FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2039580924> ?p ?o ?g. }

• W2039580924 endingPage "1114" @default.
• W2039580924 startingPage "1103" @default.
• W2039580924 abstract "Asthma is a multifactorial disease influenced by genetic and environmental factors. In the past decade, several loci and >100 genes have been found to be associated with the disease in at least one population. Among these loci, region 12q13-24 has been implicated in asthma etiology in multiple populations, suggesting that it harbors one or more asthma susceptibility genes. We performed linkage and association analyses by transmission/disequilibrium test and case-control analysis in the candidate region 12q13-24, using the Sardinian founder population, in which limited heterogeneity of pathogenetic alleles for monogenic and complex disorders as well as of environmental conditions should facilitate the study of multifactorial traits. We analyzed our cohort, using a cutoff age of 13 years at asthma onset, and detected significant linkage to a portion of 12q13-24. We identified IRAK-M as the gene contributing to the linkage and showed that it is associated with early-onset persistent asthma. We defined protective and predisposing SNP haplotypes and replicated associations in an outbred Italian population. Sequence analysis in patients found mutations, including inactivating lesions, in the IRAK-M coding region. Immunohistochemistry of lung biopsies showed that IRAK-M is highly expressed in epithelial cells. We report that IRAK-M is involved in the pathogenesis of early-onset persistent asthma. IRAK-M, a negative regulator of the Toll-like receptor/IL-1R pathways, is a master regulator of NF-κB and inflammation. Our data suggest a mechanistic link between hyperactivation of the innate immune system and chronic airway inflammation and indicate IRAK-M as a potential target for therapeutic intervention against asthma. Asthma is a multifactorial disease influenced by genetic and environmental factors. In the past decade, several loci and >100 genes have been found to be associated with the disease in at least one population. Among these loci, region 12q13-24 has been implicated in asthma etiology in multiple populations, suggesting that it harbors one or more asthma susceptibility genes. We performed linkage and association analyses by transmission/disequilibrium test and case-control analysis in the candidate region 12q13-24, using the Sardinian founder population, in which limited heterogeneity of pathogenetic alleles for monogenic and complex disorders as well as of environmental conditions should facilitate the study of multifactorial traits. We analyzed our cohort, using a cutoff age of 13 years at asthma onset, and detected significant linkage to a portion of 12q13-24. We identified IRAK-M as the gene contributing to the linkage and showed that it is associated with early-onset persistent asthma. We defined protective and predisposing SNP haplotypes and replicated associations in an outbred Italian population. Sequence analysis in patients found mutations, including inactivating lesions, in the IRAK-M coding region. Immunohistochemistry of lung biopsies showed that IRAK-M is highly expressed in epithelial cells. We report that IRAK-M is involved in the pathogenesis of early-onset persistent asthma. IRAK-M, a negative regulator of the Toll-like receptor/IL-1R pathways, is a master regulator of NF-κB and inflammation. Our data suggest a mechanistic link between hyperactivation of the innate immune system and chronic airway inflammation and indicate IRAK-M as a potential target for therapeutic intervention against asthma. Asthma (MIM #600807) is a chronic inflammatory disease of bronchial epithelium and submucosa that leads to irreversible anatomical changes in bronchi and permanent impairment of lung function. Its prevalence in Western industrialized societies is now 5% and growing, with increasing associated mortality.1Cohn L Elias JA Chupp GL Asthma: mechanisms of disease persistence and progression.Annu Rev Immunol. 2004; 22: 789-815Crossref PubMed Scopus (677) Google Scholar, 2Masoli M Fabian D Holt S Beasley R Global Initiative for Asthma The global burden of asthma: executive summary of the GINA Dissemination Committee Report.Allergy. 