACGAGGCAAAGTGCCCTTTGATTGCCACAATTCFSP1CAGCACTTCCTCTCTCTTGGTTTGTGGAAGGTGGACACAAE-cadherinGAGGTCTACACCTTCCCGGTAAAAGAAGGCTGTCCTTGGCFoxc2ACAGTTGGGCAAGACGAAACAGTGCGGATTTGTAACCAGGN-cadherinAAGGACAGCCCCTTCTCAATCGTCCACCTTGAAATCTGCTPPARy2GCCTATGAGCACTTCACAAGAAATTTGCGAGTGGTCTTCCATCACaP2GCGTGGAATTCGATGAAATCACCCGCCATCTAGGGTTATGAPerilipinGACACCACCTGCATGGCTTGAAGCAGGGCCACTCTCPGARGGAAAAGTCCACTGTGCCTCAAGATGACCCAGCTCATTGGCD36CCTGCAAATGTCAGAGGAAAGCGACATGATTAATGGCACAPEPCKAACTGTTGGCTGGCTCTCGAACCTGGCGTTGAATGC Open table in a new tab Statistical Analysis-The results are expressed as the mean ± S.E. The differences between means and the effects of treatments were determined by one-way analysis of variance using Tukey’s test, which protects the significance (p < 0.05) of all pair combinations.RESULTSGhrelin and GHSR Expression in Thymic Stromal Cells- When compared with stomach and central nervous system, the Ghrl and GHSR are expressed at lower levels in T cells (13Dixit V.D. Schaffer E.M. Pyle R.S. Collins G.D. Sakthivel S.K. Palaniappan R. Lillard Jr., J.W. Taub D.D. J. Clin. Investig. 2004; 114: 57-66Crossref PubMed Scopus (740) Google Scholar). The GHSR expression has been found to be partially co-localized with keratin 5 expressing mTECs and on keratin 8 cTECs (16Dixit V.D. Yang H. Sun Y. Weeraratna A.T. Youm Y.H. Smith R.G. Taub D.D. J. Clin. Investig. 2007; 117: 2778-2790Crossref PubMed Scopus (166) Google Scholar). These findings led us to investigate specific Ghrl and GHSR expression in purified TSC from young and aging mice. Both Ghrl and GHSR mRNA were expressed in CD45+ lymphoid as well as CD45- TSC (Fig. 1A). Interestingly, when compared with 1-month-old mice, we detected a significant reduction of GHSR mRNA expression in CD45- TSC fraction of 12-month-old animals, whereas no significant (p < 0.05) change in Ghrl could be observed (Fig. 1B).Loss of Ghrelin Signals Compromises Thymic Stromal Cell Microenvironment-Aging is known to severely impact the integrity of the TEC compartment (8Gui J. Zhu X. Dohkan J. Cheng L. Barnes P.F. Su D.M. Int. Immunol. 2007; 19: 1201-1211Crossref PubMed Scopus (86) Google Scholar, 23Gray D.H. Seach N. Ueno T. Milton M.K. Liston A. Lew A.M. Goodnow C.C. Boyd R.L. Blood. 2006; 108: 3777-3785Crossref PubMed Scopus (337) Google Scholar). The growth factors required for maintenance of TECs in the aging thymic microenvironment are incompletely understood. Ghrelin regulates T cell function via a GHSR-dependent mechanism (13Dixit V.D. Schaffer E.M. Pyle R.S. Collins G.D. Sakthivel S.K. Palaniappan R. Lillard Jr., J.W. Taub D.D. J. Clin. Investig. 2004; 114: 57-66Crossref PubMed Scopus (740) Google Scholar, 16Dixit V.D. Yang H. Sun Y. Weeraratna A.T. Youm Y.H. Smith R.G. Taub D.D. J. Clin. Investig. 2007; 117: 2778-2790Crossref PubMed Scopus (166) Google Scholar), and available evidence indicates that GHSR is also required for the anabolic effects of ghrelin (22Sun Y. Wang P. Zheng H. Smith R.G. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 4679-4684Crossref PubMed Scopus (585) Google Scholar). To assess the impact of deficient ghrelin-mediated signals, we investigated the 10–15-month-old GHSR-/- mice. When compared with 10-month-old age-matched wild type mice, the GHSR-/- animals displayed loss of keratin 8+ cTEC and UEA1+ mTEC cells in the thymus (Fig. 2A). We then investigated a separate cohort of mice (12 months old from Baylor College of Medicine animal facility) and demonstrate that similar to our IHC results, this cohort of GHSR-/- mice also had a reduced number of CD45-MHCII+Ly51- mTEC and CD45-MHCII+Ly51+ cTEC cells (Fig. 2B). We next studied the expression of stromal genes that play a key role in thymic function. The early V antigen (EVA) is a constitutively cTEC expressed gene (24Rossi S. Blazar B.R. Farrell C.L. Danilenko D.M. Lacey D.L. Weinberg K.I. Krenger W. Holländer G.A. Blood. 