Matches in SemOpenAlex for { <https://semopenalex.org/work/W2039366241> ?p ?o ?g. }
- W2039366241 endingPage "592" @default.
- W2039366241 startingPage "586" @default.
- W2039366241 abstract "Oxidative stress could be involved in the pathophysiology of schizophrenia, a major psychiatric disorder. Glutathione (GSH), a redox regulator, is decreased in patients’ cerebrospinal fluid and prefrontal cortex. The gene of the key GSH-synthesizing enzyme, glutamate cysteine ligase modifier (GCLM) subunit, is strongly associated with schizophrenia in two case-control studies and in one family study. GCLM gene expression is decreased in patients’ fibroblasts. Thus, GSH metabolism dysfunction is proposed as one of the vulnerability factors for schizophrenia. Oxidative stress could be involved in the pathophysiology of schizophrenia, a major psychiatric disorder. Glutathione (GSH), a redox regulator, is decreased in patients’ cerebrospinal fluid and prefrontal cortex. The gene of the key GSH-synthesizing enzyme, glutamate cysteine ligase modifier (GCLM) subunit, is strongly associated with schizophrenia in two case-control studies and in one family study. GCLM gene expression is decreased in patients’ fibroblasts. Thus, GSH metabolism dysfunction is proposed as one of the vulnerability factors for schizophrenia. Schizophrenia (MIM 181500) is a major and frequent chronic psychiatric disorder with a strong genetic component.1Tsuang MT Schizophrenia: genes and environment.Biol Psychiatry. 2000; 47: 210-220Abstract Full Text Full Text PDF PubMed Scopus (412) Google Scholar, 2Harrison PJ Owen MJ Genes for schizophrenia?. Recent findings and their pathophysiological implications.Lancet. 2003; 361: 417-419Abstract Full Text Full Text PDF PubMed Scopus (508) Google Scholar Converging evidence points to the involvement of oxidative stress3Mahadik SP Mukherjee S Free radical pathology and antioxidant defense in schizophrenia: a review.Schizophr Res. 1996; 19: 1-17Abstract Full Text PDF PubMed Scopus (309) Google Scholar, 4Herken H Uz E Ozyurt H Sogut S Virit O Akyol O Evidence that the activities of erythrocyte free radical scavenging enzymes and the products of lipid peroxidation are increased in different forms of schizophrenia.Mol Psychiatry. 2001; 6: 66-73Crossref PubMed Scopus (209) Google Scholar, 5Marchbanks RM Ryan M Day I Owen M McGuffin P Whatley S A mitochondrial DNA sequence variant associated with schizophrenia and oxidative stress.Schizophr Res. 2003; 65: 33-38Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar, 6Prabakaran S Swatton J Ryan M Huffaker SJ Huang JJ Griffin JL Wayland M Freeman T Dudbridge F Lilley KS Karp NA Hester S Tkachev D Mimmack ML Yolken RH Webster MJ Torrey EF Bahn S Mitochondrial dysfunction in schizophrenia: evidence for compromised brain metabolism and oxidative stress.Mol Psychiatry. 2004; 9: 684-697Crossref PubMed Scopus (348) Google Scholar, 7Altar CA Jurata LW Charles V Lemire A Liu P Bukhman Y Young TA Bullard J Yokoe H Webster MJ Knable MB Brockman JA Deficient hippocampal neuron expression of proteasome, ubiquitin, and mitochondrial genes in multiple schizophrenia cohorts.Biol Psychiatry. 2005; 58: 85-96Abstract Full Text Full Text PDF PubMed Scopus (212) Google Scholar and N-methyl d-aspartate (NMDA)–receptor hypofunction8Olney JW Newcomer JW Farber NB NMDA receptor hypofunction model of schizophrenia.J Psychiatr Res. 1999; 33: 523-533Abstract Full Text Full Text PDF PubMed Scopus (760) Google Scholar, 9Coyle JT Tsai G NMDA receptor function, neuroplasticity, and the pathophysiology of schizophrenia.Int Rev Neurobiol. 2004; 59: 491-515Crossref PubMed Scopus (105) Google Scholar in the pathophysiology of the disease. As a main cellular nonprotein antioxidant and redox regulator,10Meister A Anderson ME Glutathione.Annu Rev Biochem. 1983; 52: 711-760Crossref PubMed Scopus (5747) Google Scholar glutathione (GSH) plays a major role in protecting nervous tissue against reactive oxygen species11Rabinovic AD Hastings TG Role of endogenous glutathione in the oxidation of dopamine.J Neurochem. 1998; 71: 2071-2078Crossref PubMed Scopus (70) Google Scholar and in modulating redox-sensitive sites, including NMDA receptors (NMDA-R).12Kohr G Eckardt S Luddens H Monyer H Seeburg PH NMDA receptor channels: subunit-specific potentiation by reducing agents.Neuron. 1994; 12: 1031-1040Abstract Full Text PDF PubMed Scopus (208) Google Scholar, 13Choi YB Lipton SA Redox modulation of the NMDA receptor.Cell Mol Life Sci. 2000; 57: 1535-1541Crossref PubMed Scopus (139) Google Scholar It was shown elsewhere that the GSH levels were decreased in patients’ cerebrospinal fluid (−27%), in medial prefrontal cortex in vivo (−52%),14Do KQ Lauer CJ Schreiber W Zollinger M Gutteck-Amsler U Cuenod M Holsboer F Gamma-glutamylglutamine and taurine concentrations are decreased in the cerebrospinal fluid of drug-naive patients with schizophrenic disorders.J Neurochem. 1995; 65: 2652-2662Crossref PubMed Scopus (74) Google Scholar, 15Do KQ Trebesinger A Kirsten-Kruger M Lauer C Dydak U Hell D Holsboer F Boesinger P Cuenod M Schizophrenia: glutathione deficit in cerebro spinal fluid and prefrontal cortex in vivo.Eur J Neurosci. 