2004; 59: 469-478Crossref PubMed Scopus (2365) Google Scholar Interest in finding etiologic factors has correspondingly intensified. Whereas the role of the immune system and of specific subsets of T-helper (Th) cells in the pathophysiology of asthma has been clearly established, the genes implicated in this disease are just beginning to be identified. Multiple genetic loci and several gene variants have been recently detected and inferred to contribute to allergic asthma.3Ober C Hoffjan S Asthma genetics 2006: the long and winding road to gene discovery.Genes Immun. 2006; 7: 95-100Crossref PubMed Scopus (502) Google Scholar For most of these genes, however, their relationship to the pathophysiology of asthma remains conjectural, and none appears to be directly involved in the activation of airway inflammatory processes or allergy. Replication of studies has also been difficult because of the genetic heterogeneity of asthma, the extreme variability in disease expression, the presence of phenocopies, and a marked variety of environmental influences. One approach to reducing heterogeneity in studies of multifactorial traits focuses on founder populations, which have grown from a few initial members to large modern populations without appreciable in-migration and of which Sardinia provides one of the most promising.4Laitinen T The value of isolated populations in genetic studies of allergic diseases.Curr Opin Allergy Clin Immunol. 2002; 2: 379-382Crossref PubMed Scopus (10) Google Scholar, 5Heutink P Oostra BA Gene finding in genetically isolated populations.Hum Mol Genet. 2002; 11: 2507-2515Crossref PubMed Scopus (87) Google Scholar For example, monogenic disorders such as β-thalassemia, Wilson’s disease, and autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy syndrome, as well as complex disorders like diabetes type I, show limited heterogeneity of pathogenetic alleles.6Cao A Gossens M Pirastu M Beta thalassaemia mutations in Mediterranean populations.Br J Haematol. 1989; 71: 309-312Crossref PubMed Scopus (90) Google Scholar, 7Loudianos G Dessi V Lovicu M Angius A Figus A Lilliu F De Virgiliis S Nurchi AM Deplano A Moi P et al.Molecular characterization of Wilson disease in the Sardinian population—evidence of a founder effect.Hum Mutat. 1999; 14: 294-303Crossref PubMed Scopus (124) Google Scholar, 8Rosatelli MC Meloni A Meloni A Devoto M Cao A Scott HS Peterson P Heino M Krohn KJ Nagamine K et al.A common mutation in Sardinian autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy patients.Hum Genet. 1998; 103: 428-434Crossref PubMed Scopus (208) Google Scholar, 9Cucca F Muntoni F Lampis R Frau F Argiolas L Silvetti M Angius E Cao A De Virgiliis S Congia M Combinations of specific DRB1, DQA1, DQB1 haplotypes are associated with insulin-dependent diabetes mellitus in Sardinia.Hum Immunol. 1993; 37: 85-94Crossref PubMed Scopus (117) Google Scholar The population of the island shares much the same environment, reducing nongenetic sources of variation as well. To elucidate the genetic components of asthma, we studied affected Sardinian families by linkage and association analysis at chromosome 12q13-24, a region previously implicated in asthma etiology in different populations.10Malerba G Lauciello MC Scherpbier T Trabetti E Galavotti R Cusin V Pescollderungg L Zanoni G Martinati LC Boner AL et al.Linkage analysis of chromosome 12 markers in Italian families with atopic asthmatic children.Am J Respir Crit Care Med. 2000; 162: 1587-1590Crossref PubMed Scopus (41) Google Scholar, 11Raby BA Silverman EK Lazarus R Lange C Kwiatkowski DJ Weiss ST Chromosome 12q harbors multiple genetic loci related to asthma and asthma-related phenotypes.Hum Mol Genet. 2003; 12: 1973-1979Crossref PubMed Scopus (53) Google Scholar Here, we report that variants in the interleukin-1 receptor associated kinase-M (IRAK-M; HUGO nomenclature IRAK3 [MIM *604459]) gene are associated with early-onset persistent asthma and indicate IRAK-M as a potential new target for therapeutic intervention against asthma and atopic diseases. Patients were recruited by the recovery of information from archives and ongoing clinical activities from all the four provinces of Sardinia, in proportions representative of the local population. Atopic asthmatic sibling pairs (sibs) and trios were collected over a period of 4 years, mainly from pediatric and pneumologic centers. To