FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2039836699> ?p ?o ?g. }

• W2039836699 endingPage "22678" @default.
• W2039836699 startingPage "22667" @default.
• W2039836699 abstract "To dissect the cis-regulatory elements of the murine Msx-1 promoter, which lacks a conventional TATA element, a putative Msx-1 promoter DNA fragment (from −1282 to +106 base pairs (bp)) or its congeners containing site-specific alterations were fused to luciferase reporter and introduced into NIH3T3 and C2C12 cells, and the expression of luciferase was assessed in transient expression assays. The functional consequences of the sequential 5′ deletions of the promotor revealed that multiple positive and negative regulatory elements participate in regulating transcription of theMsx-1 gene. Surprisingly, however, the optimal expression of Msx-1 promoter in either NIH3T3 or C2C12 cells required only 165 bp of the upstream sequence to warrant detailed examination of its structure. Therefore, the functional consequences of site-specific deletions and point mutations of the cis-acting elements of the minimalMsx-1 promoter were systematically examined. Concomitantly, potential transcriptional factor(s) interacting with thecis-acting elements of the minimal promoter were also studied by gel electrophoretic mobility shift assays and DNase I footprinting. Combined analyses of the minimal promoter by DNase I footprinting, electrophoretic mobility shift assays, and super shift assays with specific antibodies revealed that 5′-flanking regions from −161 to −154 and from −26 to −13 of the Msx-1 promoter contains an authentic E box (proximal E box), capable of binding a protein immunologically related to the upstream stimulating factor 1 (USF-1) and a GC-rich sequence motif which can bind to Sp1 (proximal Sp1), respectively. Additionally, we observed that the promoter activation was seriously hampered if the proximal E box was removed or mutated, and the promoter activity was eliminated completely if the proximal Sp1 site was similarly altered. Absolute dependence of theMsx-1 minimal promoter on Sp1 could be demonstrated by transient expression assays in the Sp1-deficient Drosophilacell line cotransfected with Msx-1-luciferase and an Sp1 expression vector pPacSp1. The transgenic mice embryos containing −165/106-bp Msx-1 promoter-LacZ DNA in their genomes abundantly expressed β-galactosidase in maxillae and mandibles and in the cellular primordia involved in the formation of the meninges and the bones of the skull. Thus, the truncated murine Msx-1promoter can target expression of a heterologous gene in the craniofacial tissues of transgenic embryos known for high level of expression of the endogenous Msx-1 gene and found to be severely defective in the Msx-1 knock-out mice. To dissect the cis-regulatory elements of the murine Msx-1 promoter, which lacks a conventional TATA element, a putative Msx-1 promoter DNA fragment (from −1282 to +106 base pairs (bp)) or its congeners containing site-specific alterations were fused to luciferase reporter and introduced into NIH3T3 and C2C12 cells, and the expression of luciferase was assessed in transient expression assays. The functional consequences of the sequential 5′ deletions of the promotor revealed that multiple positive and negative regulatory elements participate in regulating transcription of theMsx-1 gene. Surprisingly, however, the optimal expression of Msx-1 promoter in either NIH3T3 or C2C12 cells required only 165 bp of the upstream sequence to warrant detailed examination of its structure. Therefore, the functional consequences of site-specific deletions and point mutations of the cis-acting elements of the minimalMsx-1 promoter were systematically examined. Concomitantly, potential transcriptional factor(s) interacting with thecis-acting elements of the minimal promoter were also studied by gel electrophoretic mobility shift assays and DNase I footprinting. Combined analyses of the minimal promoter by DNase I footprinting, electrophoretic mobility shift assays, and super shift assays with specific antibodies revealed that 5′-flanking regions from −161 to −154 and from −26 to −13 of the Msx-1 promoter contains an authentic E box (proximal E box), capable of binding a protein immunologically related to the upstream