2000; 12: 3721-3728Crossref PubMed Scopus (404) Google Scholar and in striatum postmortem tissue.16Yao JK Leonard S Reddy R Altered glutathione redox state in schizophrenia.Dis Markers. 2006; 22: 83-93Crossref PubMed Scopus (235) Google Scholar GSH-deficient models reveal morphological, electrophysiological, and behavioral anomalies similar to those observed in patients.17Grima G Benz B Parpura V Cuenod M Do KQ Dopamine-induced oxidative stress in neurons with glutathione deficit: implication for schizophrenia.Schizophr Res. 2003; 62: 213-224Abstract Full Text Full Text PDF PubMed Scopus (105) Google Scholar, 18Castagne V Rougemont M Cuenod M Do KQ Low brain glutathione and ascorbic acid associated with dopamine uptake inhibition during rat’s development induce long-term cognitive deficit: relevance to schizophrenia.Neurobiol Dis. 2004; 15: 93-105Crossref PubMed Scopus (61) Google Scholar, 19Castagne VV Cuenod M Do KQ An animal model with relevance to schizophrenia: sex-dependent cognitive deficits in osteogenic disorder-Shionogi rats induced by glutathione synthesis and dopamine uptake inhibition during development.Neuroscience. 2004; 123: 821-834Crossref PubMed Scopus (40) Google Scholar, 20Steullet P Neijt H Cuenod M Do KQ Synaptic plasticity impairment and hypofunction of NMDA receptors induced by glutathione deficit: relevance to schizophrenia.Neuroscience. 2005; 137: 807-819Crossref PubMed Scopus (138) Google Scholar, 21Cabungcal J Nicolas D Kraftsik R Cuenod M Do KQ Hornung JP Glutathione deficit during development induces anomalies in the rat anterior cingulate GABAergic neurons: relevance to schizophrenia.Neurobiol Dis. 2006; 22: 624-637Crossref PubMed Scopus (68) Google Scholar Here, we present strong evidence for an association between schizophrenia and the gene of the key GSH-synthesizing enzyme, glutamate cysteine ligase modifier (GCLM) subunit. The functional role of the GCLM gene variance in schizophrenia is supported by its low expression in patients’ fibroblasts and by the decreased stimulation of the enzyme activity when challenged by an oxidative stress.22Gysin R, Tosic M, Chappuis C, Deppen P, Ruiz V, Bovet P, Cuenod M, Do KQ (2005) Dysregulation of glutamate cysteine ligase in schizophrenia. Paper presented at the 36th Annual Meeting of the Society for Neuroscience, Washington, DC, November 12–16Google Scholar These findings are consistent with the concept that an abnormal GSH metabolism is a risk factor for schizophrenia. To identify candidate gene(s) responsible for the low level of GSH observed in patients with schizophrenia, we studied steady-state levels of mRNA for 14 genes (data not shown) involved in GSH metabolism (fig. 1). Since GSH is ubiquitously present in cells, gene expression was studied in cultured skin fibroblasts. Two enzymes are responsible for GSH synthesis: glutamate cysteine ligase (GCL), also known as γ-glutamyl cysteine synthetase (Enzyme Commission number 6.3.2.2), and glutathione synthetase (GSS [Enzyme Commission number 6.3.2.3]).10Meister A Anderson ME Glutathione.Annu Rev Biochem. 1983; 52: 711-760Crossref PubMed Scopus (5747) Google Scholar GCL, the first and rate-limiting enzyme,10Meister A Anderson ME Glutathione.Annu Rev Biochem. 1983; 52: 711-760Crossref PubMed Scopus (5747) Google Scholar is composed of two subunits—GCL modifier (GCLM [light: 27.7 kDa])23Huang CS Anderson ME Meister A Amino acid sequence and function of the light subunit of rat kidney gamma-glutamylcysteine synthetase.J Biol Chem. 1993; 268: 20578-20583Abstract Full Text PDF PubMed Google Scholar and GCL catalytic subunit (GCLC [heavy: 73 kDa])24Huang CS Chang LS Anderson ME Meister A Catalytic and regulatory properties of the heavy subunit of rat kidney gamma-glutamylcysteine synthetase.J Biol Chem. 1993; 268: 19675-19680Abstract Full Text PDF PubMed Google Scholar—each encoded by separate genes.25Tsuchiya K Mulcahy RT Reid LL Disteche CM Kavanagh TJ Mapping of the glutamate-cysteine ligase catalytic subunit gene (GLCLC) to human chromosome 6p12 and mouse chromosome 9D-E and of the regulatory subunit gene (GLCLR) to human chromosome 1p21-p22 and mouse chromosome 3H1-3.Genomics. 1995; 30: 630-632Crossref PubMed Scopus (49) Google Scholar The specific mRNA steady-state levels were measured in fibroblasts obtained from 32 patients and 53 controls from a Swiss population (table 1). The subjects were recruited with fully informed written consent and guidelines for ethical treatment given by the University of Lausanne. All subjects were assessed using the Diagnostic Interview for Genetic Studies (DIGS) developed by the National Institute of Mental Health (NIMH).27Nurnberger Jr, JI Blehar MC Kaufmann CA York-Cooler C Simpson SG Harkavy-Friedman J Severe JB Malaspina D Reich T Diagnostic interview for genetic studies: rationale, unique features, and training: NIMH Genetics Initiative.Arch Gen Psychiatry. 