FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2039441672> ?p ?o ?g. }

• W2039441672 endingPage "1160" @default.
• W2039441672 startingPage "1152" @default.
• W2039441672 abstract "RX, a homeodomain-containing protein essential for proper eye development (Mathers, P. H. Grinberg, A., Mahon, K. A., and Jamrich, M. (1997) Nature 387, 603–607), binds to the photoreceptor conserved element-1 (PCE-1/Ret 1) in the photoreceptor cell-specific arrestin promoter and stimulates gene expression. RX is found in many retinal cell types including photoreceptor cells. Another homeodomain-containing protein, CRX, which binds to the OTX element to stimulate promoter activity, is found exclusively in photoreceptor cells (Chen, S., Wang, Q. L., Nie, Z., Sun, H., Lennon, G., Copeland, N. G., Gillbert, D. J. Jenkins, N. A., and Zack, D. J. (1997) Neuron 19, 1017–1030; Furukawa, T., Morrow, E. M., and Cepko, C. L. (1997) Cell 91, 531–541). Binding assay and cell culture studies indicate that both PCE-1 and OTX elements and at least two different regulatory factors RX and CRX are necessary for high level, photoreceptor cell-restricted gene expression. Thus, photoreceptor specificity can be achieved by multiple promoter elements interacting with a combination of both photoreceptor-specific regulatory factors and factors present in closely related cell lineages. RX, a homeodomain-containing protein essential for proper eye development (Mathers, P. H. Grinberg, A., Mahon, K. A., and Jamrich, M. (1997) Nature 387, 603–607), binds to the photoreceptor conserved element-1 (PCE-1/Ret 1) in the photoreceptor cell-specific arrestin promoter and stimulates gene expression. RX is found in many retinal cell types including photoreceptor cells. Another homeodomain-containing protein, CRX, which binds to the OTX element to stimulate promoter activity, is found exclusively in photoreceptor cells (Chen, S., Wang, Q. L., Nie, Z., Sun, H., Lennon, G., Copeland, N. G., Gillbert, D. J. Jenkins, N. A., and Zack, D. J. (1997) Neuron 19, 1017–1030; Furukawa, T., Morrow, E. M., and Cepko, C. L. (1997) Cell 91, 531–541). Binding assay and cell culture studies indicate that both PCE-1 and OTX elements and at least two different regulatory factors RX and CRX are necessary for high level, photoreceptor cell-restricted gene expression. Thus, photoreceptor specificity can be achieved by multiple promoter elements interacting with a combination of both photoreceptor-specific regulatory factors and factors present in closely related cell lineages. interphotoreceptor retinoid-binding protein photoreceptor conserved element 1 base pair(s) glutathioneS-transferase polymerase chain reaction chloramphenicol acetyltransferase electrophoretic mobility shift assay chicken ovalbumin upstream promoter antibody Our goal is to understand the basic biochemical mechanisms of tissue-restricted gene expression. The vertebrate retina offers a distinct advantage in studying gene expression since it contains large numbers of well defined cell types, such as photoreceptor cells. Photoreceptor cells are highly specialized to convert light energy into neuronal impulses, a process which involves many proteins, several of which have been well characterized such as opsin, interphotoreceptor retinoid-binding protein (IRBP),1 and phosphodiesterase (4.Stryer L. Cold Spring Harbor Symp. Quant. Biol. 1988; 53: 283-294Crossref PubMed Google Scholar). Arrestin, also known as S-antigen, accumulates to high levels in the outer segments of retinal photoreceptor cells, where it down-regulates the phototransduction cascade (5.Kuhn H. Hall S.W. Wilden U. FEBS Lett. 1984; 176: 473-478Crossref PubMed Scopus (277) Google Scholar). The transcriptional efficiency and tissue specificity of a given gene are determined by the specific combination of regulatory factors that assemble on the gene's regulatory elements to form the transcription initiation complex. Several homeodomain proteins such as Pax6 (6.Walther C. Gruss P. Development. 1991; 113: 1435-1449Crossref PubMed Google Scholar), RX (1.Mathers P.H. Grinberg A. Mahon K.A. Jamrich M. Nature. 1997; 387: 603-607Crossref PubMed Scopus (582) Google Scholar, 7.Furukawa T. Kozack C.A. Cepko C.L. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 3088-3093Crossref PubMed Scopus (310) Google Scholar), and CRX (2.Chen S. Wang Q.L. Nie Z. Sun H. Lennon G. Copeland N.G. Gillbert D.J. Jenkins N.A. Zack D.J. Neuron. 