FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2040317062> ?p ?o ?g. }

• W2040317062 endingPage "53664" @default.
• W2040317062 startingPage "53653" @default.
• W2040317062 abstract "p21-activated protein kinase (PAK)-2 is a member of the PAK family of serine/threonine kinases. PAKs are activated by the p21 G-proteins Rac and Cdc42 in response to a variety of extracellular signals and act in pathways controlling cell growth, shape, motility, survival, and death. PAK-2 is unique among the PAK family members because it is also activated through proteolytic cleavage by caspase-3 or similar proteases to generate the constitutively active PAK-2p34 fragment. Activation of full-length PAK-2 by Rac or Cdc42 stimulates cell survival and protects cells from cell death, whereas caspase-activated PAK-2p34 induces a cell death response. Caspase-activated PAK-2p34 is rapidly degraded by the 26 S proteasome, but full-length PAK-2 is not. Stabilization of PAK-2p34 by preventing its polyubiquitination and degradation results in a dramatic stimulation of cell death. Although many proteins have been shown to interact with and regulate full-length PAK-2, little is known about the regulation of caspase-activated PAK-2p34. Here, we identify PS-GAP as a regulator of caspase-activated PAK-2p34. PS-GAP is a GTPase-activating protein for Cdc42 and RhoA that was originally identified by its interaction with the tyrosine kinase PYK-2. PS-GAP interacts specifically with caspase-activated PAK-2p34, but not active or inactive full-length PAK-2, through a region between the GAP and SH3 domains. The interaction with PS-GAP inhibits the protein kinase activity of PAK-2p34 and changes the localization of PAK-2p34 from the nucleus to the perinuclear region. Furthermore, PS-GAP decreases the stimulation of cell death induced by stabilization of PAK-2p34. p21-activated protein kinase (PAK)-2 is a member of the PAK family of serine/threonine kinases. PAKs are activated by the p21 G-proteins Rac and Cdc42 in response to a variety of extracellular signals and act in pathways controlling cell growth, shape, motility, survival, and death. PAK-2 is unique among the PAK family members because it is also activated through proteolytic cleavage by caspase-3 or similar proteases to generate the constitutively active PAK-2p34 fragment. Activation of full-length PAK-2 by Rac or Cdc42 stimulates cell survival and protects cells from cell death, whereas caspase-activated PAK-2p34 induces a cell death response. Caspase-activated PAK-2p34 is rapidly degraded by the 26 S proteasome, but full-length PAK-2 is not. Stabilization of PAK-2p34 by preventing its polyubiquitination and degradation results in a dramatic stimulation of cell death. Although many proteins have been shown to interact with and regulate full-length PAK-2, little is known about the regulation of caspase-activated PAK-2p34. Here, we identify PS-GAP as a regulator of caspase-activated PAK-2p34. PS-GAP is a GTPase-activating protein for Cdc42 and RhoA that was originally identified by its interaction with the tyrosine kinase PYK-2. PS-GAP interacts specifically with caspase-activated PAK-2p34, but not active or inactive full-length PAK-2, through a region between the GAP and SH3 domains. The interaction with PS-GAP inhibits the protein kinase activity of PAK-2p34 and changes the localization of PAK-2p34 from the nucleus to the perinuclear region. Furthermore, PS-GAP decreases the stimulation of cell death induced by stabilization of PAK-2p34. In multicellular organisms, cell metabolism needs to be tightly regulated by extracellular signals and intracellular signaling pathways. Because of the variety of signals cells receive, the precise balance and modulation of various signals are critical for normal function. Dysregulation of cell signaling pathways can result in cell death or malignant transformation. Protein kinases play a