1994; 51: 849-859Crossref PubMed Scopus (1722) Google Scholar Additional measures of psychopathology of patients included the Positive and Negative Syndrome Scale (PANSS), which assessed the presence of symptoms within the same week as the blood collection and skin biopsy. Specific mRNA steady-state levels were measured in cultured skin fibroblasts grown for three passages, with the use of TaqMan chemistry and ABI Prism 7000 sequence detection system. cDNA corresponding to 10 ng of reverse-transcribed total RNA was amplified using TaqMan gene expression assays (Hs00155249 m1, Hs00157694 m1, and Hs00609286 m1) at the following amplification condition: 1 cycle for 2 min at 50°C, 1 cycle for 10 min at 95°C, and 50 cycles for 15 s at 95°C, followed by 1 min at 60°C. Human glyceraldehyde-3-phosphate dehydrogenase (Applied Biosystem 4333764F) was used as endogenous control.Table 1Demographic Characteristics of the Samples Used in Gene Expression and Association StudiesStudy and PopulationNAgeaExpressed as the mean and range. (years)SexbRatio of males to females.Diagnostic ToolExpression study: Switzerland: Patient3235.5±10.53.0DSM-IV26American Psychiatric Association Diagnostic and statistical manual of mental disorders. 4th ed. American Psychiatric Association, Washington, DC1994Google Scholar/DIGS27Nurnberger Jr, JI Blehar MC Kaufmann CA York-Cooler C Simpson SG Harkavy-Friedman J Severe JB Malaspina D Reich T Diagnostic interview for genetic studies: rationale, unique features, and training: NIMH Genetics Initiative.Arch Gen Psychiatry. 1994; 51: 849-859Crossref PubMed Scopus (1722) Google Scholar Control5337.2±13.4.9DIGSAssociation study: Switzerland: Patient4035.9±11.53.5DSM-IV/DIGS Control3137.7±13.311.6DIGS Denmark: Patient34938.8±12.11.5ICD-10cInternational Classification of Diseases, 10th Revision. Control34840.2±10.51.5…a Expressed as the mean and range.b Ratio of males to females.c International Classification of Diseases, 10th Revision. Open table in a new tab Case-control comparisons showed significant differences in GCLM (t=1.989; P=.037) and GSS (t=1.997; P=.030) mRNA levels between patients and control subjects, without effect from sex or age. For the GCLC mRNA, a trend toward a decrease could be observed (t=2.000; P=.064) in patients. We tested, therefore, whether the reduced GCLM and GSS mRNA levels observed in patients with schizophrenia could be due to a primary defect. We studied eight SNPs in the GCLM gene and nine SNPs in the GSS gene for possible association with schizophrenia (fig. 2). Sixteen SNPs were chosen from a group of 60 SNPs selected from publicly available databases (SNP Consortium and dbSNP) on the basis of the estimated level of polymorphism in our population. One SNP (ss60197536) at the GCLM 5′ end, described by Nakamura et al.,28Nakamura S Kugiyama K Sugiyama S Miyamoto S Koide S Fukushima H Honda O Yoshimura M Ogawa H Polymorphism in the 5′-flanking region of human glutamate-cysteine ligase modifier subunit gene is associated with myocardial infarction.Circulation. 2002; 105: 2968-2973Crossref PubMed Scopus (138) Google Scholar is being submitted to dbSNP. The dbSNP-annotated SNP numbers and their positions in each gene are shown in figure 2. Genotyping was performed with DNA extracted from peripheral blood by the use of either Sequenom technology29Rodi CP Darnhofer-Patel B Stanssens P Zabeau M van den Boom D A strategy for the rapid discovery of disease markers using the MassARRAY system.Biotechniques. 2002; 32: S62-S69PubMed Google Scholar or sequencing. The list of specific primers is shown in table 2.Table 2Primers Used in Genotyping StudiesPCR Amplification Primer (5′→3′SNP12Extension Primerrs2235971ACGTTGGATGCAGATCTGGTAACCACCATCACGTTGGATGAGTTCTCTGACGCATTTCCGCACCATCTTTCCGGCTCrs3170633ACGTTGGATGCTTTCTAGATTTTTCACCCAGACGTTGGATGAGGATGAACTGCTAGCCAACCAGTATTTTCAAAATTTGGGAATrs2064764ACGTTGGATGCCCTCTTCTAGCTTCACTTGACGTTGGATGAAACACTAGGAACCTTAATCCTTTTACTAGTAGGAAAGGAArs769211ACGTTGGATGGATCATAAGCTTTTGTCTTACACGTTGGATGCTGTATTTTTATCACTGTCCCTTTTGTCTTACAAAAAGGTATTTrs718873ACGTTGGATGTAACCTCTAGTTGGTTCTGCACGTTGGATGGGAGTTGAGTGTCATTCCAGTTGGTTCTGCTCCTTCCrs718875ACGTTGGATGCTTACCTTCCTGAATTGAGGACGTTGGATGAATTTCCCTCTGGAAGGATGAATTCATCAGGAAAGCCTCArs2301022ACGTTGGATGTGATGCTCAGAGTCACACACACGTTGGATGCCTACTGTTATGAAGCACCCAAACATTGTTCAAAGGACTAss60197536ACGTTGGATGTGAGGTAGACACCGCCTCCACGTTGGATGAAAGAGACGTGTAGGAAGCCGCCTGGTGAGGTCTCCCrs3746450ACGTTGGATGCAGGACTTCTCTTTCTCCAGACGTTGGATGTTATCCTGGGTGACTACCTCGTCCCCCTCCCTCTAGArs725521ACGTTGGATGTAGACCAGTCTCTACAGGTGACGTTGGATGTCTCATTCCTCCCTGTGATCATCCTTAGCCACCCACTrs1801310ACGTTGGATGACGGTTGCAAAGGACTTCTCACGTTGGATGTTAAATGAGGCCAAGGACCCTCATCTGATACCCTGGTrs2236270ACGTTGGATGCCAGTGAGAGCTGATTGTTGACGTTGGATGGAATCCTCAGGAATCCACAGTCTGGAAACAGTGTAAATGrs2236271ACGTTGGATGTTGCGTTTTCACCTTCACCCACGTTGGATGTTTCCACTGCTTAAAGCAGCCCCTGCCATTAAAAATTTTTTCArs2273684ACGTTGGATGTCTGAGAATCAGCTGAGCACACGTTGGATGCAGCCCAGCATATTCCAACCCTCCCATCACATTCCTGrs734111ACGTTGGATGCTCTGCAATCTTCCAGTTCCACGTTGGATGCAAACTCTTTCCAGGTAGGGGCAGCTCCTGGCCCCCCrs2025096ACGTTGGATGCGAGGTGATGACTGGTATAGACGTTGGATGTCTTTCTCCAATGAAGAGCCTTGAACCCATGTCTCTGrs3761144ACGTTGGATGCTTTTGCCTCTAATGCTTTCCACGTTGGATGAAGTCCCAGAAAAATCCCCCTAATGCTTTCCCTGCTG Open table in a new tab A pilot association study was performed with a relatively small sample (40 patients and 31 controls from a Swiss population) (fig. 2). Most, although