1997; 19: 1017-1030Abstract Full Text Full Text PDF PubMed Scopus (575) Google Scholar, 3.Furukawa T. Morrow E.M. Cepko C.L. Cell. 1997; 91: 531-541Abstract Full Text Full Text PDF PubMed Scopus (716) Google Scholar) which profoundly affect vertebrate eye development, bind to promoter elements of several eye-specific genes, and may aid in the activation of these genes. The RX homeobox gene has been found to be essential for normal vertebrate eye development, and its mis-expression has profound effects on eye morphology (1.Mathers P.H. Grinberg A. Mahon K.A. Jamrich M. Nature. 1997; 387: 603-607Crossref PubMed Scopus (582) Google Scholar). Xenopus embryos injected with RX mRNA develop ectopic retinal tissue and exhibit hyperproliferation in the neural retina. Mouse embryos homozygous for a null allele of this gene fail to form optic cups and therefore do not develop eyes. It is clear that the RX gene family plays a crucial role in the establishment and/or proliferation of retinal progenitor cells. Other homeobox proteins, especially the transcriptional regulatory protein Pax6, play an important role in vertebrate and invertebrate eye formation. Mutations which affect the function of Pax6 result in severe eye malformations known as Aniridia in humans and small eye syndrome in mice (8.Hill R.E. Favor J. Hogan B.L. Ton C.C. Saunders G.F. Hanson I.M. Proseer J. Jordan T. Hastie N.D. van Heyningen V. Nature. 1991; 354: 522-525Crossref PubMed Scopus (1162) Google Scholar). Another homeodomain protein, CRX, binds to the OTX regulatory sequence found upstream of several photoreceptor cell-specific genes and can stimulate transcriptional activity of the opsin and IRBP promoters in non-retinal cells (2.Chen S. Wang Q.L. Nie Z. Sun H. Lennon G. Copeland N.G. Gillbert D.J. Jenkins N.A. Zack D.J. Neuron. 1997; 19: 1017-1030Abstract Full Text Full Text PDF PubMed Scopus (575) Google Scholar). Moreover, mutation of the CRX gene induces a cone-rod dystrophy in humans (9.Freund C.L. Gregory-Evans C.Y. Furukawa T. Papaioannou M. Looser J. Ploder L. Bellingham J. Ng D. Herbrick J.A.S. Duncan A. Scherer S.W. Tsui L.C. Loutradis-Anagnostou A. Jacobson S.G. Cepko C.L. Bhattacharya S.S. McInnes R.R. Cell. 1997; 91: 543-553Abstract Full Text Full Text PDF PubMed Scopus (455) Google Scholar). Thus, CRX is a novel photoreceptor cell-specific factor and plays a crucial role in the differentiation of photoreceptor cells. We have previously identified the photoreceptor conserved element 1 (PCE-1) consensus sequence which is found in the functionally important regulatory regions of all known photoreceptor cell-specific genes. The same nuclear regulatory factors which bind to the arrestin PCE-1 site also recognize PCE-1 sites in the promoter regions of other vertebrate photoreceptor-specific genes (10.Kikuchi T. Raji K. Breitman M.L. Shinohara T. Mol. Cell. Biol. 1993; 13: 4400-4408Crossref PubMed Scopus (105) Google Scholar). A factor-binding site with the same core sequence as PCE-1 has also been identified as Ret1 in the 5′-flanking region of the rat opsin gene (11.Morabito M.A., Yu, X. Barnstable C.J. J. Biol. Chem. 1991; 266: 9667-9672Abstract Full Text PDF PubMed Google Scholar). These results suggest that the PCE-1 and Ret1 sites are structurally and perhaps functionally the same. Recently, a factor designated Erx was found to bind to the Ret 1 site (12.Martinez J.A. Barnstable J.C. Biochem. Biophys. Res. Commun. 1998; 250: 175-180Crossref PubMed Scopus (27) Google Scholar). Here we have isolated a human homeodomain-containing protein RX, which binds to the PCE-1/Ret1 site and activates the TATA-less arrestin promoter (10.Kikuchi T. Raji K. Breitman M.L. Shinohara T. Mol. Cell. Biol. 1993; 13: 4400-4408Crossref PubMed Scopus (105) Google Scholar, 13.Smale S.T. Biochim. Biophys. Acta. 1997; 1351: 73-88Crossref PubMed Scopus (501) Google Scholar) and IRBP promoter. Our study established that RX is a transcriptional regulatory protein which binds to a regulatory region found in many retina-specific genes and up-regulates expression of these genes. Furthermore, our study suggested that two individual elements (PCE-1 and OTX) and two different factors (RX and CRX) are necessary for stimulating expression of photoreceptor cell-specific genes. The random-primed