stimulating factor 1 (USF-1) and a GC-rich sequence motif which can bind to Sp1 (proximal Sp1), respectively. Additionally, we observed that the promoter activation was seriously hampered if the proximal E box was removed or mutated, and the promoter activity was eliminated completely if the proximal Sp1 site was similarly altered. Absolute dependence of theMsx-1 minimal promoter on Sp1 could be demonstrated by transient expression assays in the Sp1-deficient Drosophilacell line cotransfected with Msx-1-luciferase and an Sp1 expression vector pPacSp1. The transgenic mice embryos containing −165/106-bp Msx-1 promoter-LacZ DNA in their genomes abundantly expressed β-galactosidase in maxillae and mandibles and in the cellular primordia involved in the formation of the meninges and the bones of the skull. Thus, the truncated murine Msx-1promoter can target expression of a heterologous gene in the craniofacial tissues of transgenic embryos known for high level of expression of the endogenous Msx-1 gene and found to be severely defective in the Msx-1 knock-out mice. Homeobox (Hox) genes of vertebrates are closely related in sequence and genomic organization to the homeotic genes ofDrosophila. Most vertebrate Hox genes are located in four unique clusters in the genome (e.g. HoxA,HoxB, HoxC, and HoxD complexes), each cluster consisting of about 10 genes; there is striking correlation between the linear order of Hox genes on the chromosome and their regional expression in the developing embryo (1Manak, J. R., and Scott, M. P. (1994)Development (suppl.), 61–71.Google Scholar, 2Carroll S.B. Nature. 1995; 376: 479-485Crossref PubMed Scopus (554) Google Scholar). In contrast, the members of the Msx class of hox genes, which also share remarkable homology to the msh gene ofDrosophila, are found physically unlinked in the vertebrate genome (3Holland, P. W. H., Garcia-Fernandez, J., Williams, N. A., and Sidow, A. (1994) Development (suppl.), 125–133.Google Scholar, 4Davidson D. Trends Genet. 1995; 11: 405-411Abstract Full Text PDF PubMed Scopus (309) Google Scholar). Although Hox genes encode transcription factors, characterized by the presence of a highly conserved 60-amino acid-long helix-turn-helix DNA binding domain, the homeodomain, the downstream genetic targets of their regulation, and the underlying molecular mechanisms of their action are only beginning to be unraveled (5Mann R.S. Bioassays. 1995; 17: 855-863Crossref PubMed Scopus (144) Google Scholar, 6Laughon A. Biochemistry. 1991; 30: 11357-11367Crossref PubMed Scopus (260) Google Scholar, 7Gehring W.J. Qian Y.Q. Billeter M. Furukubo-Tokunaga K. Schier A.F. Resendez-Perez D. Affolter M. Otting G. Wüthrich K. Cell. 1994; 78: 211-223Abstract Full Text PDF PubMed Scopus (702) Google Scholar). In the developing embryo, Hox genes play a central role in positional specification, pattern formation, and organogenesis; it is thought that inductive interactions among the various cell layers, mediated through the action of intercellular ligands with their receptors, and a cascade of signaling events regulate the temporal and spatial expression of Hox genes (4Davidson D. Trends Genet. 1995; 11: 405-411Abstract Full Text PDF PubMed Scopus (309) Google Scholar, 8Izpisúa-Belmonte J.C. Duboule D. Dev. Biol. 1992; 152: 26-36Crossref PubMed Scopus (87) Google Scholar, 9Muneoka K. Sassoon D. Dev. Biol. 1992; 152: 37-49Crossref PubMed Scopus (87) Google Scholar, 10Kessel M. Gruss P. Science. 1990; 249: 4374-4379Crossref Scopus (455) Google Scholar, 11Gehring W. Trends Biochem. Sci. 1992; 17: 277-280Abstract Full Text PDF PubMed Scopus (120) Google Scholar, 12McGinnis W. Krumlauf R. Cell. 1992; 68: 283-302Abstract Full Text PDF PubMed Scopus (2221) Google Scholar, 13Krumlauf R. Cell. 1994; 78: 191-201Abstract Full Text PDF PubMed Scopus (1749) Google Scholar, 14Kenyon C. Cell. 1994; 78: 175-180Abstract Full Text PDF PubMed Scopus (101) Google Scholar, 15Bienz M. Trends Genet. 1994; 10: 22-26Abstract Full Text PDF PubMed Scopus (160) Google Scholar). Inappropriate ectopic expression of Hox genes or their elimination by genetic “knock-out” leads to severe developmental anomalies (16Krumlauf R. Trends Genet. 