not all, of the subjects from the Swiss population were used in both gene expression and association studies. The details about subject groups are given in the tables: demographic data in table 1, genotype and allele frequencies for each SNP in table 3, and the allelic frequencies compared with those known for other populations in table 4. All SNPs were in Hardy-Weinberg equilibrium (HWE) in both subject groups (data not shown). No association was observed with the GSS gene. Two GCLM markers, rs2301022 in intron 1 and rs3170633 at the 3′ end, had P values that were low, but not significant after correction for multiple testing. However, these data suggested that a functional region in GCLM may be associated with schizophrenia. Consequently, we proceeded with a second case-control study of a larger sample from an independent population.Table 3Genotype and Allele Frequencies for Each SNP Studied in Two PopulationsFrequencySwissDanishGenotypeAlleleGenotypeAlleleGene and SNP1/11/22/2121/11/22/212GCLM: ss60197536 (C/T).73.23.04.84.16.71.27.03.84.16 rs2301022 (A/G).13.40.47.33.67.13.42.45.34.66 rs718875 (C/T).00.16.84.08.92.01.24.76.13.87 rs718873 (C/T).00.33.67.16.84.03.24.73.15.85 rs769211 (G/T).58.39.03.77.23.53.39.08.73.27 rs2064764 (A/G).15.43.43.36.64.11.45.44.34.66 rs3170633 (A/G).16.43.41.37.63.26.42.32.47.53 rs2235971 (A/G).11.43.45.33.67.11.43.45.33.67GSS: rs3761144 (C/G).40.46.14.63.37.37.50.13.62.38 rs2025096 (A/G).09.38.53.28.72.03.30.67.18.82 rs734111 (A/C).13.46.41.36.64.12.50.38.37.63 rs2273684 (G /T).27.47.26.51.49.18.58.24.47.53 rs2236270 (G /T).20.48.33.44.56.12.50.38.37.63 rs1801310 (A/G).34.44.22.56.44.37.51.12.63.37 rs2236271 (A/C).14.44.42.36.64.11.49.39.36.64 rs725521 (C/T).41.45.14.64.36.40.49.12.64.36 rs3746450 (A/C).28.50.22.53.47.39.49.12.63.37Note.—The alternative alleles given in parentheses for each SNP correspond to 1 and 2, respectively, in the table. Open table in a new tab Table 4Frequencies of the Rare Allele in Swiss and Danish Populations Compared with Reported Frequencies in Other White PopulationsFrequencyGene and SNPSwissDanishOther White PopulationsaMean and range shown when data for more than one population were available in dbSNP. ND = No data available.GCLM: ss60197536 (C/T).16.16ND rs2301022 (A/G).33.34.37 (.31–.44) rs718875 (C/T).08.13.09 rs718873 (C/T).16.15.23 rs769211 (G/T).23.27.17 rs2064764 (A/G).36.34ND rs3170633 (A/G).37.47.18 (.11–.25) rs2235971 (A/G).33.33.35GSS: rs3761144 (C/G).37.38.37 (.35–.39) rs2025096 (A/G).28.18ND rs734111 (A/C).36.37.34 (.21–.49) rs2273684 (G/T).49.47.48 (.46–.51) rs2236270 (G/T).44.37.39 (.3–.44) rs1801310 (A/G).44.37.28 (.14–.42) rs2236271 (A/C).36.36.35 (.17–.58) rs725521 (C/T).36.36.33 (.21–.46) rs3746450 (A/C).47.37.42a Mean and range shown when data for more than one population were available in dbSNP. ND = No data available. Open table in a new tab Note.— The alternative alleles given in parentheses for each SNP correspond to 1 and 2, respectively, in the table. The second study included 349 patients with schizophrenia from the Danish Psychiatric Biobank and 348 unrelated anonymous blood donors serving as unaffected control subjects (table 1). Both control and affected groups were tested for HWE. Whereas the control group was in equilibrium for all markers, the SNP rs2301022 showed a deviation from HWE (P=.026) in patients. This SNP also showed an association in our Swiss population. Genotype frequency analysis confirmed a strong association of SNP rs2301022 (χ2=13.2, 2 df; P=.023) after correction for multiple testing (fig. 2). Thus, the deviation from HWE in patients but not in controls must be viewed as additional evidence of association. Here again, no association with GSS SNPs was found; thus, we excluded this gene from further studies. Our results showed that rs2301022 is strongly associated with schizophrenia. This marker is localized between markers rs718875 and ss60197536, which showed weaker association with this disease in one of two populations that we studied (fig. 2). This fact suggests that there is a functional variant associated with the disease in the proximity of these three markers. SNP ss60197536 is 343 bp upstream of the transcription initiation site, and rs718875 is localized, like rs2301022, in intron 1. We analyzed different genotype pattern classes for these three markers (ss60197536, rs2301022, and rs718875) in a region of ∼3,000 bp that includes GCLM exon 1. We identified 14 different genotype patterns (table 5), among which 2 were specifically present in affected individuals. Nine patterns of these three SNPs showed different frequencies between patients and unaffected controls, with χ2=30.39 and P=.004. Two particular combinations, TT/GG/TC and CC/GG/TT, had odds ratios (ORs) of 4.89 and 4.17, respectively.Table 5Diplotype Analysis of the SNP Patterns Associated with SchizophreniaGenotype PatternFrequencyrs718875rs2301022ss60197536PatientsControlsORCCGGTT.035.0094.17TCGGTT.006.014.4TTGGCC.263.282.91TTGGTC.041.0094.89TTAGTC.05.0351.46TTAGCC.339.31.2TCGGTC.137.138.99TTAACC.044.121.33TCAGTC.067.078.85Five rare patterns.018.0141.22Note.