2002; 100: 682-691Crossref PubMed Scopus (168) Google Scholar), and autoimmune regulator (Aire), expressed in a subset of mTEC cells (25Anderson M.S. Venanzi E.S. Klein L. Chen Z. Berzins S.P. Turley S.J. von Boehmer H. Bronson R. Dierich A. Benoist C. Mathis D. Science. 2002; 298: 1395-1401Crossref PubMed Scopus (1842) Google Scholar), is critical for thymic function. We observed that 12-month-old Ghrl-/- and GHSR-/- mice had significant reduction in EVA, Aire, and IL-7 mRNA expression with no change in fibroblast growth factor-7 (FGF7) levels (Fig. 2C). These findings are consistent with our hypothesis that ghrelin signaling may be required for TEC maintenance.FIGURE 2Loss of ghrelin signals compromises thymic stromal microenvironment during aging. A, the thymic cryosections were labeled for keratin 8+ cortical TEC using anti-TROMA1 antibody, and medullary TECs were identified by biotin-conjugated plant lectin Ulex europaeus agglutinin 1 (UEA-1). Nuclei were counterstained with DAPI. C, cTEC; M, mTEC. B, the CD45- thymic stromal cells were stained for Ly51 and MHCII to distinguish cTEC and mTEC cells. A deletion of GHSR reduces both cTEC and mTEC population in 12-month-old mice. C, the real-time-PCR analysis of EVA, Aire, IL-7, and keratinocyte growth factor (KGF) in thymi of 12-month-old GHSR and Ghrl null mice and control littermates. D, the thymic cryosections were labeled for the fibroblast-specific marker ERTR7 (red) and LipidTox (green). Nuclei were counterstained with DAPI. The arrows indicate the lipid-expressing fibroblasts in the PVS of thymus. A representative image from a minimum of four thymi in each group is shown. E, the CD45- TSC were pooled from six thymi of control and GHSR null mice in 10-month-old and 15-month-old age groups and stained with LipidTox-fluorescein isothiocyanate, and FACS analysis was performed in two separate cohorts of mice.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Given our previous findings that 24-month-old GHSR-/- mice have increased adipocytes in thymic space (16Dixit V.D. Yang H. Sun Y. Weeraratna A.T. Youm Y.H. Smith R.G. Taub D.D. J. Clin. Investig. 2007; 117: 2778-2790Crossref PubMed Scopus (166) Google Scholar), we next investigated whether thymic fibroblasts serve as adipogenic precursors during aging. Using ERTR7 as a marker of fibroblasts, we detected increased labeling for ERTR7 in 12-month-old GHSR-/- mice (Fig. 2D), whereas the isotype control antibody showed no specific staining (data not shown). Recent studies by Boyd and colleagues (26Gray D.H. Tull D. Ueno T. Seach N. Classon B.J. Chidgey A. McConville M.J. Boyd R.L. J. Immunol. 2007; 178: 4956-4965Crossref PubMed Scopus (53) Google Scholar) have also demonstrated that aging is associated with increase in thymic fibroblasts. Interestingly, we observed an increase in lipid-expressing perivascular fibroblasts in GHSR-/- mice, suggesting their adipogenic nature. We next quantitated the lipid-expressing cells in the thymus during aging using FACS analysis and demonstrated that in 10- and 15-month-old mice, the absence of ghrelin-mediated signals leads to significant increase in CD45-LipidTox+ adipogenic cells in the thymus (Fig. 2E). Thus, our data suggest that GHSR may serve to limit the adipogenesis within TSCs and that loss of GHSR-mediated signals may contribute to increased thymic adipogenic cells.Deficient Ghrelin Receptor Signaling Regulates EMT in Aging Thymus-Considering that GHSR null animals exhibited reduction in TECs, an increase in thymic fibroblasts led us to hypothesize that this might be related to the process of EMT. The EMT is a process whereby epithelial cells assume a mesenchymal phenotype via cellular transition (27Hay E.D. Dev. Dyn. 2005; 233: 706-720Crossref PubMed Scopus (510) Google Scholar). The EMT is a defining structural mechanism of organ development during embryogenesis (27Hay E.D. Dev. Dyn. 2005; 233: 706-720Crossref PubMed Scopus (510) Google Scholar). However, in adult life, the EMT can also be a source of local tissue fibroblasts, which are known to cause several fibrotic diseases (28Iwano M. Plieth D. Danoff T.M. Xue C. Okada H. Neilson E.G. J. Clin. Investig. 