1993; 9: 106-112Abstract Full Text PDF PubMed Scopus (203) Google Scholar, 17Dolle P. Dierich A. LeMeur M. Schimmang T. Schuhbaur B. Chambon P. Duboule D. Cell. 1993; 75: 431-441Abstract Full Text PDF PubMed Scopus (401) Google Scholar, 18Dolle P. Lufkin T. Krumlauf R. Mark M. Duboule D. Chambon P. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 7666-7670Crossref PubMed Scopus (127) Google Scholar). Hox genes Msx-1 and Msx-2, the best studied members of the Msx family, have been shown to be expressed most conspicuously in the areas of epithelial-mesenchymal interactions (4Davidson D. Trends Genet. 1995; 11: 405-411Abstract Full Text PDF PubMed Scopus (309) Google Scholar). High levels of Msx-1 gene expression observed in the developing limb bud (19Hill R.E. Jones P.F. Rees A.R. Sime C.M. Justice M.J. Copeland N.G. Jenkins N.A. Graham E. Davidson D.R. Genes Dev. 1989; 3: 26-37Crossref PubMed Scopus (331) Google Scholar, 20Robert B. Sassoon D. Jacq B. Gehring W. Buckingham M. EMBO J. 1989; 8: 91-100Crossref PubMed Scopus (294) Google Scholar, 21Mackenzie A. Ferguson M.W.J. Sharpe P.T. Development. 1991; 113: 601-611PubMed Google Scholar, 22Su M.W. Suzuki H.R. Solursh M. Ramirez F. Development. 1991; 111: 1179-1187Crossref PubMed Google Scholar, 23Robert B. Lyons G. Simandl B.K. Kuroiwa A. Buckingham M. Genes Dev. 1991; 5: 2363-2374Crossref PubMed Scopus (142) Google Scholar, 24Takahashi Y. LeDouarin N. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 7482-7486Crossref PubMed Scopus (81) Google Scholar, 25Bell J.R. Noveen A. Liu Y.H. Ma L. Dobias S. Kundu R. Luo W. Xia Y. Lusis A.J. Snead M.L. Maxson R. Genomics. 1993; 16: 123-131Crossref PubMed Scopus (58) Google Scholar, 26Holland P.W.H. Gene. 1991; 98: 253-257Crossref PubMed Scopus (99) Google Scholar), regenerating limbs (27Simon H.G. Nelson C. Goff D. Laufer E. Morgan B.A. Tabin C. Dev. Dyn. 1995; 202: 1-12Crossref PubMed Scopus (105) Google Scholar) or fins (28Akimenko M.A. Johnson S.L. Westerfield M. Ekker M. Development. 1995; 121: 347-357PubMed Google Scholar), developing eyes (29Monaghan A.P. Davidson D.R. Sime C. Graham E. Baldock R. Bhattacharya S.S. Hill R.E. Development. 1991; 112: 1053-1061PubMed Google Scholar, 30Levine E.M. Schechter N. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 2729-2733Crossref PubMed Scopus (49) Google Scholar), or molar teeth (31Jowett A.K. Seppo V. Ferguson M.W. Sharpe P.T. Thesleff I. Development. 1993; 117: 461-470PubMed Google Scholar, 32Mackenzie A. Leeming G.L. Jowett A.K. Ferguson M.W.J. Sharpe P.T. Development. 1991; 111: 269-285PubMed Google Scholar) imply thatMsx-1 plays a critical role during organogenesis. Defective expression of Msx-1 in the limb bud mesenchyme of chicken mutants limbless and talpid has been reported; apparently the embryos of limbless mutants failed to assemble an active apical ectodermal ridge, and the underlying mesoderm expressed little or no Msx-1 transcripts (33Coelho C.D. Krabbenhoft K.M. Upholt W.B. Fallon J.F. Kosher R.A. Development. 1991; 113: 1487-1493PubMed Google Scholar, 34Krabbenhoft K.M. Fallon J.F. Dev. Dyn. 1992; 194: 52-62Crossref PubMed Scopus (30) Google Scholar). Implantation of apical ectodermal ridge from a wild type embryo above the limbless mesoderm restored Msx-1 gene expression (33Coelho C.D. Krabbenhoft K.M. Upholt W.B. Fallon J.F. Kosher R.A. Development. 1991; 113: 1487-1493PubMed Google Scholar). Therefore, it appears that the cells of apical ectodermal ridge, either through cell-cell contact or through diffusible factors, regulate Msx-1 gene transcription (23Robert B. Lyons G. Simandl B.K. Kuroiwa A. Buckingham M. Genes Dev. 1991; 5: 2363-2374Crossref PubMed Scopus (142) Google Scholar,24Takahashi Y. LeDouarin N. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 7482-7486Crossref PubMed Scopus (81) Google Scholar, 29Monaghan A.P. Davidson D.R. Sime C. Graham E. Baldock R. Bhattacharya S.S. Hill R.E. Development. 1991; 112: 1053-1061PubMed Google Scholar, 30Levine E.M. Schechter N. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 2729-2733Crossref PubMed Scopus (49) Google Scholar, 31Jowett A.K. Seppo V. Ferguson M.W. Sharpe P.T. Thesleff I. Development. 1993; 117: 461-470PubMed Google Scholar, 32Mackenzie A. Leeming G.L. Jowett A.K. Ferguson M.W.J. Sharpe P.T. Development. 1991; 111: 269-285PubMed Google Scholar, 33Coelho C.D. Krabbenhoft K.M. Upholt W.B. Fallon J.F. Kosher R.A. Development. 