—χ2=30.40, 9 df; P=.000375. Cells highlighted in bold show significantly different values. Open table in a new tab Note.— χ2=30.40, 9 df; P=.000375. Cells highlighted in bold show significantly different values. At present, we cannot completely exclude the possibility of a second functionally associated region in the vicinity of SNP rs3170633. The association test for this SNP showed low P values in both populations (P=.009) (fig. 2). However, these values are not significant after correction for multiple testing. Genotype frequency distribution in the Danish population suggests a dominant mode of transmission for the two SNPs of interest (rs2301022 and rs3170633), with the G allele dominant in each of them (fig. 3). For rs2301022, genotypes AA, AG, and GG show respective ORs of 0.37, 1.22, and 1.12. Thus, we pooled AG and GG genotypes, since both are associated with disease, to approximately the same degree. The corresponding OR for disease then was 2.72 (P=.0005). For rs3170633, which showed weaker association, OR=1.77 (P=.002). Thus, case-control studies of two independent populations provided strong evidence of an association of the GCLM gene and schizophrenia. These data were supported with an additional linkage study of the families from the NIMH cohort, shown in table 6. Genotyping of 275 individuals from 72 families for seven SNPs in the GCLM gene showed supportive (although by no means significant) evidence of linkage between schizophrenia and two GCLM markers. The highest LOD score, 1.382 (corresponding to P=.012), was obtained under assumed dominant inheritance for rs2064764, which is located within 2 kb (∼0.002 cM) of rs3170633.Table 6Family Linkage Analysis of the GCLM GeneDominant ModelRecessive ModelSNPLODaLOD score is log10 (OR).χ2PLODaLOD score is log10 (OR).χ2Prs2235971001.038.176.675rs3170633.5682.614.106.215.991.320rs20647641.3826.363.012.4702.163.141rs769211.2711.248.264.081.371.542rs7188731.1065.093.0241.2065.553.019rs718875.5162.375.123.109.501.479rs2301022.034.157.692.170.785.376Note.—Cells highlighted in bold show significantly different values.a LOD score is log10 (OR). Open table in a new tab Note.— Cells highlighted in bold show significantly different values. To test whether there is association in the presence of linkage, we ran a family-based association statistic test (FBAT v. 1.7.2) in NIMH families (table 7). The results showed that there is significant evidence (Z=3.247; P=.0012) to accept the alternative hypothesis of association in the presence of linkage between SNP marker rs2301022 and the schizophrenia phenotype: allele G at the marker appeared as significantly overtransmitted to the affected offspring. Moreover, the P value remains significant, experiment-wise, after correction for multiple testing (table 7).Table 7Family-Based Association Test for SNP Markers Linked to GCLMMarkerAlleleAllele FrequencyZPrs2301022G.5673.247.0012rs718875T.892.202.8399rs718873T.862.258.7963rs769211T.209.784.4332rs2064764A.428.935.3496rs3170633A.441.577.5637rs2235971A.266.832.4054Note.—Cells highlighted in bold show significantly different values. Open table in a new tab Note.— Cells highlighted in bold show significantly different values. To define possible functional variants associated with the disease, we estimated pairwise linkage disequilibrium (LD) for all 17 SNPs of GCLM and GSS genes in 348 unaffected subjects from Denmark. The resulting LD map showed very strong association among all markers within each of the two genes (fig. 4). Thus, any association with this region might suggest the presence of a functional variant associated with schizophrenia. On the basis of the strong association of two SNPs (rs2301022 and rs718875) in the 5′ region of the GCLM gene and schizophrenia, we examined the relationship of these variants and the GCLM expression level in the Swiss population. The mRNA steady-state level in cultured fibroblasts showed a significant correlation with these two SNPs (P=.040). This result confirms the functional effect of the GCLM variants on the schizophrenia phenotype. However, it is still unknown in which way these variants affect the GCLM gene expression, since their localization is not directly related to any of the currently known regulatory sequences. It is worth noting that the GCLM gene is localized on chromosome 1p21, the region shown by previous linkage studies to be one of the several regions critical for schizophrenia.30Pulver AE Mulle J Nestadt G Swartz KL Blouin JL Dombroski B Liang KY Housman DE Kazazian HH Antonarakis SE Lasseter VK Wolyniec PS Thornquist MH McGrath JA Genetic heterogeneity in schizophrenia: stratification of genome scan data using co-segregating related phenotypes.Mol Psychiatry. 2000; 5: 650-653Crossref PubMed Scopus (81) Google Scholar, 31Arinami T Ohtsuki T Ishiguro H Ujike H Tanaka Y Morita Y Mineta M et al.Genomewide high-density SNP linkage analysis of 236 Japanese families supports the existence of schizophrenia susceptibility loci on chromosomes 1p, 14q, and 20p.Am J Hum Genet. 