avoid phenocopies, all patients fulfilled the following criteria: Sardinian origin for at least 3 generations and age at visit >6 years. At the recruitment sessions, each subject was interviewed, disease status was ascertained by physical examination, permission was asked to access personal health records, and blood samples were collected. Each participant signed an informed consent form. All study methods have been approved by the local ethics committee (Azienda Sanitaria Locale number 8 protocol 24/Comitato Etico/02, authorization number 4737). Asthma was diagnosed by a pulmonary physician, in accordance with American Thoracic Society criteria.12National Institutes of Health/National, Heart, Lung, and Blood Institute, World Health Organization Global initiative for asthma. National Institutes of Health publication number 95-3659, Bethesda1995Google Scholar Pulmonary function was evaluated by spirometry: forced expiratory volume at the 1st s (FEV1) was expressed in liters/minute. A physician administered a questionnaire collecting clinical history and classifying asthma severity in four levels according to the World Health Organization guidelines (Global Initiative for Asthma). The use of asthma drugs and any other medication was recorded. Atopy was detected by positive skin testing to common inhalant allergens by standard methods. Patients with early onset were interviewed by a physician about persistency of asthma symptoms after the completion of puberty (18 years). The replication sample was composed of 345 unrelated individuals (67 cases and 278 healthy controls) selected from a cohort of 211 asthmatic families that has been described elsewhere.10Malerba G Lauciello MC Scherpbier T Trabetti E Galavotti R Cusin V Pescollderungg L Zanoni G Martinati LC Boner AL et al.Linkage analysis of chromosome 12 markers in Italian families with atopic asthmatic children.Am J Respir Crit Care Med. 2000; 162: 1587-1590Crossref PubMed Scopus (41) Google Scholar In particular, since information about age at disease onset was not available for this sample, we selected as cases all atopic individuals older than 18 years with persistency of asthma symptoms (persistent asthmatic cases). All families were ascertained at the Pediatric Clinic of the University of Verona and at the Bolzano Hospital. Phenotyping included interview of the individuals with a modified American Thoracic Society questionnaire, an asthma physician’s diagnosis, measurement of serum immunoglobulin E (IgE) levels, skin testing against a panel of allergens, and bronchial hyperresponsiveness testing with methacholine. Genomic DNA isolated from peripheral blood leukocytes was used for genotyping with both microsatellite and SNP markers. Microsatellite markers, including di-, tri-, and tetranucleotide repeats, were chosen from the Marshfield Center for Medical Genetics, The GDB Human Genome Database, and the Ensembl Genome Browser. All microsatellites were analyzed using the MegaBACE 1000 fluorescence-based genotyping methodology. Genotypes were scored using MegaBACE Genetic Profiler Software v1.5 (Amersham Biosciences). Two DNA standards, consisting of the CEPH control individual number 1347.02 (Applied Biosystems) and an internal DNA control, were incorporated in all the runs to verify accuracy of typing. SNP markers were selected from dbSNP, The SNP Consortium, and Ensembl Genome Browser. SNP-based genotyping was performed after dot-blot preparation of amplified DNA with use of sequence-specific oligonucleotide probes. All markers were PCR amplified and genotyped a second time when failures occurred during the first round of amplification. Data quality of microsatellite and SNP genotypes was established by three methods: reproducibility of control DNA samples, expected Mendelian inheritance of alleles within a family, and tests of Hardy-Weinberg equilibrium. These last analyses were performed with the PEDSTATS program with the use of unrelated individuals (P>.05).13Wigginton JE Abecasis GR PEDSTATS: descriptive statistics, graphics and quality assessment for gene mapping data.Bioinformatics. 