1991; 113: 1487-1493PubMed Google Scholar, 34Krabbenhoft K.M. Fallon J.F. Dev. Dyn. 1992; 194: 52-62Crossref PubMed Scopus (30) Google Scholar, 35Coelho C.N.D. Upholt W.B. Kosher R.A. Dev. Biol. 1993; 156: 303-306Crossref PubMed Scopus (18) Google Scholar, 36Davidson D.R. Crawley A. Hill R.E. Tickle C. Nature. 1991; 352: 429-431Crossref PubMed Scopus (166) Google Scholar). Concomitant alterations of Msx-1 gene expression and mirror image duplications of digits in response to 9-cis-retinoic acid (37Yokouchi Y. Ohsugi K. Kuroiwa A. Development. 1992; 113: 431-444Google Scholar) or fibroblast growth factor-2 or -4 (38Riley B.B. Savage M.P. Simandl B.K. Olwin B.B. Fallon J.F. Development. 1993; 118: 95-104PubMed Google Scholar, 39Niswander L. Tickle C. Vogel A. Booth I. Martin G.R. Cell. 1993; 75: 579-587Abstract Full Text PDF PubMed Scopus (577) Google Scholar, 40Fallon J.F. Lopez A. Ros M.A. Savage M.P. Olwin B.B. Simandl B.K. Science. 1994; 264: 104-107Crossref PubMed Scopus (426) Google Scholar, 41Laufer E. Nelson C.E. Johnson R.L. Morgan B.A. Tabin C. Cell. 1994; 79: 993-1003Abstract Full Text PDF PubMed Scopus (721) Google Scholar, 42Cohn M.J. Izpisúa-Belmonte J.C. Abud H. Heath J.K. Tickle C. Cell. 1995; 80: 739-746Abstract Full Text PDF PubMed Scopus (511) Google Scholar) suggest that these phenomena may be causally related to each other, and therefore, the molecular mechanisms of Msx-1 gene regulation warrant further investigation. Earlier we described the structural organization of the coding and noncoding sequences of the Msx-1 gene and reported data that suggested that Msx-1 gene expression may be subject to autoregulation (43Kuzuoka M. Takahashi T. Guron C. Raghow R. Genomics. 1994; 21: 85-91Crossref PubMed Scopus (32) Google Scholar). We carried out a detailed functional analysis of ∼5 kb 1The abbreviations used are: kb, kilobase pair(s); bp, base pair(s); DMEM, Dulbecco's modified Eagle's medium; PCR, polymerase chain reaction; EMSA, electrophoretic mobility shift assay; X-gal, 5-bromo-4-chloro-3-indolyl β-d-galactopyranoside; TSP, transcription start point. of 5′-flanking genomic DNA of Msx-1 with an aim to elucidate the putative cis-acting elements which mediateMsx-1 gene transcription in NIH3T3 and C2C12 cells. We report that a −165/+106-bp minimal Msx-1 promoter, containing sequence motifs capable of interacting with helix-loop-helix proteins (proximal E box) and a ubiquitous transcriptional modulator, Sp1 (proximal Sp1), is sufficiently active in driving the expression of luciferase in cells in culture. Furthermore, our analysis of the bacterial LacZ expression driven by the minimal Msx-1 promoter in transgenic mice suggests that the minimal Msx-1 promoter is exquisitely activated in the structures derived from the interactions between epithelial and mesenchymal cell layers during craniofacial morphogenesis. NIH3T3 cells (ATCC, CRL1658) and C2C12 cells (ATCC, CRL1772) were bought from the American Tissue Culture Collection, Bethesda, MD; cells were cultured in Dulbecco's minimal essential medium (DMEM) supplemented with 10% fetal bovine serum in a humidified 37 °C incubator with 5% CO2. C2C12 cells are capable of differentiation into multinucleated myotubes when cultivated in DMEM with 0.2% fetal bovine serum. Drosophila Schneider line 2 (SL2) cells, provided by Dr. Carl Wu, National Institutes of Health, Bethesda, MD, were grown in the Schneider medium (Life Technologies, Inc.) supplemented with 10% heat-inactivated fetal bovine serum, penicillin, streptomycin, and fungizone at 25 °C in an incubator without CO2 (44Schneider I. J. Embryol. Exp. Morphol. 1972; 27: 353-365PubMed Google Scholar). The Msx-1 promoter-luciferase plasmids for the transfection experiments were constructed by cloning DNA fragments from an Msx-1 genomic clone (43Kuzuoka M. Takahashi T. Guron C. Raghow R. Genomics. 