critical role in modulation of a wide variety of signals, and many protein kinases have been identified as oncogenes or tumor suppressor genes, demonstrating their critical role in cell signaling (1Krebs E.G. Trends Biochem. Sci. 1994; 19: 439Abstract Full Text PDF PubMed Scopus (88) Google Scholar, 2Cohen P. Trends Biochem. Sci. 1992; 17: 408-413Abstract Full Text PDF PubMed Scopus (277) Google Scholar). The p21-activated protein kinases (PAKs) 1The abbreviations used are: PAKs, p21-activated protein kinases; GAP, GTPase-activating protein; EGFP, enhanced green fluorescent protein; D-PBS, Dulbecco's phosphate-buffered saline; HA, hemagglutinin; GST, glutathione S-transferase; RT, reverse transcription; SH3, Src homology 3; Ub, ubiquitin; PH, pleckstrin homology.1The abbreviations used are: PAKs, p21-activated protein kinases; GAP, GTPase-activating protein; EGFP, enhanced green fluorescent protein; D-PBS, Dulbecco's phosphate-buffered saline; HA, hemagglutinin; GST, glutathione S-transferase; RT, reverse transcription; SH3, Src homology 3; Ub, ubiquitin; PH, pleckstrin homology. are a family of cellular serine/threonine kinases. The PAK family includes PAK-1 (α-PAK), PAK-2 (γ-PAK), and PAK-3 (β-PAK) as well as PAK-4, PAK-5, and PAK-6, a less closely related second group of PAK family proteins (3Manser E. Leung T. Salihuddin H. Zhao Z.S. Lim L. Nature. 1994; 367: 40-46Crossref PubMed Scopus (1280) Google Scholar, 4Manser E. Chong C. Zhao Z.S. Leung T. Michael G. Hall C. Lim L. J. Biol. Chem. 1995; 270: 25070-25078Abstract Full Text Full Text PDF PubMed Scopus (205) Google Scholar, 5Bagrodia S. Taylor S.J. Creasy C.L. Chernoff J. Cerione R.A. J. Biol. Chem. 1995; 270: 22731-22737Abstract Full Text Full Text PDF PubMed Scopus (328) Google Scholar, 6Jakobi R. Chen C.J. Tuazon P.T. Traugh J.A. J. Biol. Chem. 1996; 271: 6206-6211Abstract Full Text Full Text PDF PubMed Scopus (67) Google Scholar, 7Abo A. Qu J. Cammarano M.S. Dan C. Fritsch A. Baud V. Belisle B. Minden A. EMBO J. 1998; 17: 6527-6540Crossref PubMed Scopus (306) Google Scholar, 8Yang F. Li X. Sharma M. Zarnegar M. Lim B. Sun Z. J. Biol. Chem. 2001; 276: 15345-15353Abstract Full Text Full Text PDF PubMed Scopus (129) Google Scholar, 9Dan C. Nath N. Liberto M. Minden A. Mol. Cell. Biol. 2002; 22: 567-577Crossref PubMed Scopus (133) Google Scholar). PAKs are named for their activation by the monomeric p21 G-proteins Cdc42 and Rac. Active Cdc42 and Rac bind to a region within the regulatory domain of PAKs. This binding region overlaps with an autoinhibitory region within PAK-1, PAK-2, and PAK-3, and p21 binding induces conformational changes that lead to PAK activation (10Zhao Z.S. Manser E. Chen X.Q. Chong C. Leung T. Lim L. Mol. Cell. Biol. 1998; 18: 2153-2163Crossref PubMed Google Scholar, 11Tu H. Wigler M. Mol. Cell. Biol. 1999; 19: 602-611Crossref PubMed Scopus (78) Google Scholar, 12Lei M. Lu W. Meng W. Parrini M.C. Eck M.J. Mayer B.J. Harrison S.C. Cell. 2000; 102: 387-397Abstract Full Text Full Text PDF PubMed Scopus (431) Google Scholar). PAK-4, PAK-5, and PAK-6 appear to lack this autoinhibitory region, although they are still activated by binding of active Cdc42 and Rac (7Abo A. Qu J. Cammarano M.S. Dan C. Fritsch A. Baud V. Belisle B. Minden A. EMBO J. 1998; 17: 6527-6540Crossref PubMed Scopus (306) Google Scholar, 13Jaffer Z.M. Chernoff J. Int. J. Biochem. Cell Biol. 2002; 34: 713-717Crossref PubMed Scopus (309) Google Scholar). PAKs have been implicated in a variety of cellular functions, including regulation of cell shape and motility through effects on the actin cytoskeleton and integrin signaling pathways and regulation of cell survival and death (14Lim L. Manser E. Leung T. Hall C. Eur. J. Biochem. 