2005; 21: 3445-3447Crossref PubMed Scopus (330) Google Scholar Overall, we obtained a rate of genotyping efficiency >96% in the first step and reached 99.8% in the second. Mutation analysis of all exons and intron/exon boundaries was performed bidirectionally by direct sequencing of PCR products. In brief, for each gene, we first sequenced a subgroup of affected individuals by selecting one affected individual per informative family (the proband). Every mutation was first confirmed in the patient by resequencing, and then its presence was ascertained in the remaining family members (sibs and both parents). Mutations were also checked to verify compatibility with Mendelian inheritance. Confirmed mutations were then analyzed in the entire sample of affected families (294 families) and in 200 healthy controls by dot-blot analysis with the use of allele-specific oligonucleotide probes. Each sample was amplified using the GeneAmp PCR System 9700 Thermal Cycler (Applied Biosystems) in accordance with the manufacturer’s conditions. Sequencing reactions were performed using the ABI PRISM BigDye chemistry BigDye Terminator v3.1 Cycle Sequencing Kit and the automated sequencer ABI PRISM 3100 (Applied Biosystems), in accordance with the manufacturer’s recommendations, and were visualized with the DNA Genetic Analyzer software (ABI PRISM 3100 Genetic Analyzer Data Collection Software [Applied Biosystems]). Sequences were aligned and compared with consensus from the human genome databases (National Center for Biotechnology Information and UCSC Genome Browser). Multipoint linkage analyses were calculated by maximum-likelihood estimate of identical-by-descent (IBD) sharing for affected sib pairs with use of the GENEHUNTER program v2.1.14Kruglyak L Daly MJ Reeve-Daly MP Lander ES Parametric and nonparametric linkage analysis: a unified multipoint approach.Am J Hum Genet. 1996; 58: 1347-1363PubMed Google Scholar LOD scores were computed using the possible triangle method, and no assumption was made about mode of inheritance. Sibships containing more than one affected sib pair (nine families) were considered as “all independent pairs.” For the analysis on the stratified sample, multipoint linkage analysis was conducted on two subgroups of affected sib pairs stratified for age at asthma onset. The early-onset subgroup contains sib pairs concordant for age at asthma onset (≤13 years), whereas the group with age at onset >13 years includes sibs both concordant and discordant for onset. The order of microsatellites and the genetic intermarker distances were derived using CRIMAP v2.4,15Lander ES Green P Construction of multilocus genetic linkage maps in humans.Proc Natl Acad Sci USA. 1987; 84: 2363-2367Crossref PubMed Scopus (1165) Google Scholar after physical localization data was checked with the Ensembl Genome Browser. To obtain a 95% CI in localizing susceptibility genes on 12q, the GENEFINDER program was used.16Glidden DV Liang KY Chiu YF Pulver AE Multipoint affected sibpair linkage methods for localizing susceptibility genes of complex diseases.Genet Epidemiol. 2003; 24: 107-117Crossref PubMed Scopus (26) Google Scholar It applies generalized estimating equations to estimate the location of a susceptibility gene on the basis of IBD sharing of multiple markers by affected sib pairs and can incorporate covariate information on sib pairs, such as age at onset. To assess the effect of the risk haplotype on linkage, we also used the genotype-IBD sharing test (GIST),17Li C Scott LJ Boehnke M Assessing whether an allele can account in part for a linkage signal: the Genotype-IBD Sharing Test (GIST).Am J Hum Genet. 2004; 74: 418-431Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar which assigns family-specific weights on the basis of the genotype of the affected family members and the model of interest (dominant, recessive, or additive) and tests for correlations between these weights and family-based IBD sharing (NPL score). Association analyses of SNPs with asthma were performed by both the transmission/disequilibrium test (TDT) and case-control analysis. For the TDT, only trios consisting of father, mother, and one affected son were included in the analysis. To assess significance of the TDT results, we derived empirical P values by a permutation procedure that used the same genotype data as our sample. Each permuted data set was formed by randomly reassigning alleles as transmitted or untransmitted. Haploview was used to investigate the linkage disequilibrium (LD) block structure and to identify tag SNPs and distribution of haplotypes across the IRAK-M gene and the flanking genomic regions.18Barrett JC Fry B Maller J Daly MJ Haploview: analysis and visualization of LD and haplotype maps.Bioinformatics. 