1994; 21: 85-91Crossref PubMed Scopus (32) Google Scholar) into the pGL2-Basic Vector (Promega). A 1.4-kb EcoRI-BamHIMsx-1 genomic DNA fragment was cloned into pBluescript-IISK+ (pBEB) and was used as the source of DNA for all other promoter-luciferase or promoter-LacZ constructs. DNA fragments, prepared either by digestion with restriction enzymes or by polymerase chain reaction (PCR) amplification with oligonucleotides designed according to the sequence of the genomic DNA and containing desirable restriction sites, were cloned into pGL2-Basic. Thus, −1282/+106-bp promoter was constructed by inserting aHincII-BamHI fragment (HincII was derived from the polylinker of pBluescript, and the BamHI site came from Msx-1 genomic DNA), encompassing 1282 bp upstream and 106 bp downstream of the transcription start site (43Kuzuoka M. Takahashi T. Guron C. Raghow R. Genomics. 1994; 21: 85-91Crossref PubMed Scopus (32) Google Scholar), into the SmaI-BglII sites of pGL2-Basic Vector. PCR-amplified promoter fragments −1168/+106, −1042/+106, −886/+106, −811/+106, −726/+106, −588/+106, −509/+106, −268/+106, or −165/+106 with SstI-BglII termini were cloned into SstI and BglII sites of the pGL2-Basic. The −127/+106-bp promoter was generated by digesting pBEB withKpnI and BamHI and by cloning the DNA fragment into the homologous restriction sites of pGL2-Basic. The promoter fragments −91/+106, −52/+106, −32/+106, +10/+106, and +33/+106 were prepared by PCR and cloned into KpnI-BglII sites of pGL2-basic. Fragments with 5′ or 3′ site deletions, −886/−33, −886/−166, −268/−33, −268/−166, and −165/−33, were created by PCR-based strategy using oligonucleotides withSstI-BamHI ends. The nucleotide sequences of all PCR-amplified DNA fragments inserted in reporter plasmids were verified by the dideoxynucleotide method of DNA sequencing (45Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Current Protocols in Molecular Biology. John Wiley & Sons, New York1989–1996Google Scholar). NIH3T3 and C2C12 cells were seeded (105 cells per 35-mm diameter well) in 6-well tissue culture dishes, 1 day prior to transfection. Both cell lines were transfected using LipofectAMINETM (Life Technologies, Inc.) according to the manufacturer's recommendations. Four μl of LipofectAMINETM and 1 μg of plasmid DNA were diluted individually in 100-μl aliquots of OptiMEMTM I Reduced-Serum Medium (Life Technologies, Inc.). Cells were incubated with DNA lipid complexes for 5 h and then fed DMEM; 24–30 h after transfection, cells were rinsed and harvested in phosphate-buffered saline, and lysed in 150 μl of 1 × Cell Culture Lysis Reagent (Promega). Aliquots of cell extracts were mixed with 100 μl of 470 mm luciferin, and light intensity was measured in a Turner Designs Luminometer Model 20. Expression of luciferase in cells transfected with pGL2-Basic Vector, which lacks eukaryotic promoter and enhancer, and the pGL2-Control Vector (Promega), which contains SV40 promoter and enhancer, were used as negative and positive controls, respectively (46Wang Q. Raghow R. Mol. Cell. Biochem. 1996; 158: 33-42PubMed Google Scholar). Cells were transfected with a given construct in triplicate, and expression of the cotransfected pSV-β-galactosidase plasmid (Promega) was used to correct for the variable transfection efficiencies. The protein content of cell extracts was quantitated by the Bradford method (Bio-Rad Protein Assay System). The luciferase activities were expressed as arbitrary units of light intensity per μg of protein. To examine transactivation of Msx-1 promoter with Sp1, SL-2 cells were cotransfected with Msx-1 promoter-luciferase and Sp1 expression constructs. Twenty-four h before transfection,Drosophila SL-2 cells were transferred to 35-mm well plates at a density of 1.0 × 105 cells per well. Cells were transfected with 0.5 μg of Msx-1 promoter-luciferase plasmid mixed with 0.05 μg of Sp1 expression vector, pPacSp1 (47Kadonaga J.T. Carner K.R. Masiarz F.R. Tjian R. Cell. 1987; 51: 1079-1090Abstract Full Text PDF PubMed Scopus (1255) Google Scholar,48Courey A.J. Tjian R. Cell. 1988; 55: 887-898Abstract Full Text PDF PubMed Scopus (1079) Google Scholar), using 2 μl of Cellfectin (Life Technologies, Inc.). Parallel aliquots of SL-2 were also cotransfected with Msx-1luciferase constructs mixed with 0.05 μg of pPacSp1 in antisense orientation and were used as negative controls. Luciferase assays were performed 48 h after transfection as outlined above. Nuclear extracts from NIH3T3 or C2C12 cells were prepared according to Dignam et al. (49Dignam J.D. Lebovitz R.M. Roeder R.G. Nucleic Acids Res. 1983; 11: 1475-1489Crossref PubMed Scopus (9164) Google Scholar) and as described in detail previously (50Armendariz-Borunda