λgt11 human retina library (CLONTECH Laboratories, Palo Alto, CA) was screened by the Southwestern method (14.Singh H. LeBowitz J.H. Baldwin Jr., A.S. Sharp P.A. Cell. 1988; 52: 415-423Abstract Full Text PDF PubMed Scopus (419) Google Scholar). Oligonucleotides were synthesized by the Life Technologies, Inc. Custom Primers Service (Grand Island, NY). The oligonucleotides containing mouse PCE-1 sites were annealed, 5′ end-labeled with [γ-32P]ATP (NEN Life Science Products, Boston, MA) and T4 polynucleotide kinase, and concatenated with T4 DNA ligase. The average final length of probe 1 and probe 2 was approximately 200 bp. Probe 1 was GCGCAAGCTTTCAATTAGCTATTTTCGAAAGTTAATCGATAACGCG and Probe 2, CCAAAAGCTTTCAATTAGCTATTTTCGAAAGTTAATCGATAAGGTT. Bacteriophage (2 × 105 per dish) were plated withEscherichia coli Y1090 on 120-cm2 LB plates and incubated at 42 °C for 3.5 h. Nitrocellulose filters (BA-S 85TM; Schleicher & Schuell Inc., Keene, NH) impregnated with 10 mmisopropylthio-β-d-galactopyranoside were then overlaid onto the cultures and incubation continued at 37 °C overnight. The filters were lifted, air-dried, and submerged for 10 min in 250 ml of binding buffer (12 mm HEPES, pH 7.9, 12 mm KCl, 0.6 mm MgCl2, 1.2 mmdithiothreitol) containing 6 m guanidine hydrochloride. The filters were washed for 10 min with gentle shaking in the same volume of the binding buffer without guanidine hydrochloride. To maximize renaturation of the proteins, we repeated this cycle (binding buffer plus 6 m guanidine hydrochloride followed by binding buffer alone) four times. The filters were blocked with 250 ml of binding buffer containing 5% nonfat skim milk for 4 h at 4 °C with gentle shaking. They were incubated with gentle shaking at 4 °C overnight with labeled DNA probe (106 cpm/ml) in 250 ml of binding buffer supplemented with 0.25% skim milk. The filters were washed 3 times with 500 ml of binding buffer containing 0.25% skim milk and 50 mm KCl for 10 min at room temperature. The filters were dried on 3MM paper and exposed to Fuji x-ray Film (Fuji Film Co., Tokyo, Japan) overnight at −70 °C. The 5′ fragment (479 bp) and 3′ fragment (856 bp) of the hRx cDNA were 32P-labeled with T7 QuickPrimeTM Kit (Amersham Pharmacia Biotech) and used to screen the human retina cDNA library. Bacteriophage (5 × 105) were plated with E. coli strain Y1090 onto 120-cm2 plates and grown 37 °C for 8 h. Detailed procedures were described elsewhere (15.Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning, A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989Google Scholar). We produced RX and CRX as GST fusion proteins in anE. coli expression system. Because there was a stop codon upstream of the translation initiation codon of hRx, a PCR primer (TCCCGGAATTCCCCATGCACCTG) was designed with anEcoRI site just upstream of the translation initiation codon of the hRx cDNA, and a second PCR primer (GGACCTCTGGTAGGTTGACCTTG) was designed to introduce EcoNI site into the 3′ non-coding region of the hRx cDNA. These primers were used to PCR amplify 10 ng of DNA containing the entire coding region of hRx cDNA (16.Innis M.A. Gelfand D.H. Sninsky J.J. White T.J. PCR Protocols, A Guide to Method and Application. Academic Press, San Diego, CA1990Google Scholar). The PCR amplification product (548 bp) was blunt end ligated into the HincII site of the pBlueScript II SK+ (Stratagene, La Jolla, CA). After confirming the fidelity of the PCR amplification by DNA sequence analysis, the fragment between the XhoI site in the pBlueScript and EcoNI site in the PCR product was subcloned such that it replaced the XhoI/EcoNI fragment in the original hRx cDNA/pBlueScript construct. The EcoRI fragment of this new hRx cDNA was subcloned into the EcoRI site of pGEX4T-1 (Amersham Pharmacia Biotech), and the final ligation creates an in-frame fusion of the GST and hRx coding sequences. The cDNA for human CRX (provided by Dr. D.J. Zack, Johns Hopkin University) was subcloned into the BamHI and XhoI sites of pGEX4T-1 to create a similar in-frame fusion between GST and hCRX. These two GST fusion constructs were expressed in the E. coli strain BL21. The bacteria were cultured in 25 ml of LB medium with 0.1 mg/ml ampicillin at 37 °C for 3–4 h (to anA 600 of 0.6), then 0.2 mmisopropylthio-β-d-galactopyranoside was added and the incubation continued for an additional 4–6 h. The