2005; 21: 263-265Crossref PubMed Scopus (11426) Google Scholar To determine haplotype-transmission rates from parents to affected siblings, we used the UNPHASED program.19Dudbridge F Pedigree disequilibrium tests for multilocus haplotypes.Genet Epidemiol. 2003; 25: 115-121Crossref PubMed Scopus (1044) Google Scholar The case-control study of the Sardinian sample was performed by comparing allele and genotype distribution of one affected persistent case per family with those of 460 healthy subjects. Logistic-regression analyses were used to calculate odds ratios (ORs) with 95% CI and corresponding P values for all analyzed SNPs, with age and sex controlled for as covariates. P values were adjusted for multiple testing by Bonferroni correction, to maintain an overall error rate of 0.05. We also performed an analysis with the THESIAS program,20Tregouet DA Escolano S Tiret L Mallet A Golmard JL A new maximum likelihood algorithm for haplotype-based association analysis: the Stochastic-EM algorithm.Ann Hum Genet. 2004; 68: 165-177Crossref PubMed Scopus (245) Google Scholar to test covariate-adjusted haplotype effects on disease. THESIAS was also used to test for deviation from additivity (on a log scale) of haplotype effects by a likelihood-ratio test. For the Italian subjects, the difference of distributions between cases and controls of genotypic and allele frequencies was assessed by the Fisher exact test. In this sample, the presence of population stratification was excluded by the method proposed by Pritchard and colleagues and was implemented in the program STRUCTURE.21Pritchard JK Stephens M Donnelly P Inference of population structure using multilocus genotype data.Genetics. 2000; 155: 945-959PubMed Google Scholar In brief, 400 unrelated individuals selected from the sample of asthmatic families were studied using 53 unlinked markers. Several runs of the program were performed under the hypothesis of one, two, three, four, or five clusters in the population. Results showed that the model including only one cluster is much more likely than any other model, indicating that the individuals studied are genetically homogeneous. Lung biopsies were fixed in 10% formalin, were embedded in paraffin, were serially sectioned at 5 μm, and were processed for immunohistochemistry by standard methods with the following antibodies: rabbit polyclonal anti-IRAK-M (Cell Signaling), mouse monoclonal anti–thyroid transcription factor-1 (TTF1) (Dako), and mouse monoclonal anti-phospho-NF-κB p65 (Cell Signaling). Immunoperoxidase staining was performed with the biotin/streptavidin–based LSAB2 system (Dako). Nuclei were counterstained with hematoxylin. Photographs were taken using a Leica DMR microscope, with use of the program Leica IM50 Image Manager v1.2 (Leica Microsystems). Our initial analysis of asthma susceptibility genes in the candidate region of chromosome 12q13-24 was conducted with 121 affected sib pairs selected from 100 families coming from all four provinces of Sardinia (table 1). Multipoint nonparametric affected sib pair analysis in this cohort showed suggestive evidence of linkage at marker D12S75 (fig. 1A, and see table A1 for the markers used). To reduce possible sources of variation and to increase the power to detect linkage, we repeated the analysis after stratification of our sample population by age at asthma onset. We arbitrarily selected a pubertal cutoff age of 13 years, on the basis of clinical observations pointing to the existence of phenotypical heterogeneity in early- versus late-onset forms of the disease (also see the “Discussion” section). Linkage analysis revealed that the 12q13-24 region is significantly linked to asthma in a subgroup of 60 families (66 sibs) with exclusively early-onset cases, yielding a multipoint LOD score of 3.56 (P=5.2×10−5) between markers D12S75 and D12S335. By contrast, no evidence of linkage was detected in the families with at least one patient with age at asthma onset >13 years (fig. 1A and table 1). No bias for geographic origin within Sardinia was observed between the two subgroups. Analysis with the GENEFINDER program16Glidden DV Liang KY Chiu YF Pulver AE Multipoint affected sibpair linkage methods for localizing susceptibility genes of complex diseases.Genet Epidemiol. 