J. Simkevich C.P. Roy N. Raghow R. Kang A.H. Seyer J.M. Biochem. J. 1994; 304: 817-824Crossref PubMed Scopus (72) Google Scholar). Cells were rinsed and scraped in phosphate-buffered saline, resuspended in hypotonic buffer (10 mm HEPES, 1.5 mm MgCl2, 10 mm KCl, 0.2 mm phenylmethylsulfonyl fluoride, 0.5 mmdithiothreitol), and homogenized. The nuclei were removed by centrifugation and resuspended in low-salt buffer (20 mmHEPES, 25% glycerol, 1.5 mm MgCl2, 20 mm KCl, 0.2 mm EDTA, 0.2 mmphenylmethylsulfonyl fluoride, 0.5 mm dithiothreitol). The salt concentration of the nuclear suspension was adjusted to 0.3m KCl which released soluble nuclear proteins. Nuclei were then pelleted by centrifugation, and the protein extracts were dialyzed against a buffer containing 100 mm KCl. The precipitated protein was removed by centrifugation, and the supernatants were stored in aliquots at −80 °C. Complementary single-stranded oligonucleotides (Table I) with 3–4-nucleotide-long 5′ overhangs were annealed and radiolabeled by end-filling with Klenow fragment of Escherichia coli DNA polymerase, using [α-32P]dCTP. Radiolabeled DNA probes (10,000 cpm/μl) were incubated with nuclear extracts in the presence or absence of competitor oligonucleotides. To each tube, 17 μl of the premixed incubation buffer (Stratagene) and 1 μl of radiolabeled probe were added, and the mixture was incubated at room temperature for 20–30 min. For supershift assays, nuclear extracts were preincubated with polyclonal antibodies against MyoD, myogenin, c-Myc, Max, USF-1, USF-2, or Sp-1 for 2 h at 4 °C prior to initiation of the binding reaction. The contents of the binding reactions were electrophoresed at 4 °C on a 4% nondenaturing polyacrylamide gel in 1 × TBE (135 mm Tris, 45 mm boric acid, and 2.5 mm Na2 EDTA, pH 8.9) and fluorographed; we have described EMSA methods in detail previously (50Armendariz-Borunda J. Simkevich C.P. Roy N. Raghow R. Kang A.H. Seyer J.M. Biochem. J. 1994; 304: 817-824Crossref PubMed Scopus (72) Google Scholar, 51Katai H. Stephenson J.D. Simkevich C.P. Thompson J.P. Raghow R. Mol. Cell. Biochem. 1992; 118: 119-129Crossref PubMed Scopus (57) Google Scholar). All antibodies to transcriptional factors and the oligonucleotides containing the consensus recognition motifs used in EMSA were purchased from Santa Cruz Biotechnology, Inc.Table IOligonucleotides used in electrophoretic mobility shift assaysPositionSequenceProximal E boxE box −165/−1285′GATGCCCACCTGACTTAGCTAGGCGGAAAAGCTCCCCA3′ −165/−1475′GATGCCCACCTGACTTAGC3′ −156/−1385′CTGACTTAGCTAGGCGGAA3′ −146/−1285′TAGGCGGAAAAGCTCCCCA3′**** M−165/−1625′GGTCCAGCCGGACCCGACCCCACCTGACTTAGC3′**** M−161/−1585′GGTCCAGCCGGACCGATGTAGTCCTGACTTAGCTAGG3′**** M−157/−1545′CCGGACCGATGCCCATAACACTTAGCTAGGCGGAA3′Distal E box −1168/−1147 WildE box5′CAATCACCTGCTCCACCTCCCCC3′ −1167/−1147 Mut* *5′CAATCTCCTCCTCCACCTCCCCC3′Proximal Sp1Sp1 −32/+25′TCTCCGGACCCGCCCCCTCGCGCTCTGATTGGCC3′**** M−22/−195′GGTTCTCTCCGGACCATGACCCTCGCGCTCTGATTGGCC3′**** M−18/−155′GGTTCTCTCCGGACCCGCCTTAGCGCGCTCTGATTGGCC3′**** M−14/−115′GGACCCGCCCCCTTATACTCTGATTGGCCGC3′M or Mut shows mutant oligonucleotides, and the numbers represent the 5′ and 3′ ends of the oligonucleotides. The sequences of the putative binding Sp1 and E box motifs are underlined and the mutated bases are indicated by asterisks placed above them. Open table in a new tab M or Mut shows mutant oligonucleotides, and the numbers represent the 5′ and 3′ ends of the oligonucleotides. The sequences of the putative binding Sp1 and E box motifs are underlined and the mutated bases are indicated by asterisks placed above them. The protocols for DNase I footprinting were used as described previously with minor modifications (50Armendariz-Borunda J. Simkevich C.P. Roy N. Raghow R. Kang A.H. Seyer J.M. Biochem. J. 1994; 304: 817-824Crossref PubMed Scopus (72) Google Scholar, 51Katai H. Stephenson J.D. Simkevich C.P. Thompson J.P. Raghow R. Mol. Cell. Biochem. 