bacteria were harvested and resuspended in 1 ml of bacteria lysis buffer (50 mm Tris, pH 8.0, 200 mm NaCl, 1.5 mm EDTA, pH 8.0). The bacterial suspensions were treated with 1 mg/ml lysozyme, 5 mm dithiothreitol, 1 mm phenylmethylsulfonyl fluoride and sonicated for 1 min. After centrifugation at 20,000 × g for 20 min, the supernatant was mixed with 30 μl of glutathione-Sepharose 4B (Amersham Pharmacia Biotech) and incubated for 1 h at room temperature. The Sepharose was washed 3 times with bacteria lysis buffer, then mixed with glutathione reducing buffer (Amersham Pharmacia Biotech). After centrifugation, the supernatant containing the GST fusion protein was kept at −70 °C. An albino rabbit (Harlan Sprague-Dawley) and a mouse (BALB/c) were immunized with the GST-RX fusion protein emulsified with CFA (Life Technologies, Inc.) by subcutaneous injection in the back with 2 mg/0.5 ml and 0.5 mg/0.2 ml, respectively. Two and four weeks later booster injections of GST-RX emulsified with IFA (Life Technologies, Inc.) were given. Five weeks after the first injection the animals were euthanized and their serum collected. The anti-RX antibodies were purified on an immobilized protein-A agarose column following a Pierce instruction manual (Pierce, Rockford, IL). The eyes from adult Long-Evan's rats (body weight about 200 g) were immersed in fixative (4% paraformaldehyde in phosphate-buffered saline, pH 7.4) at 4 °C for 10 min. Then the eyes were cut and retinae were removed from the anterior segment, lens and vitreous body and kept in the fresh fixative at 4 °C for overnight. The tissues were embedded in paraffin and thin sections (5 μm) were obtained. These sections were treated with methanol for 30 min at −20 °C to increase membrane permeability, followed by 4% hydrogen peroxide treatment to block endogenous peroxidase activity. The sections were incubated overnight at 4 °C with a 1:500 dilution of mouse anti-RX polyclonal Ab alone or with the same antiserum which had been neutralized by preincubation with 200 μg of GST-RX protein at 4 °C for 24 h. The sections were then incubated with biotinylated goat anti-rabbit IgG antibody (Sigma). Color development was done with ExtrAvidin Peroxidase (Sigma) and 3-amino-9-ethylcarbazole (AEC substrate kit, Vector Laboratories, Burlingame, CA) according to the manufacturers' instructions. One gram each of bovine retina, lens, iris, mouse brain, and mouse liver were homogenized in RIPA buffer (1× phosphate-buffered saline, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS) and centrifuged. After estimation of supernatant protein concentration with Bio-Rad Protein AssayTM (Bio-Rad), aliquots containing 60 μg of protein were dissolved in SDS-polyacrylamide gel electrophoresis sample buffer, separated on SDS-polyacrylamide gel electrophoresis and blotted onto ImmunobilonTM (Millipore Corp., Bedford, MA) (17.Legendre N. BioTechniques. 1990; 9: 788-805PubMed Google Scholar). The filters were incubated overnight with rabbit RX Ab alone (1:1000 dilution) or with RX Ab which had been neutralized with GST-RX protein (see above). After washing, the blots were incubated with horseradish peroxidase-labeled secondary Abs (goat anti-rabbit IgG or goat anti-mouse IgG; 1:1000; Kirkegaard & Perry Laboratories, Inc., Gaithersburg, MD). The color was developed with 0.01% hydrogen peroxide and 0.05% 3,3-diaminobenzidine tetrahydrochloride (Bio-Rad). Protein size markers were purchased from Bio-Rad. Oligonucleotide probes listed in TableI were annealed and their 5′-ends were labeled with [γ-32P]ATP and T4polynucleotide kinase (Promega, Madison, WI). The standard binding reaction was carried out in 20 μl of a mixture containing 12 mm HEPES (pH 7.9), 12 mm KCl, 0.6 mm MgCl2, 1.2 mm dithiothreitol, 10% glycerol, 2 μg of poly(dI-dC), 5 fmol of the32P-labeled probe, and 8 ng to 1 μg of purified GST-RX fusion protein. In competition assays, 8 fmol to 1 pmol (1.6–200 fold molar excess) of the competitor DNA was added to the standard mixture. After incubation on ice for 30 min, the samples were loaded onto 5% polyacrylamide gels in 0.5 × Tris borate-EDTA (TBE) buffer, and electrophoresed at 10 V/cm for 2 to 3 h at room temperature. The gel was then dried and autoradiographed at −70 °C.Table IOligonucleotides used in EMSA Open table in a new tab For Ab supershift analysis, 1 μl of rabbit Ab to RX was