2003; 24: 107-117Crossref PubMed Scopus (26) Google Scholar in the whole sample, with age at onset incorporated as a covariate, showed that the most likely location for one or more genes predisposing an individual to asthma lay within a 95% CI of 10.5 cM centered 2.7 cM distal to D12S75 (P=.001) (fig. 1A).Table 1Sardinian Families with Asthma Studied by Multipoint Linkage Analysis and TDTLinkage AnalysisTDTCharacteristicTotal SampleAge Onset ≤13 YearsaSib pairs in the early-onset group (≤13 years) are concordant for age at asthma onset.Age Onset >13 YearsbThe group with age at onset >13 years includes sibs both concordant and discordant for onset.Total SamplecOnly one affected sibling (the proband) is included in TDT analysis.Early-Onset Persistent AsthmacOnly one affected sibling (the proband) is included in TDT analysis.Subjects (n)4102431671,100453No. of familiesdFamilies were selected from all four provinces of Sardinia, in proportions representative of the local population. (no. of sibs)100 (121)60 (66)40 (55)294139Males (%)6169435663Age at asthma onset (years)eData are reported as means±SDs.10.69±10.765.13±3.6118.41±12.5110.15±10.824.79±3.59Age (years)eData are reported as means±SDs.21.86±12.3715.51±6.4730.76±13.1820.39±12.1015.95±8.22a Sib pairs in the early-onset group (≤13 years) are concordant for age at asthma onset.b The group with age at onset >13 years includes sibs both concordant and discordant for onset.c Only one affected sibling (the proband) is included in TDT analysis.d Families were selected from all four provinces of Sardinia, in proportions representative of the local population.e Data are reported as means±SDs. Open table in a new tab Table A1Microsatellite Markers Genotyped for Multipoint Linkage Analysis on Chromosome 12q13-24Primer (3′–5′)MarkerSex-Averaged Map (Kosambi cM)FluorophoreForwardReverseD12S297.0HEXGTTTGGTATTGGAGTTTTCAGAAATCATCAGTGGAGTTAGCAD12S17242.4TETCTCTGGAGGCTGAGGTGGATCCGTGCTGGTTCTATCTGTGTAD12S726.2TETCATCATCCCATGGTCGAAGGAGAGTAGGTTCCTTATCCTGGGD12S837.7TETTTTTTGGAAGTCTATCAATTTGATAGCAGAGAAAGCCAATTCAD12S37112.3FAMAAACCACACAAAGCCTCCAGTGATGACAGGCTCAAGCGD12S7517.6FAMGTGGCTCTAAAGCATGACCAATTTCTTCCACCTGCATGATD12S33522.2NEDTCATCCAGGCTTCACCGTTTCTTTGGCAAGGACAGACACAIFNG24.3HEXGCTGTTATAATTATAGCTGTCGTTTCTTCTACTGTGCCTTCCTGTAGD12S4326.0FAMAATGTCCTTGTACTTAGGATCACTTAATATCTCAATGTATACD12S104028.4TETTATGACAGGATGAACAAAAACGAAATTGAATTTGATTTCTTCATAGCD12S105229.9HEXATAGACAGGCTGGATAGATAGACGAGTGTGATATGAATAATGAGCTGCD12S32632.3HEXCCCAGCAGTGCTAGTGTTGAGTTTCTTGGGCTAGGGTGGAGAATCAAD12S106439.6TETACTACTCCAAGGTTCCAGCCAATATTGACTTTCTCTTGCTACCCD12S31140.9HEXCCAAACATTAACTGTTCCCGTTTCTTGTGCCCTGAGCAACTGD12S130044.6HEXCCTCACACAATGTTGTAAGGGTGTAACATCCGTGATTAAAATAGCPAH48.6TETGCCAGAACAACTGCTGGTTCAATCATAAGTGTTCCCAGACD12S7854.7FAMCTTTGCAGCACCATGTATTTACTGCTGGCTTTAACAGAAA Open table in a new tab The 10.5-cM region of the 95% CI for estimated gene location contains the cytokine genes interferon gamma (IFNG), interleukin 22 (IL22), and interleukin 26 (IL26), which were previously implicated in asthma (see fig. 1B). Sequence analysis of all the exons as well as the intron/exon boundaries of these genes in the patients with asthma chosen as the most informative for linkage revealed no associated variation (data not shown). On the basis of its function and possible relevance to asthma, we turned to IRAK-M, the other well-known gene located within the linkage peak. IRAK-M is one of the four IRAK proteins that mediate signal transduction of the Toll-like receptor (TLR)/IL-1R family in host defense and inflammatory responses, acting as a negative regulator.22Janssens S Beyaert R Functional diversity and regulation of different interleukin-1 receptor-associated kinase (IRAK) family members.Mol Cell. 2003; 11: 293-302Abstract Full Text Full Text PDF PubMed Scopus (452) Google Scholar, 23Akira S Takeda K Toll-like receptor signalling.Nat Rev Immunol. 