2002; 110: 341-350Crossref PubMed Scopus (1697) Google Scholar). An important question arising from the findings of age-related loss of thymic epithelial cells and increase in fibroblast is whether EMT is an underlying mechanism in the aging thymus. Also, mesenchymal cells are highly plastic and multipotent in nature and can give rise to adipocytes in vitro (29Mani S.A. Guo W. Liao M.J. Eaton E.N. Ayyanan A. Zhou A.Y. Brooks M. Reinhard F. Zhang C.C. Shipitsin M. Campbell L.L. Polyak K. Brisken C. Yang J. Weinberg R.A. Cell. 2008; 133: 704-715Abstract Full Text Full Text PDF PubMed Scopus (6663) Google Scholar). However, the determination of cell lineage by gene expression analysis or in vitro studies is insufficient because transcriptional signatures are transient and subject to epigenetic or regulatory influences. Hence, the true origin of a cell can only be determined by genetic lineage tracing. To this end, we developed the FoxN1Cre;R26RstopLacZ double transgenic mouse to test the hypothesis that EMT contributes toward generation of a subset of local thymic fibroblasts.The FoxN1 gene is expressed by the TECs, and in FoxN1Cre mice, the IRES-Cre cassette has been knocked-in into the 3′-untranslated region of FoxN1 genomic locus; thus, Cre expression causes a permanent genetic change in all cells that express FoxN1 (21Gordon J. Xiao S. Hughes III, B. Su D.M. Navarre S.P. Condie B.G. Manley N.R. BMC Dev. Biol. 2007; 7: 69Crossref PubMed Scopus (87) Google Scholar). In the R26RstopLacZ indicator mice, the lacZ gene is expressed upon Cre-mediated excision of a loxP STOP cassette. Therefore, in the FoxN1Cre;R26RstopLacZ double transgenic mice, the lacZ expression persists in cells that have ever expressed FoxN1, despite any subsequent age-related phenotypic alterations or cellular transitions (Fig. 3A).FIGURE 3Ghrelin regulates epithelial-to mesenchymal transition in the thymus. A, the FoxN1-Cre-expressing mice were bred with indicator mice that contain the LacZ gene integrated into the ubiquitous ROSA26 locus downstream of a floxed transcriptional STOP sequence. Expression of Cre recombinase in TECs excised the floxed STOP sequence and indelibly marked the cells with LacZ. B, immunofluorescence triple labeling in 3-month-old FoxN1Cre; ROSA26RstoplacZ reporter mice thymus with DAPI (blue), antibodies to β-galactosidase (indelibly marked TEC), and FSP-1 (EMT marker). The EMT is evident by medullary expression and co-localization of FSP1 with β-galactosidase. Thymic cryosections of 3-month-old FoxN1Cre;ROSA26RstoplacZ mice were triple labeled with antibodies to FSP1 (blue), β-galactosidase (red), and neutral lipid by LipidTox (green) or PPARγ (green). A representative image (n = 4) shows lipid expression within a β-galactosidase and FSP1 co-expressing cells in the thymic PVS.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Studies from Eric Nielson and colleagues (30Strutz F. Okada H. Lo C.W. Danoff T. Carone R.L. Tomaszewski J.E. Neilson E.G. J. Cell Biol. 1995; 130: 393-405Crossref PubMed Scopus (877) Google Scholar) have identified fibroblast-specific protein-1 (F" @default.
• W2039006670 created "2016-06-24" @default.
• W2039006670 creator A5001845810 @default.
• W2039006670 creator A5003194153 @default.
• W2039006670 creator A5003846107 @default.
• W2039006670 creator A5020165472 @default.
• W2039006670 creator A5020412136 @default.
• W2039006670 creator A5048737792 @default.
• W2039006670 creator A5091876557 @default.
• W2039006670 date "2009-03-01" @default.
• W2039006670 modified "2023-09-29" @default.
• W2039006670 title "Deficient Ghrelin Receptor-mediated Signaling Compromises Thymic Stromal Cell Microenvironment by Accelerating Thymic Adiposity" @default.
• W2039006670 cites W1497362213 @default.
• W2039006670 cites W1816944676 @default.
• W2039006670 cites W1977066411 @default.
• W2039006670 cites W1980927128 @default.
• W2039006670 cites W1984876328 @default.