2005; 77: 937-944Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar Several genes involved in GSH metabolism have already been considered as potential candidates for schizophrenia. Association of the glutathione-S-transferase M 1 gene was shown in a subgroup of patients with schizophrenia in Japanese32Harada S Tachikawa H Kawanishi Y Glutathione S-transferase M1 gene deletion may be associated with susceptibility to certain forms of schizophrenia.Biochem Biophys Res Commun. 2001; 281: 267-271Crossref PubMed Scopus (60) Google Scholar and Korean33Pae CU Yu HS Kim JJ Kim W Lee CU Lee SJ Jun TY Lee C Paik IH Serretti A Glutathione S-transferase M1 polymorphism may contribute to schizophrenia in the Korean population.Psychiatr Genet. 2004; 14: 147-150Crossref PubMed Scopus (30) Google Scholar populations. Case-control studies of glutathione-S-transferase P1 and glutathione peroxidase 1 showed no association.34Pae CU Kim JJ Lee SJ Lee CU Lee C Paik IH Park HR Yang S Serretti A Association study between glutathione S-transferase P1 polymorphism and schizophrenia in the Korean population.Prog Neuropsychopharmacol Biol Psychiatry. 2003; 27: 519-523Crossref PubMed Scopus (21) Google Scholar, 35Shinkai T Luca VD Zai G Shaikh S Matsumoto C Arnold PD Hwang R King N Trakalo J Potapova N Wong G Hori H Wong AH Ohmori O Nakamura J Kennedy JL No association between the Pro197Leu polymorphism in the glutathione peroxidase (GPX1) gene and schizophrenia.Psychiatr Genet. 2004; 14: 177-180Crossref PubMed Scopus (12) Google Scholar Although GCLM is not essential for survival, its interaction with the GCLC subunit increases, by four- to fivefold, the catalytic efficiency of the holoenzyme.36Chen Y Shertzer HG Schneider SN Nebert DW Dalton TP Glutamate cysteine ligase catalysis: dependence on ATP and modifier subunit for regulation of tissue glutathione levels.J Biol Chem. 2005; 280: 33766-33774Crossref PubMed Scopus (159) Google Scholar The GCLM knockout (KO) mice exhibit an increased sensitivity to oxidative stress37Yang Y Dieter MZ Chen Y Shertzer HG Nebert DW Dalton TP Initial characterization of the glutamate-cysteine ligase modifier subunit Gclm(−/−) knockout mouse: novel model system for a severely compromised oxidative stress response.J Biol Chem. 2002; 277: 49446-49452Crossref PubMed Scopus (191) Google Scholar; mouse fetal fibroblasts are 10-fold more sensitive to an oxidative stress than are the wild type. Similarly, we observed lower GCL activity in patients’ fibroblasts exposed to an oxidative stress, compared with that in control fibroblasts.22Gysin R, Tosic M, Chappuis C, Deppen P, Ruiz V, Bovet P, Cuenod M, Do KQ (2005) Dysregulation of glutamate cysteine ligase in schizophrenia. Paper presented at the 36th Annual Meeting of the Society for Neuroscience, Washington, DC, November 12–16Google Scholar Thus, a GCLM defect could lead to GCL-activity dysregulation, consistent with the involvement of oxidative stress–induced impairment of neuronal processes and mitochondrial function3Mahadik SP Mukherjee S Free radical pathology and antioxidant defense in schizophrenia: a review.Schizophr Res. 1996; 19: 1-17Abstract Full Text PDF PubMed Scopus (309) Google Scholar, 4Herken H Uz E Ozyurt H Sogut S Virit O Akyol O Evidence that the activities of erythrocyte free radical scavenging enzymes and the products of lipid peroxidation are increased in different forms of schizophrenia.Mol Psychiatry. 2001; 6: 66-73Crossref PubMed Scopus (209) Google Scholar, 5Marchbanks RM Ryan M Day I Owen M McGuffin P Whatley S A mitochondrial DNA sequence variant associated with schizophrenia and oxidative stress.Schizophr Res. 2003; 65: 33-38Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar, 6Prabakaran S Swatton J Ryan M Huffaker SJ Huang JJ Griffin JL Wayland M Freeman T Dudbridge F Lilley KS Karp NA Hester S Tkachev D Mimmack ML Yolken RH Webster MJ Torrey EF Bahn S Mitochondrial dysfunction in schizophrenia: evidence for compromised brain metabolism and oxidative stress.Mol Psychiatry. 2004; 9: 684-697Crossref PubMed Scopus (348) Google Scholar, 7Altar CA Jurata LW Charles V Lemire A Liu P Bukhman Y Young TA Bullard J Yokoe H Webster MJ Knable MB Brockman JA Deficient hippocampal neuron expression of proteasome, ubiquitin, and mitochondrial genes in multiple schizophrenia cohorts.Biol Psychiatry. 2005; 58: 85-96Abstract Full Text Full Text PDF PubMed Scopus (212) Google Scholar reported for schizophrenia. GCLM KO mice showed an increased feedback inhibition of GCL activity, apparently resulting in brain GSH levels ∼40% of normal.36Chen Y Shertzer HG Schneider SN Nebert DW Dalton TP Glutamate cysteine ligase catalysis: dependence on ATP and modifier subunit for regulation of tissue glutathione levels.J Biol Chem. 2005; 280: 33766-33774Crossref PubMed Scopus (159) Google Scholar, 37Yang Y Dieter MZ Chen Y Shertzer HG Nebert DW Dalton TP Initial characterization of the glutamate-cysteine ligase modifier subunit Gclm(−/−) knockout mouse: novel model system for a severely compromised oxidative stress response.J Biol Chem. 2002; 277: 49446-49452Crossref PubMed Scopus (191) Google Scholar This is strikingly similar to the levels 52% below normal reported for patients with schizophrenia.15Do KQ Trebesinger A Kirsten-Kruger M Lauer C Dydak U Hell D Holsboer F Boesinger P Cuenod M Schizophrenia: glutathione deficit in cerebro spinal fluid and prefrontal cortex in vivo.Eur J Neurosci. 