2004; 4: 499-511Crossref PubMed Scopus (6241) Google Scholar, 24Wesche H Gao X Li X Kirschning CJ Stark GR Cao Z IRAK-M is a novel member of the Pelle/interleukin-1 receptor-associated kinase (IRAK) family.J Biol Chem. 1999; 274: 19403-19410Crossref PubMed Scopus (328) Google Scholar, 25Kobayashi K Hernandez LD Galan JE Janeway Jr, CA Medzhitov R Flavell RA IRAK-M is a negative regulator of Toll-like receptor signaling.Cell. 2002; 110: 191-202Abstract Full Text Full Text PDF PubMed Scopus (1095) Google Scholar TLRs are key participants in lung host defense and in the regulation of the Th1/Th2 balance and are thus thought to have a major impact on Th2-biased allergic diseases like asthma.26El Biaze M Boniface S Koscher V Mamessier E Dupuy P Milhe F Ramadour M Vervloet D Magnan A T cell activation, from atopy to asthma: more a paradox than a paradigm.Allergy. 2003; 58: 844-853Crossref PubMed Scopus (89) Google Scholar, 27Basu S Fenton MJ Toll-like receptors: function and roles in lung disease.Am J Physiol Lung Cell Mol Physiol. 2004; 286: L887-L892Crossref PubMed Scopus (164) Google Scholar To look for association, we performed a TDT, using 22 SNPs distributed across a region of 387 kb spanning the IRAK-M gene in an extended sample of 294 families with asthma (100 from the initial linkage analysis and 194 additional families recruited later) (see table 1). We conducted the analysis by stratifying the families according to the age at asthma onset, as described above. Strong evidence of association was detected only in the subgroup including subjects with early-onset persistent asthma (139 families). We identified seven SNPs with significant P values even after correction for multiple testing (fig. 1C and table A2). Four SNPs mapped inside the IRAK-M gene (rs1882200, rs11465955, rs2293657, and rs1821777), whereas the remaining three (rs10878378, rs1177578, and rs1168770) were several kilobases upstream. Unlike those in the IRAK-M gene, these SNPs showed no replicated significance in a second population or in case-control studies (see below), and their apparent association with asthma is likely a consequence of LD. Indeed, a disequilibrium estimate of D′≥0.70 defines a single 138-kb haplotype block containing the entire IRAK-M gene (fig. 1C). In this interval, we identified four common haplotypes tagged by six SNPs, which captured most of the genetic variation in this area of the genome. The most frequent haplotypes (GGGTAT and GCACGC) were significantly over- and undertransmitted, respectively, to early-onset persistent asthmatic patients (empirical P=.0011 and P=.0282, respectively) (see table A2).Table A2Results of Association Analysis by TDT in Trios with Early-Onset Persistent Asthma, with Use of 22 SNPs in the Genomic Region Spanning IRAK-MSNP or HaplotypeaSNPs highlighted in bold italics are within the IRAK-M gene. Four haplotypes identified by six tag SNPs (rs2870784, rs1177578, rs2141709, rs11465955, rs1624395, and rs1370128) are shown at the bottom. Only haplotypes with frequency >0.05 are shown.FrequencybFrequency of minor alleles of SNPs and haplotypes.T:UcT:U denotes number of transmitted versus untransmitted minor alleles.PdP value in bold indicates P<.05.Empirical P (105 Permutations)rs7970350.39830:42.1572.8416rs949911.14225:27.78151.0000rs6581660.27348:34.1220.7359rs11836463.24142:34.3587.9904rs2870784.17130:24.4142.9984rs10878378.41325:59.0002.0018rs1177578.41327:66.0000.0003rs1168754.16727:23.57161.0000rs2141709.31723:45.0076.0726rs1168770.41427:62.0002.0017rs2701652.18025:23.77281.0000rs1732886.18126:261.00001.0000rs1882200.39660:30.0007.0094rs11465955.39158:28.0012.0113rs2293657.39258:27.0007.0063rs1821777.39855:29.0045.0294rs1624395.45147:29.0389.3453rs1370128.47149:32.0489.4524rs2118137.32446:50.68301.0000rs289068.23234:341.00001.0000rs3741604.33838:46.3827.9945rs1168314.35038:52.1400.7785GGGTAT.38561:28.0005.0011GCACGC.27723:46.0057.0282TGGCGC.16531:22.2163.8403GCGCAT.0577:16.0587.3274a SNPs highlighted in bold italics are within the IRAK-M gene. Four haplotypes identified by six tag SNPs (rs2870784, rs1177578, rs2141709, rs11465955, rs1624395, and rs1370128) are shown at the bottom. Only haplotypes with frequency >0.05 are shown.b Fr" @default.
• W2039580924 created "2016-06-24" @default.
• W2039580924 creator A5000752964 @default.
• W2039580924 creator A5002764986 @default.
• W2039580924 creator A5003774733 @default.
• W2039580924 creator A5004204696 @default.
• W2039580924 creator A5007008917 @default.
• W2039580924 creator A5011868322 @default.
• W2039580924 creator A5012121613 @default.
• W2039580924 creator A5014755474 @default.
• W2039580924 creator A5015332898 @default.