1992; 118: 119-129Crossref PubMed Scopus (57) Google Scholar). DNA fragments encompassing −91/+106 bp and −268/+106 bp, cloned intoSstI-BglII sites of pGL2-Basic, were linearized with XmaI and end-labeled with [α-32P]dCTP and E. coli DNA polymerase. After labeling, DNA polymerase was inactivated by incubation at 75 °C for 15 min. The 3′ end of the insert was cut with HindIII and purified. Nuclear extracts or recombinant human Sp1 (Promega) were incubated with radiolabeled DNA (10,000 cpm). For competition, radiolabeled probes were mixed with 50 ng of Sp1 consensus oligonucleotide (Stratagene) before initiating binding; the binding reactions were allowed to proceed for 15 min on ice and incubated for an additional 2 min at room temperature. After addition of DNase I, the mixture was incubated for exactly 2 min and was combined with 100 μl of a stop solution. The digested probe was extracted with phenol/chloroform, precipitated with ethanol, and electrophoresed in 8% polyacrylamide containing 7 m urea, alongside a nucleotide sequence ladder. Msx-1promoter fragment, −886/+106, was cloned intoSstI-BamHI sites of pALTER-1 Vector (Promega), which is resistant to tetracycline (tet) and sensitive to ampicillin (amp). Mutagenic oligonucleotide, Ampr repair oligonucleotide, and TCr knock-out oligonucleotide were annealed to single-stranded DNA templates. M−161/−158, M−22/−19, M−18/−15, and M−14/−11 (Table I) were used as mutagenic oligonucleotides. The complementary DNA strand was synthesized with T4 DNA polymerase, dNTPs, and T4 DNA ligase. BMH71-18mutS cells were transformed with mismatched double-stranded DNA plasmids; E. coli DNA isolated from individual clones was used to transform JM109 cells. Mutated DNAs were sequenced and cloned into SstI-BglII sites of pGL2-Basic and used in transient transfections. The incrementally truncated murineMsx-1 promoter fragments were cloned in front of the LacZ gene in the plasmid pLacF (52Mercer E.H. Hoyle G.W. Kapur R.P. Brinster R.L. Palmiter R.D. Neuron. 1991; 7: 703-716Abstract Full Text PDF PubMed Scopus (235) Google Scholar). The detailed experimental strategies used to generate transgenic mice which contain the full-length (5.0 kb) or serially truncated variants of Msx-1 promoter-LacZ vectors in their genome will be described elsewhere. The minimal −165/+106-bp Msx-1 promoter DNA fragment containingXbaI recognition termini was ligated in the XbaI site of pLacF (52Mercer E.H. Hoyle G.W. Kapur R.P. Brinster R.L. Palmiter R.D. Neuron. 1991; 7: 703-716Abstract Full Text PDF PubMed Scopus (235) Google Scholar). The BglII-linearized plasmid DNA was microinjected into fertilized eggs obtained from FVB/NHsd females, and embryos were implanted in the pseudopregnant mice; the transgenic founders were identified by analyzing their tail DNA by Southern hybridization and PCR methods as detailed previously (53Hogan B. Beddington R. Constantini F. Lacy E. Manipulating the Mouse Embryo: a Laboratory Manual. Cold Spring Harbor Press, Cold Spring Harbor, NY1994: 1-497Google Scholar). Four independent lines of transgenic founders containing the −165/+106-bpMsx-1-LacZ DNA were studied extensively. Founders were back-crossed, and timed-mated FVB females were sacrificed by cervical dislocation. The embryos were partially fixed in 2% paraformaldehyde at 4 °C and stained with X-gal at 37 °C overnight (53Hogan B. Beddington R. Constantini F. Lacy E. Manipulating the Mouse Embryo: a Laboratory Manual. Cold Spring Harbor Press, Cold Spring Harbor, NY1994: 1-497Google Scholar). The stained embryos were submerged in 70% ethanol, illuminated uniformly by scattered light, and photographed under a dissecting microscope. To assess expression of the endogenousMsx-1 gene, normal FVB/NHsd mouse embryos were obtained at different stages of development and processed for wholemount in situ hybridization by previously published protocols (54Conlon R.A. Herrmann B.G. Methods Enzymol. 1993; 225: 373-383Crossref PubMed Scopus (83) Google Scholar, 55Wilkinson D.G. Nieto M.A. Methods Enzymol. 1993; 225: 361-372Crossref PubMed Scopus (724) Google Scholar). A 700-bp SstI-EcoRI DNA fragment containing the 5′ half of the Msx-1 cDNA was cloned in pGEM+ vector (Boehringer Mannheim). Antisense or sense RNAs were transcribed by T7 or Sp6 polymerases, respectively, according to the directions provided by the manufacturer. RNA was synthesized to incorporate digoxigenin-UTP and purified. Fixed embryos were subject to wholemount in situ hybridization with digoxigenin-labeled RNAs according to the published protocols" @default.
• W2039836699 created "2016-06-24" @default.
• W2039836699 creator A5001609397 @default.