added to the standard mixture halfway through the reaction (after the first 15 min of incubation). Nuclear extract from bovine retinas was prepared by the method of Gorski et al. (18.Gorski K. Carneriro M. Schibler U. Cell. 1986; 47: 767-776Abstract Full Text PDF PubMed Scopus (973) Google Scholar). A construct containing the mouse arrestin promoter (−209 to +304)/chloramphenicol acetyltransferase (CAT) fusion gene (m-ARR-209-CAT) was prepared as described (10.Kikuchi T. Raji K. Breitman M.L. Shinohara T. Mol. Cell. Biol. 1993; 13: 4400-4408Crossref PubMed Scopus (105) Google Scholar). A construct containing the mouse IRBP promoter (−1783 to +101)/CAT fusion gene (m-IRBP-1983-CAT) was provided by John M. Nickerson (Emory University). CAT constructs containing PCE-1 sites or OTX sites upstream of the basal herpes simplex virus thymidine kinase (tk) promoter were generated by inserting double-stranded oligonucleotides into theBstXI site of pBLCAT5 (ATCC, Manassas, VA). Oligonucleotides containing either the PCE-1 or OTX element were chemically synthesized and annealed and ligated as described above. The elements were: PCE-1 CTAGAAAAGCTTTCAATTAGCTATTTTTTCGAAAGTTAATCGATAAGATC and OTX CTAGACTGCTGAGCTTAATCAGGCCTTGACGACTCGAATTAGTCCGGAGATC. Selected clones were sequenced and only clones having exactly two tandemly repeated PCE-1 or OTX elements in the correct orientation were chosen for further experiments. To confirm that RX binds to the PCE-1 site and activates the natural arrestin promoter, the PCE-1 site in the mouse arrestin promoter/CAT construct m-ARR-209-CAT was mutated. The m-ARR-209-CAT was cleaved withHindIII and EcoNI and the fragment was replaced with a double-stranded oligomer containing the mutated sequence as follows: AGCTTTCAACCAGCTATTCCTCTCTTTGCACCTTGAAGTTGGTCGATAAGGAGAGAAACGTGGAACG. The resulting construct was called m-ARR-209-PCE-1-mut-CAT. The mammalian expression plasmid pcDNA3 (Stratagene), bearing the human cytomegalovirus promoter-enhancer, was used to generate RX and CRX expression vectors for co-transfection studies. cDNA fragments containing the complete coding regions of human RX (EcoRI/EcoRI fragment) and human CRX (BamHI/XhoI fragment) were subcloned intoEcoRI-digested and BamHI- andXhoI-digested pcDNA3, respectively. Neuroretinal cells from day 14 embryonic chicken retinae were incubated in 0.25% trypsin at 37 °C for 20 min. Then 5 × 106 cells were cultured in Y-199 medium with 10% fetal calf serum, penicillin (100 units/ml), and streptomycin (100 μg/ml) at 37 °C in polyornithine-coated 60-mm tissue culture plates. Detailed procedures were described elsewhere (19.Boatright J.H. Buono R. Bruno J. Lang R.K. Si J.S. Shinohara T. Peoples J.W. Nickerson J.M. Exp. Eye Res. 1997; 64: 269-277Crossref PubMed Scopus (22) Google Scholar). Human embryonic kidney cells (293 cells) were cultured for 1 to 2 days in Dulbecco's modified Eagle's medium containing 10% fetal calf serum, then they were co-transfected by the calcium phosphate precipitation method with three constructs: (i) 0.04–5.0 μg of an RX or CRX expression vector, (ii) 10 μg of promoter/CAT reporter construct, and (iii) 5 μg of pSV-β-galactosidase vector. After a 48-h incubation, cells were harvested and extracts were assayed for CAT activity (20.Gorman C. Glover D.M. DNA Cloning. 2. IRL Press, Oxford1985: 143-190Google Scholar). All CAT values were normalized to β-galactosidase activity. The results presented represent the mean of at least three independent experiments. We isolated cDNAs for seven individual factors from a human retinal library by Southwestern screening with the PCE-1 probes (probe 1 and probe 2; see “Experimental Procedures”), and a clone which bound strongly to both probes was selected for further study. Sequencing revealed that the clone contained a region homologous to the highly conserved DNA binding consensus (homeobox) in homeodomain proteins. The full size of this clone was 1790 bp long and encoded a 346-amino acid protein, which we have named human RX (GenBank accession number AF115392). This protein shares 85% identity (Fig.1 A) with mouse RX (1.Mathers P.H. Grinberg A. Mahon K.A. Jamrich M. Nature. 1997; 387: 603-607Crossref PubMed Scopus (582) Google Scholar, 7.Furukawa T. Kozack C.A. Cepko C.L. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 3088-3093Crossref PubMed Scopus (310) Google Scholar) and 100% identity between 97 and 162 with the partial human RX sequence isolated by Mathers et al. (1.Mathers P.H. Grinberg A. Mahon K.A. Jamrich M. Nature. 1997; 387: 603-607Crossref PubMed Scopus (582) Google Scholar) (GenBank™ accession numberAF001911). The nucleotide sequence between 295 and 493 bp of the partial human hRx cDNA (1.Mathers P.H. Grinberg A. Mahon K.A. Jamrich M. Nature. 1997; 387: 603-607Crossref PubMed Scopus (582) Google Scholar) shares 96% homology with the 478 to 676-bp region of our hRx. The sequence between 1 and 294 bp of the partial human Rx cDNA (1.Mathers P.H. Grinberg A. Mahon K.A. Jamrich M. Nature. 1997; 387: 603-607Crossref PubMed Scopus (582) Google Scholar) shares 95% homology with a Int-1 sequence of our hRx-1 cDNA (see below). Thus, the human partial sequence of Rx published by the Mathers et al. (1.Mathers P.H. Grinberg A. Mahon K.A. Jamrich M. Nature. 1997; 387: 603-607Crossref PubMed Scopus (582) Google Scholar) is part of hRx-1 cDNA. Two additional clones similar to hRx (hRx-1 and hRx-2) were isolated from the same library by a DNA hybridization method using an hRx (cDNA) probe. Nucleotide sequence of hRx-1 (2,230 bp) and hRx-2 (1,846 bp) was identical in sequence to hRx except for a 303-bp insertion between bp 484/485 in hRx-1 and two insertions of 303 and 159 bp between bp 484/485 and bp 742/743, respectively, in hRx-2 (Fig. 1 B). We believe that these cDNAs might be products of alternative RNA splicing. A functional role of these two clones is presently unknown. It does, however, seem unlikely that these cDNA clones could encode a homeodomain-containing protein, since the first inserted sequence (Int-1) contains two in-frame stop codons upstream of the homeodomain, and the second insertion (Int-2) also contains two stop codons. We studied the expression pattern of RX in various tissues by immunoblot analysis. Specificity of the this procedure was demonstrated on duplicate immunoblots probed with the same RX-specific Abs (Fig.2 A) which had been preincubated with purified GST-RX (Fig. 2 B) or with preimmune serum (data not shown). Two predominant bands in the 37-kDa molecular mass region were detected in retina (Fig. 2 A), but only one of these was RX (Fig. 2 A, shown by anarrowhead) since this band could be eliminated by addition of GST-RX to anti-RX Ab (Fig. 2 B). This RX-specific band was also detected in iris (Fig. 2 A). The specificity of the RX Abs for GST-RX but not the related GST-CRX is shown in Fig.2 A. These results suggest that RX is present in neural retina and iris, but not detectable lens, brain, and liver. The expression pattern of RX in the retina was further investigated by immunohistochemistry using the affinity purified rabbit anti-RX Ab (1/500 dilution). This analysis revealed that RX was present in the outer nuclear layer (nucleus of photoreceptor cells), in addition, it was present in neuroretinal cells including ganglion cells and the inner nuclear layer (Fig. 3 A). In control experiments, RX Abs which had been preincubated with purified GST-RX failed to stain any of these cell types (Fig.3 B).Figure 3Immunohistochemistry. A, rat retinas were immunostained with RX-specific antibodies (1/500 dilution). B, retinas were immunostained with RX-specific antibodies (1/500 dilation) which had been preincubated with purified GST-RX (200 μg). The bar indicates 20 μm.View Large Image Figure ViewerDownload Hi-res image Download (PPT) We investigated the binding properties of RX to the PCE-1 element using an EMSA. Double-stranded oligonucleotides containing the PCE-1 element of the mouse arrestin gene (10.Kikuchi T. Raji K. Breitman M.L. Shinohara T. Mol. Cell. Biol. 1993; 13: 4400-4408Crossref PubMed Scopus (105) Google Scholar) and the mouse OTX element (m-OTX) (see Refs. 2.Chen S. Wang Q.L. Nie Z. Sun H. Lennon G. Copeland N.G. Gillbert D.J. Jenkins N.A. Zack D.J. Neuron. 