1996; 242: 171-185Crossref PubMed Scopus (273) Google Scholar, 15Sells M.A. Chernoff J. Trends Cell Biol. 1997; 7: 162-167Abstract Full Text PDF PubMed Scopus (262) Google Scholar, 16Knaus U.G. Bokoch G.M. Int. J. Biochem. Cell Biol. 1998; 30: 857-862Crossref PubMed Scopus (158) Google Scholar, 17Bagrodia S. Cerione R.A. Trends Cell Biol. 1999; 9: 350-355Abstract Full Text Full Text PDF PubMed Scopus (341) Google Scholar, 18Roig J. Traugh J.A. Vitam. Horm. 2001; 62: 167-198Crossref PubMed Google Scholar, 19Bokoch G.M. Annu. Rev. Biochem. 2003; 71: 743-781Crossref Scopus (869) Google Scholar). PAKs appear to accomplish these different functions by interaction with a variety of other signaling molecules. The best known PAK interaction partners are the p21 monomeric G-proteins Cdc42 and Rac. Indeed, the PAK family was first identified in an overlay screen for proteins that interact with activated Rac (3Manser E. Leung T. Salihuddin H. Zhao Z.S. Lim L. Nature. 1994; 367: 40-46Crossref PubMed Scopus (1280) Google Scholar). Binding of Cdc42 and Rac to the so-called PBD (p21-binding domain) or CRIB (Cdc42/Rac-interactive binding) domain results in activation of PAKs. Interestingly, sphingolipids also interact with the same region and activate PAKs (20Bokoch G.M. Reilly A.M. Daniels R.H. King C.C. Olivera A. Spiegel S. Knaus U.G. J. Biol. Chem. 1998; 273: 8137-8144Abstract Full Text Full Text PDF PubMed Scopus (171) Google Scholar). Additionally, the adaptor protein Nck binds to a proline-rich motif within the regulatory domain of PAK (residues 12-16 of PAK-1) and has been implicated in recruiting PAKs to activated growth factor receptor complexes (21Bokoch G.M. Wang Y. Bohl B.P. Sells M.A. Quilliam L.A. Knaus U.G. J. Biol. Chem. 1996; 271: 25746-25749Abstract Full Text Full Text PDF PubMed Scopus (264) Google Scholar, 22Galisteo M.L. Chernoff J. Su Y.C. Skolnik E.Y. Schlessinger J. J. Biol. Chem. 1996; 271: 20997-21000Abstract Full Text PDF PubMed Scopus (234) Google Scholar, 23Zhao Z. Manser E. Lim L. Mol. Cell. Biol. 2000; 20: 3906-3917Crossref PubMed Scopus (125) Google Scholar). Pix/COOL proteins, which are guanine nucleotide exchange factors, have also been shown to modulate PAK activity through binding to a third, atypical proline-rich region within the regulatory domain of PAK (residues 187-196 of PAK-1) (24Bagrodia S. Taylor S.J. Jordon K.A. Van Aelst L. Cerione R.A. J. Biol. Chem. 1998; 273: 23633-23636Abstract Full Text Full Text PDF PubMed Scopus (270) Google Scholar, 25Daniels R.H. Zenke F.T. Bokoch G.M. J. Biol. Chem. 1999; 274: 6047-6050Abstract Full Text Full Text PDF PubMed Scopus (107) Google Scholar, 26Manser E. Loo T.H. Koh C.G. Zhao Z.S. Chen X.Q. Tan L. Tan I. Leung T. Lim L. Mol. Cell. 1998; 1: 183-192Abstract Full Text Full Text PDF PubMed Scopus (630) Google Scholar). More recently, PAK-3 has been shown to interact with paxillin, which acts as a scaffolding adaptor protein in integrin signaling, through a region within the PAK regulatory domain that may include the Nck-binding site (27Hashimoto S. Tsubouchi A. Mazaki Y. Sabe H. J. Biol. Chem. 2001; 276: 6037-6045Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar). Paxillin can compete with Nck for PAK binding; surprisingly, it also appears to compete with Pix, even though they are believed to interact with distinct regions within the regulatory domain of PAK. PAK-1, PAK-2, and PAK-4 have been shown to suppress cell death and to promote cell survival through phosphorylation of the pro-apoptotic protein Bad (28Schurmann A. Mooney A.F. Sanders L.C. Sells M.A. Wang H.G. Reed J.C. Bokoch G.M. Mol. Cell. Biol. 2000; 20: 453-461Crossref PubMed Scopus (302) Google Scholar, 29Tang Y. Zhou H. Chen A. Pittman R.N. Field J. J. Biol. Chem. 2000; 275: 9106-9109Abstract Full Text Full Text PDF PubMed Scopus (201) Google Scholar, 30Gnesutta N. Qu J. Minden A. J. Biol. Chem. 2001; 276: 14414-14419Abstract Full Text Full Text PDF PubMed Scopus (174) Google Scholar, 31Jakobi R. Moertl E. Koeppel M.A. J. Biol. Chem. 2001; 276: 