• W2039006670 cites W1986768602 @default.
• W2039006670 cites W1993153481 @default.
• W2039006670 cites W2007246387 @default.
• W2039006670 cites W2014691022 @default.
• W2039006670 cites W2022070851 @default.
• W2039006670 cites W2025439366 @default.
• W2039006670 cites W2025605686 @default.
• W2039006670 cites W2026158123 @default.
• W2039006670 cites W2035600501 @default.
• W2039006670 cites W2042108397 @default.
• W2039006670 cites W2051174713 @default.
• W2039006670 cites W2052609811 @default.
• W2039006670 cites W2065466577 @default.
• W2039006670 cites W2088986234 @default.
• W2039006670 cites W2104962128 @default.
• W2039006670 cites W2116700965 @default.
• W2039006670 cites W2123371309 @default.
• W2039006670 cites W2132561227 @default.
• W2039006670 cites W2134705919 @default.
• W2039006670 cites W2136295793 @default.
• W2039006670 cites W2139789471 @default.
• W2039006670 cites W2143209754 @default.
• W2039006670 cites W2144489715 @default.
• W2039006670 cites W2154124733 @default.
• W2039006670 cites W2165214298 @default.
• W2039006670 cites W2293072912 @default.
• W2039006670 cites W4235460794 @default.
• W2039006670 cites W4236836803 @default.
• W2039006670 cites W4244774747 @default.
• W2039006670 doi "https://doi.org/10.1074/jbc.m808302200" @default.
• W2039006670 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/2652314" @default.
• W2039006670 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/19054770" @default.
• W2039006670 hasPublicationYear "2009" @default.
• W2039006670 type Work @default.
• W2039006670 sameAs 2039006670 @default.
• W2039006670 citedByCount "83" @default.
• W2039006670 countsByYear W20390066702012 @default.
• W2039006670 countsByYear W20390066702013 @default.
• W2039006670 countsByYear W20390066702014 @default.
• W2039006670 countsByYear W20390066702015 @default.
• W2039006670 countsByYear W20390066702016 @default.
• W2039006670 countsByYear W20390066702017 @default.
• W2039006670 countsByYear W20390066702018 @default.
• W2039006670 countsByYear W20390066702019 @default.
• W2039006670 countsByYear W20390066702020 @default.
• W2039006670 countsByYear W20390066702021 @default.
• W2039006670 countsByYear W20390066702022 @default.
• W2039006670 countsByYear W20390066702023 @default.
• W2039006670 crossrefType "journal-article" @default.
• W2039006670 hasAuthorship W2039006670A5001845810 @default.
• W2039006670 hasAuthorship W2039006670A5003194153 @default.
• W2039006670 hasAuthorship W2039006670A5003846107 @default.
• W2039006670 hasAuthorship W2039006670A5020165472 @default.
• W2039006670 hasAuthorship W2039006670A5020412136 @default.
• W2039006670 hasAuthorship W2039006670A5048737792 @default.
• W2039006670 hasAuthorship W2039006670A5091876557 @default.
• W2039006670 hasBestOaLocation W20390066701 @default.
• W2039006670 hasConcept C126322002 @default.
• W2039006670 hasConcept C134018914 @default.
• W2039006670 hasConcept C150555746 @default.
• W2039006670 hasConcept C16930146 @default.
• W2039006670 hasConcept C170493617 @default.
• W2039006670 hasConcept C185592680 @default.
• W2039006670 hasConcept C2779357093 @default.
• W2039006670 hasConcept C62478195 @default.
• W2039006670 hasConcept C71924100 @default.
• W2039006670 hasConcept C86803240 @default.
• W2039006670 hasConcept C95444343 @default.
• W2039006670 hasConceptScore W2039006670C126322002 @default.
• W2039006670 hasConceptScore W2039006670C134018914 @default.
• W2039006670 hasConceptScore W2039006670C150555746 @default.
• W2039006670 hasConceptScore W2039006670C16930146 @default.
• W2039006670 hasConceptScore W2039006670C170493617 @default.
• W2039006670 hasConceptScore W2039006670C185592680 @default.
• W2039006670 hasConceptScore W2039006670C2779357093 @default.
• W2039006670 hasConceptScore W2039006670C62478195 @default.
• W2039006670 hasConceptScore W2039006670C71924100 @default.
• W2039006670 hasConceptScore W2039006670C86803240 @default.
• W2039006670 hasConceptScore W2039006670C95444343 @default.
• W2039006670 hasIssue "11" @default.
• W2039006670 hasLocation W20390066701 @default.

• next