1997; 19: 1017-1030Abstract Full Text Full Text PDF PubMed Scopus (575) Google Scholar and 3.Furukawa T. Morrow E.M. Cepko C.L. Cell. 1997; 91: 531-541Abstract Full Text Full Text PDF PubMed Scopus (716) Google Scholar and Table I) were 5′-end labeled with [32P]. Fusion proteins of GST with RX (GST-RX) or with the human CRX (GST-CRX) were produced in an E. coli expression system and purified by glutathione column chromatography. Strong binding was observed when the m-PCE-1 element was incubated with the GST-RX protein at higher concentrations (Fig.4 A). In contrast, less strong binding of GST-CRX to m-PCE-1 was observed. Conversely, binding was observed between m-OTX and GST-RX only at higher concentrations, but stronger binding was observed between m-OTX and GST-CRX at those concentrations. In the control experiments, GST bound to neither the m-PCE-1 site nor the m-OTX site. Binding of RX to the m-PCE-1 element was decreased significantly by a 40-fold molar excesses of unlabeled m-PCE-1 competitor, but was only slightly diminished by a 200-fold molar excesses of unlabeled m-OTX competitor (Fig. 4 B). Complex formation between RX and PCE-1 sites was unaffected by a large excess of an unlabeled, unrelated oligonucleotide containing the chicken ovalbumin upstream promoter transcription factor (COUP-TF) site. Conversely, binding of CRX to m-OTX was inhibited slightly by a large molar excess of unlabeled m-PCE-1, and strongly by a large molar excess of unlabeled of m-OTX, but was unaffected by the COUP competitor. These results indicated that the stronger binding was between m-PCE-1 and RX and between m-OTX and CRX, and that the affinity of CRX for m-PCE-1 and the affinity of RX for m-OTX are much weaker. We have therefore concluded that PCE-1 and OTX are the binding sites for RX and CRX, respectively. We used an antibody (Ab) supershifting technique in combination with EMSA to confirm that the PCE-1 elements bind to RX contained in retina extracts. In a previous publication (10.Kikuchi T. Raji K. Breitman M.L. Shinohara T. Mol. Cell. Biol. 1993; 13: 4400-4408Crossref PubMed Scopus (105) Google Scholar), when m-PCE-1 was incubated with bovine retinal nuclear extract, EMSA revealed a complex designated Bp1 (see also Fig. 5, lane 1, indicated by an arrow). Initially we generated complexes between m-PCE-1 and bovine nuclear extract followed by addition of Abs (Fig. 5, lanes 1 and 3, an arrow and an open arrowhead, respectively). Similarly, we generated complexes between m-PCE-1 and purified RX, then added RX-specific Abs (Fig. 5, lanes 4 and 5, an arrowheadand an open arrowhead, respectively). The RX-specific Abs recognized both purified GST-RX and RX from bovine nuclear extracts bound in PCE-1 complexes. The complexes formed between m-PCE-1 and purified GST-RX were smaller than those formed with the nuclear extract, but both of these complexes were supershifted by RX-specific Abs (Fig. 5, lanes 3 and 5, open arrowheads, respectively). We therefore concluded that the Bp1 complexes formed between bovine retina nuclear extract and the m-PCE-1 element contained RX factor. As reported previously (10.Kikuchi T. Raji K. Breitman M.L. Shinohara T. Mol. Cell. Biol. 1993; 13: 4400-4408Crossref PubMed Scopus (105) Google Scholar), m-PCE-1 and a bovine nuclear factor generated a second complex, Bp2 (Fig. 5, arrow). Interestingly, the Bp2 complex failed to supershift upon addition of RX-specific Abs suggesting that it does not contain RX. We speculated that the Bp2 may be composed of m-PCE-1 element and other homeodomain proteins such as CRX (2.Chen S. Wang Q.L. Nie Z. Sun H. Lennon G. Copeland N.G. Gillbert D.J. Jenkins N.A. Zack D.J. Neuron. 1997; 19: 1017-1030Abstract Full Text Full Text PDF PubMed Scopus (575) Google Scholar, 3.Furukawa T. Morrow E.M. Cepko C.L. Cell. 1997; 91: 531-541Abstract Full Text Full Text PDF PubMed Scopus (716) Google Scholar), Pax6 (6.Walther C. Gruss P. Development. 1991; 113: 1435-1449Crossref PubMed Google Scholar, 8.Hill R.E. Favor J. Hogan B.L. Ton C.C. Saunders G.F. Hanson I.M. Proseer J. Jordan T. Hastie N.D. van Heyningen" @default.
• W2039441672 created "2016-06-24" @default.
• W2039441672 creator A5005211896 @default.
• W2039441672 creator A5036383692 @default.
• W2039441672 creator A5062647435 @default.
• W2039441672 creator A5074767369 @default.
• W2039441672 creator A5081121459 @default.
• W2039441672 creator A5083968281 @default.
• W2039441672 date "2000-01-01" @default.
• W2039441672 modified "2023-10-03" @default.
• W2039441672 title "Both PCE-1/RX and OTX/CRX Interactions Are Necessary for Photoreceptor-specific Gene Expression" @default.
• W2039441672 cites W1512108330 @default.
• W2039441672 cites W1589588578 @default.
• W2039441672 cites W1965258786 @default.
• W2039441672 cites W1974792476 @default.
• W2039441672 cites W1978198515 @default.