• W2039836699 creator A5005015758 @default.
• W2039836699 creator A5038437206 @default.
• W2039836699 creator A5083377561 @default.
• W2039836699 creator A5087356429 @default.
• W2039836699 date "1997-09-01" @default.
• W2039836699 modified "2023-10-10" @default.
• W2039836699 title "A Minimal Murine Msx-1 Gene Promoter" @default.
• W2039836699 cites W1542932778 @default.
• W2039836699 cites W1560672799 @default.
• W2039836699 cites W1582891190 @default.
• W2039836699 cites W1826330550 @default.
• W2039836699 cites W1923477899 @default.
• W2039836699 cites W1959992381 @default.
• W2039836699 cites W1963641861 @default.
• W2039836699 cites W1965350971 @default.
• W2039836699 cites W1967198448 @default.
• W2039836699 cites W1971943177 @default.
• W2039836699 cites W1973890187 @default.
• W2039836699 cites W1975131757 @default.
• W2039836699 cites W1975197215 @default.
• W2039836699 cites W1978198515 @default.
• W2039836699 cites W1983203736 @default.
• W2039836699 cites W1985126857 @default.
• W2039836699 cites W1988573735 @default.
• W2039836699 cites W1993243592 @default.
• W2039836699 cites W1993445669 @default.
• W2039836699 cites W2001607246 @default.
• W2039836699 cites W2003494144 @default.
• W2039836699 cites W2007821628 @default.
• W2039836699 cites W2008004759 @default.
• W2039836699 cites W2009851083 @default.
• W2039836699 cites W2015724320 @default.
• W2039836699 cites W2025438239 @default.
• W2039836699 cites W2028512350 @default.
• W2039836699 cites W2033596891 @default.
• W2039836699 cites W2034767141 @default.
• W2039836699 cites W2035378222 @default.
• W2039836699 cites W2036820557 @default.
• W2039836699 cites W2036824257 @default.
• W2039836699 cites W2037653294 @default.
• W2039836699 cites W2038818631 @default.
• W2039836699 cites W2041031381 @default.
• W2039836699 cites W2044083856 @default.
• W2039836699 cites W2046567232 @default.
• W2039836699 cites W2048249977 @default.
• W2039836699 cites W2049413252 @default.
• W2039836699 cites W2063880459 @default.
• W2039836699 cites W2066398820 @default.
• W2039836699 cites W2068742932 @default.
• W2039836699 cites W2068817943 @default.
• W2039836699 cites W2069163155 @default.
• W2039836699 cites W2076953222 @default.
• W2039836699 cites W2080444658 @default.
• W2039836699 cites W2080592158 @default.
• W2039836699 cites W2082403352 @default.
• W2039836699 cites W2085430625 @default.
• W2039836699 cites W2089126365 @default.
• W2039836699 cites W2091941970 @default.
• W2039836699 cites W2099897830 @default.
• W2039836699 cites W2103735500 @default.
• W2039836699 cites W2104209513 @default.
• W2039836699 cites W2115654784 @default.
• W2039836699 cites W2127321901 @default.
• W2039836699 cites W2129454448 @default.
• W2039836699 cites W2143818366 @default.
• W2039836699 cites W2148439606 @default.
• W2039836699 cites W2149006664 @default.
• W2039836699 cites W2169604969 @default.
• W2039836699 cites W2188175856 @default.
• W2039836699 cites W2189430740 @default.
• W2039836699 cites W2248512179 @default.
• W2039836699 cites W2283248130 @default.
• W2039836699 cites W2339526814 @default.
• W2039836699 cites W2341117863 @default.
• W2039836699 cites W244331836 @default.
• W2039836699 cites W4236512674 @default.
• W2039836699 cites W92384234 @default.
• W2039836699 doi "https://doi.org/10.1074/jbc.272.36.22667" @default.
• W2039836699 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9278425" @default.
• W2039836699 hasPublicationYear "1997" @default.
• W2039836699 type Work @default.
• W2039836699 sameAs 2039836699 @default.
• W2039836699 citedByCount "32" @default.
• W2039836699 countsByYear W20398366992013 @default.
• W2039836699 countsByYear W20398366992015 @default.
• W2039836699 crossrefType "journal-article" @default.
• W2039836699 hasAuthorship W2039836699A5001609397 @default.
• W2039836699 hasAuthorship W2039836699A5005015758 @default.
• W2039836699 hasAuthorship W2039836699A5038437206 @default.
• W2039836699 hasAuthorship W2039836699A5083377561 @default.
• W2039836699 hasAuthorship W2039836699A5087356429 @default.
• W2039836699 hasBestOaLocation W20398366991 @default.
• W2039836699 hasConcept C104317684 @default.
• W2039836699 hasConcept C153911025 @default.
• W2039836699 hasConcept C185592680 @default.

• next