2000; 12: 3721-3728Crossref PubMed Scopus (404) Google Scholar Thus, GCLM KO mice can be used as a model for further studies of GSH deficit in schizophrenia. A GCL dysregulation could lead to cellular alterations in the surroundings of dopaminergic terminals, affecting the synaptic contacts on dendritic spines of prefrontal cortical neurons that are particularly rich in dopamine innervations. Indeed, the metabolism of dopamine generates reactive oxygen species (e.g., hydrogen peroxide and quinones), which, in GSH-deficit conditions, are not adequately neutralized and, thus, induce cellular damage.11Rabinovic AD Hastings TG Role of endogenous glutathione in the oxidation of dopamine.J Neurochem. 1998; 71: 2071-2078Crossref PubMed Scopus (70) Google Scholar Interestingly, in rat models, GSH deficit and excess dopamine during development mimic structural and functional anomalies observed in patients: they exhibited a decrease in spine density of pyramidal neurons (F. Gheorghita, unpublished data) and, selectively, in GABA-parvalbumin immunoreactivity of prefrontal cortex,21Cabungcal J Nicolas D Kraftsik R Cuenod M Do KQ Hornung JP Glutathione deficit during development induces anomalies in the rat anterior cingulate GABAergic neurons: relevance to schizophrenia.Neurobiol Dis. 2006; 22: 624-637Crossref PubMed Scopus (68) Google Scholar similar to patients.38Lewis DA Hashimoto T Volk DW Cortical inhibitory neurons and schizophrenia.Nat Rev Neurosci. 2005; 6: 312-324Crossref PubMed Scopus (1707) Google Scholar, 39Kolluri N Sun Z Sampson AR Lewis DA Lamina-specific reductions in dendritic spine density in the prefrontal cortex of subjects with schizophrenia.Am J Psychiatry. 2005; 162: 1200-1202Crossref PubMed Scopus (173) Google Scholar The same rat model presented an impairment in object recognition18Castagne V Rougemont M Cuenod M Do KQ Low brain glutathione and ascorbic acid associated with dopamine uptake inhibition during rat’s development induce long-term cognitive deficit: relevance to schizophrenia.Neurobiol Dis. 2004; 15: 93-105Crossref PubMed Scopus (61) Google Scholar, 19Castagne VV Cuenod M Do KQ An animal model with relevance to schizophrenia: sex-dependent cognitive deficits in osteogenic disorder-Shionogi rats induced by glutathione synthesis and dopamine uptake inhibition during development.Neuroscience. 2004; 123: 821-834Crossref PubMed Scopus (40) Google Scholar and in integration of olfactory information,40Cabungcal J Singer D Hornung J-P Cuenod M Do KQ Schenk F Special bias deficit in rats with low glutathione during development: a behaviour model with relevance to schizophrenia.Schizophr Res. 2004; 67: 118Google Scholar reproducing some cognitive deficits of schizophrenia. Furthermore, NMDA-R hypofunction is implicated in schizophrenia, since the NMDA-R antagonist phencyclidine induces a psychotic syndrome.41Krystal JH Karper LP Seibyl JP Freeman GK Delaney R Bremner JD Heninger GR Bowers Jr, MB Charney DS Subanesthetic effects of the noncompetitive NMDA antagonist, ketamine, in humans: psychotomimetic, perceptual, cognitive, and neuroendocrine responses.Arch Gen Psychiatry. 1994; 51: 199-214Crossref PubMed Scopus (2523) Google Scholar In the case of GSH deficit, NMDA-R activity could be depressed through interaction at their redox sites.12Kohr G Eckardt S Luddens H Monyer H Seeburg PH NMDA receptor channels: subunit-specific potentiation by reducing agents.Neuron. 1994; 12: 1031-1040Abstract Full Text PDF PubMed Scopus (208) Google Scholar, 13Choi YB Lipton SA Redox modulation of the NMDA receptor.Cell Mol Life Sci. 2000; 57: 1535-1541Crossref PubMed Scopus (139) Google Scholar Similarly, in rat hippocampal slices, GSH depletion impaired NMDA-dependent synaptic plasticity.20Steullet P Neijt H Cuenod M Do KQ Synaptic plasticity impairment and hypofunction of NMDA receptors induced by glutathione deficit: relevance to schizophrenia.Neuroscience. 2005; 137: 807-819Crossref PubMed Scopus (138) Google Scholar In conclusion, these studies provide converging evidence of a link between schizophrenia and GCLM genetic variations, which affect the function of the encoded protein in its ability to promote GSH synthesis when challenged by an oxidative stress. They support the new concept that a dysregulation of GSH metabolism is one of the vulnerability factors contributing to the development of the disease. We are grateful to Marinette Blanc, Sylviane Raymond, and Beatrice Benz, for technical help; to Dr. Messod Benathan, for advice concerning skin biopsy and fibroblast cell cultures; to Dr. Franziska Gamma, for participation in patient recruitment; and to Dr. Graham Knott, for critical reading of the manuscript. We are thankful to Prof. Olivier Halfon, for financial support of F.G., and to Prof. Pierre Magistretti, for his constant support. This work was supported by Swiss National Research Foundation grant 31-55924.98, by the Novartis Research Foundation, and by NIMH grant MH44292." @default.