16624-16634Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar). Constitutive activation of PAKs appears to be involved in malignant transformation, cancer development, and cancer cell invasion. Expression of constitutively active PAK-4 results in anchorage-independent growth (32Qu J. Cammarano M.S. Shi Q. Ha K.C. de Lanerolle P. Minden A. Mol. Cell. Biol. 2001; 21: 3523-3533Crossref PubMed Scopus (138) Google Scholar, 33Callow M.G. Clairvoyant F. Zhu S. Schryver B. Whyte D.B. Bischoff J.R. Jallal B. Smeal T. J. Biol. Chem. 2002; 277: 550-558Abstract Full Text Full Text PDF PubMed Scopus (220) Google Scholar). Elevated protein or activity levels of PAK-1, PAK-2, and PAK-4 have been detected in various cancer cell lines, and elevated PAK activity has been shown to be required for proliferation of MDA-MB435 breast cancer cells (33Callow M.G. Clairvoyant F. Zhu S. Schryver B. Whyte D.B. Bischoff J.R. Jallal B. Smeal T. J. Biol. Chem. 2002; 277: 550-558Abstract Full Text Full Text PDF PubMed Scopus (220) Google Scholar, 34Vadlamudi R.K. Adam L. Wang R-A. Mandal M. Nguyen D. Sahin A. Chernoff J. Hung M.-C. Kumar R. J. Biol. Chem. 2000; 275: 36238-36244Abstract Full Text Full Text PDF PubMed Scopus (220) Google Scholar, 35Mira J.P. Benard V. Groffen J. Sanders L.C. Knaus U.G. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 185-189Crossref PubMed Scopus (195) Google Scholar). Dominant-negative PAK constructs reduce invasion of MDA-MB435 breast cancer cells (35Mira J.P. Benard V. Groffen J. Sanders L.C. Knaus U.G. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 185-189Crossref PubMed Scopus (195) Google Scholar). PAK-2 is unique among the PAKs because of the existence of a cleavage site for caspase-3 or a caspase-3-like protease within the regulatory domain. Proteolytic cleavage C-terminal of Asp212 removes most of the regulatory domain, generating a constitutively active PAK-2p34 catalytic fragment (36Rudel T. Bokoch G.M. Science. 1997; 276: 1571-1574Crossref PubMed Scopus (601) Google Scholar, 37Walter B.N. Huang Z. Jakobi R. Tuazon P.T. Alnemri E.S. Litwack G. Traugh J.A. J. Biol. Chem. 1998; 273: 28733-28739Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar). Caspase-mediated generation of PAK-2p34 has been observed in response to a variety of apoptotic stimulants (31Jakobi R. Moertl E. Koeppel M.A. J. Biol. Chem. 2001; 276: 16624-16634Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar, 36Rudel T. Bokoch G.M. Science. 1997; 276: 1571-1574Crossref PubMed Scopus (601) Google Scholar, 38Tang T.K. Chang W.C. Chan W.H. Yang S.D. Ni M.H. Yu J.S. J. Cell. Biochem. 1998; 70: 442-454Crossref PubMed Scopus (39) Google Scholar, 39Chan W.H. Yu J.S. Yang S.D. J. Protein Chem. 1998; 17: 485-494Crossref PubMed Scopus (27) Google Scholar). Additionally, ectopic expression of PAK-2p34 stimulates cell death (40Lee N. MacDonald H. Reinhard C. Halenbeck R. Roulston A. Shi T. Williams L.T. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 13642-13647Crossref PubMed Scopus (172) Google Scholar, 41Rudel T. Zenke F.T. Chuang T.H. Bokoch G.M. J. Immunol. 1998; 160: 7-11PubMed Google Scholar, 42Jakobi R. McCarthy C.C. Koeppel M.A. Stringer D.K. J. Biol. Chem. 2003; 278: 38675-38685Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar). Therefore, PAK-2 appears to have dual and opposing functions in the regulation of cell survival and death. Activated full-length PAK-2 stimulates cell survival and suppresses cell death, whereas proteolytically activated PAK-2p34 induces a cell death response. We have shown recently that localization and protein levels of PAK-2p34 are tightly regulated (42Jakobi R. McCarthy C.C. Koeppel M.A. Stringer D.K. J. Biol. Chem. 2003; 278: 38675-38685Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar). Subcellular localization of PAK-2 is regulated by nuclear export and nuclear localization signals. In full-length PAK-2, the nuclear export signal dominates