• W2039441672 cites W2009716064 @default.
• W2039441672 cites W2011509827 @default.
• W2039441672 cites W2014908429 @default.
• W2039441672 cites W2019836905 @default.
• W2039441672 cites W2022682222 @default.
• W2039441672 cites W2025692747 @default.
• W2039441672 cites W2027066480 @default.
• W2039441672 cites W2055166643 @default.
• W2039441672 cites W2057002159 @default.
• W2039441672 cites W2058829111 @default.
• W2039441672 cites W2059344357 @default.
• W2039441672 cites W2072414883 @default.
• W2039441672 cites W2074455385 @default.
• W2039441672 cites W2076885024 @default.
• W2039441672 cites W2100247616 @default.
• W2039441672 cites W2103884152 @default.
• W2039441672 cites W2123315427 @default.
• W2039441672 cites W2161687343 @default.
• W2039441672 cites W2205162546 @default.
• W2039441672 cites W4323238746 @default.
• W2039441672 doi "https://doi.org/10.1074/jbc.275.2.1152" @default.
• W2039441672 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10625658" @default.
• W2039441672 hasPublicationYear "2000" @default.
• W2039441672 type Work @default.
• W2039441672 sameAs 2039441672 @default.
• W2039441672 citedByCount "129" @default.
• W2039441672 countsByYear W20394416722012 @default.
• W2039441672 countsByYear W20394416722013 @default.
• W2039441672 countsByYear W20394416722014 @default.
• W2039441672 countsByYear W20394416722015 @default.
• W2039441672 countsByYear W20394416722016 @default.
• W2039441672 countsByYear W20394416722017 @default.
• W2039441672 countsByYear W20394416722018 @default.
• W2039441672 countsByYear W20394416722019 @default.
• W2039441672 countsByYear W20394416722020 @default.
• W2039441672 countsByYear W20394416722021 @default.
• W2039441672 countsByYear W20394416722023 @default.
• W2039441672 crossrefType "journal-article" @default.
• W2039441672 hasAuthorship W2039441672A5005211896 @default.
• W2039441672 hasAuthorship W2039441672A5036383692 @default.
• W2039441672 hasAuthorship W2039441672A5062647435 @default.
• W2039441672 hasAuthorship W2039441672A5074767369 @default.
• W2039441672 hasAuthorship W2039441672A5081121459 @default.
• W2039441672 hasAuthorship W2039441672A5083968281 @default.
• W2039441672 hasBestOaLocation W20394416721 @default.
• W2039441672 hasConcept C104317684 @default.
• W2039441672 hasConcept C150194340 @default.
• W2039441672 hasConcept C185592680 @default.
• W2039441672 hasConcept C199360897 @default.
• W2039441672 hasConcept C41008148 @default.
• W2039441672 hasConcept C54355233 @default.
• W2039441672 hasConcept C70721500 @default.
• W2039441672 hasConcept C86803240 @default.
• W2039441672 hasConcept C90559484 @default.
• W2039441672 hasConcept C95444343 @default.
• W2039441672 hasConceptScore W2039441672C104317684 @default.
• W2039441672 hasConceptScore W2039441672C150194340 @default.
• W2039441672 hasConceptScore W2039441672C185592680 @default.
• W2039441672 hasConceptScore W2039441672C199360897 @default.
• W2039441672 hasConceptScore W2039441672C41008148 @default.
• W2039441672 hasConceptScore W2039441672C54355233 @default.
• W2039441672 hasConceptScore W2039441672C70721500 @default.
• W2039441672 hasConceptScore W2039441672C86803240 @default.
• W2039441672 hasConceptScore W2039441672C90559484 @default.
• W2039441672 hasConceptScore W2039441672C95444343 @default.
• W2039441672 hasIssue "2" @default.
• W2039441672 hasLocation W20394416721 @default.
• W2039441672 hasOpenAccess W2039441672 @default.
• W2039441672 hasPrimaryLocation W20394416721 @default.
• W2039441672 hasRelatedWork W1991523530 @default.
• W2039441672 hasRelatedWork W2002128513 @default.
• W2039441672 hasRelatedWork W2009966535 @default.
• W2039441672 hasRelatedWork W2020824267 @default.
• W2039441672 hasRelatedWork W2031436818 @default.
• W2039441672 hasRelatedWork W2057739827 @default.
• W2039441672 hasRelatedWork W2075354549 @default.
• W2039441672 hasRelatedWork W2088063203 @default.
• W2039441672 hasRelatedWork W2171277769 @default.
• W2039441672 hasRelatedWork W2092874662 @default.
• W2039441672 hasVolume "275" @default.
• W2039441672 isParatext "false" @default.
• W2039441672 isRetracted "false" @default.

• next