• W2039580924 creator A5015857923 @default.
• W2039580924 creator A5019161228 @default.
• W2039580924 creator A5024004432 @default.
• W2039580924 creator A5024038810 @default.
• W2039580924 creator A5028387948 @default.
• W2039580924 creator A5028411448 @default.
• W2039580924 creator A5034327821 @default.
• W2039580924 creator A5036320059 @default.
• W2039580924 creator A5037106433 @default.
• W2039580924 creator A5037463942 @default.
• W2039580924 creator A5046817644 @default.
• W2039580924 creator A5047397152 @default.
• W2039580924 creator A5050507111 @default.
• W2039580924 creator A5055674298 @default.
• W2039580924 creator A5059607511 @default.
• W2039580924 creator A5061949364 @default.
• W2039580924 creator A5062254229 @default.
• W2039580924 creator A5068148000 @default.
• W2039580924 creator A5068408738 @default.
• W2039580924 creator A5069995140 @default.
• W2039580924 creator A5071085312 @default.
• W2039580924 creator A5071740872 @default.
• W2039580924 creator A5072787885 @default.
• W2039580924 creator A5076593030 @default.
• W2039580924 creator A5079340049 @default.
• W2039580924 creator A5080750993 @default.
• W2039580924 creator A5081270721 @default.
• W2039580924 creator A5083872776 @default.
• W2039580924 creator A5085429895 @default.
• W2039580924 creator A5085568887 @default.
• W2039580924 creator A5086640673 @default.
• W2039580924 creator A5090272721 @default.
• W2039580924 creator A5090642693 @default.
• W2039580924 date "2007-06-01" @default.
• W2039580924 modified "2023-10-11" @default.
• W2039580924 title "IRAK-M Is Involved in the Pathogenesis of Early-Onset Persistent Asthma" @default.
• W2039580924 cites W1873495658 @default.
• W2039580924 cites W1968094755 @default.
• W2039580924 cites W1975373828 @default.
• W2039580924 cites W1978402197 @default.
• W2039580924 cites W1993997407 @default.
• W2039580924 cites W1998158007 @default.
• W2039580924 cites W2004465286 @default.
• W2039580924 cites W2007292583 @default.
• W2039580924 cites W2010388697 @default.
• W2039580924 cites W2015849111 @default.
• W2039580924 cites W2024718596 @default.
• W2039580924 cites W2025765618 @default.
• W2039580924 cites W2034315431 @default.
• W2039580924 cites W2038542042 @default.
• W2039580924 cites W2043182417 @default.
• W2039580924 cites W2043990114 @default.
• W2039580924 cites W2047078884 @default.
• W2039580924 cites W2063214912 @default.
• W2039580924 cites W2064434771 @default.
• W2039580924 cites W2066608222 @default.
• W2039580924 cites W2076551734 @default.
• W2039580924 cites W2077448009 @default.
• W2039580924 cites W2082966751 @default.
• W2039580924 cites W2087541775 @default.
• W2039580924 cites W2093713190 @default.
• W2039580924 cites W2095241809 @default.
• W2039580924 cites W2098126593 @default.
• W2039580924 cites W2110844358 @default.
• W2039580924 cites W2113624460 @default.
• W2039580924 cites W2118477852 @default.
• W2039580924 cites W2134204376 @default.
• W2039580924 cites W2141150979 @default.
• W2039580924 cites W2146934844 @default.
• W2039580924 cites W2147351691 @default.
• W2039580924 cites W2162530578 @default.
• W2039580924 cites W2164692566 @default.
• W2039580924 cites W2164710696 @default.
• W2039580924 cites W4245422493 @default.
• W2039580924 cites W4248219898 @default.
• W2039580924 doi "https://doi.org/10.1086/518259" @default.
• W2039580924 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/1867098" @default.
• W2039580924 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17503328" @default.
• W2039580924 hasPublicationYear "2007" @default.
• W2039580924 type Work @default.
• W2039580924 sameAs 2039580924 @default.
• W2039580924 citedByCount "142" @default.
• W2039580924 countsByYear W20395809242012 @default.
• W2039580924 countsByYear W20395809242013 @default.
• W2039580924 countsByYear W20395809242014 @default.
• W2039580924 countsByYear W20395809242015 @default.
• W2039580924 countsByYear W20395809242016 @default.

• next