- W2039366241 created "2016-06-24" @default.
- W2039366241 creator A5005689668 @default.
- W2039366241 creator A5037140624 @default.
- W2039366241 creator A5042072885 @default.
- W2039366241 creator A5044053940 @default.
- W2039366241 creator A5047586882 @default.
- W2039366241 creator A5051228367 @default.
- W2039366241 creator A5055755754 @default.
- W2039366241 creator A5058566851 @default.
- W2039366241 creator A5064616364 @default.
- W2039366241 creator A5066813811 @default.
- W2039366241 creator A5069893226 @default.
- W2039366241 creator A5075652902 @default.
- W2039366241 creator A5076937097 @default.
- W2039366241 creator A5078914193 @default.
- W2039366241 creator A5084586573 @default.
- W2039366241 creator A5091160132 @default.
- W2039366241 date "2006-09-01" @default.
- W2039366241 modified "2023-10-12" @default.
- W2039366241 title "Schizophrenia and Oxidative Stress: Glutamate Cysteine Ligase Modifier as a Susceptibility Gene" @default.
- W2039366241 cites W1538128477 @default.
- W2039366241 cites W160295494 @default.
- W2039366241 cites W1631043697 @default.
- W2039366241 cites W1966111889 @default.
- W2039366241 cites W1975372261 @default.
- W2039366241 cites W1989394936 @default.
- W2039366241 cites W2003614392 @default.
- W2039366241 cites W2004497754 @default.
- W2039366241 cites W2004830149 @default.
- W2039366241 cites W2008682443 @default.
- W2039366241 cites W2014109189 @default.
- W2039366241 cites W2019514154 @default.
- W2039366241 cites W2028884770 @default.
- W2039366241 cites W2033750212 @default.
- W2039366241 cites W2034361309 @default.
- W2039366241 cites W2048168782 @default.
- W2039366241 cites W2054602118 @default.
- W2039366241 cites W2061811064 @default.
- W2039366241 cites W2062296684 @default.
- W2039366241 cites W2062479330 @default.
- W2039366241 cites W2067929856 @default.
- W2039366241 cites W2071370388 @default.
- W2039366241 cites W2073123124 @default.
- W2039366241 cites W2074278966 @default.
- W2039366241 cites W2075650547 @default.
- W2039366241 cites W2077595708 @default.
- W2039366241 cites W2081413793 @default.
- W2039366241 cites W2084120702 @default.
- W2039366241 cites W2088215062 @default.
- W2039366241 cites W2089114713 @default.
- W2039366241 cites W2089912569 @default.
- W2039366241 cites W2108715835 @default.
- W2039366241 cites W2121082411 @default.
- W2039366241 cites W2130718539 @default.
- W2039366241 cites W2156139982 @default.
- W2039366241 cites W2159599680 @default.
- W2039366241 cites W2413585916 @default.
- W2039366241 cites W4245957869 @default.
- W2039366241 cites W4251014585 @default.
- W2039366241 cites W4317639707 @default.
- W2039366241 doi "https://doi.org/10.1086/507566" @default.
- W2039366241 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/1559555" @default.
- W2039366241 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16909399" @default.
- W2039366241 hasPublicationYear "2006" @default.
- W2039366241 type Work @default.
- W2039366241 sameAs 2039366241 @default.
- W2039366241 citedByCount "202" @default.
- W2039366241 countsByYear W20393662412012 @default.
- W2039366241 countsByYear W20393662412013 @default.
- W2039366241 countsByYear W20393662412014 @default.
- W2039366241 countsByYear W20393662412015 @default.
- W2039366241 countsByYear W20393662412016 @default.
- W2039366241 countsByYear W20393662412017 @default.
- W2039366241 countsByYear W20393662412018 @default.
- W2039366241 countsByYear W20393662412019 @default.
- W2039366241 countsByYear W20393662412020 @default.
- W2039366241 countsByYear W20393662412021 @default.
- W2039366241 countsByYear W20393662412022 @default.
- W2039366241 countsByYear W20393662412023 @default.
- W2039366241 crossrefType "journal-article" @default.
- W2039366241 hasAuthorship W2039366241A5005689668 @default.
- W2039366241 hasAuthorship W2039366241A5037140624 @default.
- W2039366241 hasAuthorship W2039366241A5042072885 @default.
- W2039366241 hasAuthorship W2039366241A5044053940 @default.
- W2039366241 hasAuthorship W2039366241A5047586882 @default.
- W2039366241 hasAuthorship W2039366241A5051228367 @default.
- W2039366241 hasAuthorship W2039366241A5055755754 @default.
- W2039366241 hasAuthorship W2039366241A5058566851 @default.
- W2039366241 hasAuthorship W2039366241A5064616364 @default.
- W2039366241 hasAuthorship W2039366241A5066813811 @default.
- W2039366241 hasAuthorship W2039366241A5069893226 @default.
- W2039366241 hasAuthorship W2039366241A5075652902 @default.
- W2039366241 hasAuthorship W2039366241A5076937097 @default.
- W2039366241 hasAuthorship W2039366241A5078914193 @default.
- W2039366241 hasAuthorship W2039366241A5084586573 @default.
- W2039366241 hasAuthorship W2039366241A5091160132 @default.
- W2039366241 hasBestOaLocation W20393662411 @default.