over the nuclear localization signal, resulting in cytoplasmic localization. Caspase cleavage disrupts the nuclear export signal and results in nuclear accumulation of PAK-2p34. Protein levels of PAK-2p34 are regulated by ubiquitination and degradation by the 26 S proteasome. Caspase-activated PAK-2p34 is rapidly degraded by the 26 S proteasome, but full-length PAK-2 is not. Expression of epitope-tagged ubiquitin stabilizes PAK-2p34 by preventing its polyubiquitination and degradation, and stabilization of PAK-2p34 results in dramatic stimulation of programmed cell death (42Jakobi R. McCarthy C.C. Koeppel M.A. Stringer D.K. J. Biol. Chem. 2003; 278: 38675-38685Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar). Interestingly, cleavage of PAK-2 to the PAK-2p34 fragment removes interaction sites for Nck, Pix/COOL proteins, paxillin, and Cdc42/Rac/sphingolipids, thereby freeing the PAK-2p34 fragment from these known regulators of PAK signaling. Here, we report the identification of a novel PAK-2 regulator, PS-GAP. PS-GAP is a GTPase-activating protein (GAP) for Cdc42 and RhoA previously identified by interaction with the tyrosine kinase PYK-2 (43Ren X.R. Du Q.S. Huang Y.Z. Ao S.Z. Mei L. Xiong W-C. J. Cell Biol. 2001; 152: 971-984Crossref PubMed Scopus (99) Google Scholar). PS-GAP interacts selectively with caspase-activated PAK-2p34 both in vitro and in vivo, but does not interact with full-length PAK-2. The interaction with PS-GAP regulates the activity and subcellular localization of caspase-activated PAK-2p34. PS-GAP inhibits the protein kinase activity of PAK-2p34 in vitro and changes the localization of PAK-2p34 from the nucleus to the perinuclear region. Furthermore, PS-GAP appears to regulate the ability of caspase-activated PAK-2p34 to induce programmed cell death. Expression of PS-GAP reduces levels of cell death induced by stabilization of PAK-2p34. PS-GAP is the first identified protein that specifically regulates pro-apoptotic caspase-activated PAK-2p34, but not anti-apoptotic full-length PAK-2, a critical step in elucidating the pro-apoptotic PAK-2p34 signaling pathway. Materials—Yeast strain PJ69-4a was a generous gift from Dr. P. James (University of Wisconsin, Madison, WI) (44James P. Halladay J. Craig E.A. Genetics. 1996; 144: 1425-1436Crossref PubMed Google Scholar). Yeast strain Y190, two-hybrid vectors pAS2-1 and pACT2, the Advantage 2 PCR kit, mouse heart Marathon-Ready cDNA, the monoclonal anti-green fluorescent protein (EGFP) Living Colors antibody, and expression vector pRevTRE were obtained from Clontech. The Frozen-EZ Yeast Transformation II kit was from Zymo Research. Restriction enzymes and T4 DNA ligase were obtained from New England Biolabs Inc. The QIAprep spin miniprep kit and plasmid midi kit and the pDRIVE PCR cloning kit were purchased from QIAGEN Inc. The Geneclean III kit was from BIO 101, Inc. Biomax MR and Biomax MS autoradiography films were from Eastman Kodak. The Thermoscript RT-PCR kit, Platinum Taq polymerase, plasmid pcDNA3.1, Dulbecco's modified Eagle's medium, Dulbecco's phosphate-buffered saline (D-PBS), trypsin/EDTA, Express Five SFM medium, Cellfectin, anti-Myc monoclonal antibody, and customized oligonucleotide primers were obtained from Invitrogen. Fetal bovine serum was from Hyclone Laboratories. The baculovirus expression vector pAcG2T and BaculoGold baculovirus helper DNA were from Pharmingen. Genejammer transfection reagent and Escherichia coli XL2-Blue were from Stratagene. TransIT-LT1 transfection reagent was from Mirus. Tris-buffered saline and SuperSignal chemiluminescent reagent were from Pierce. Bacterial expression vector pGEX2-T and reduced glutathione-Sepharose were obtained from Amersham Biosciences. Immuno-Fluore mounting medium and [γ-32P]GTP were from ICN Biomedicals, Inc. [γ-32P]ATP was obtained from PerkinElmer Life Sciences. Mouse RNA from various tissues was a gift from Dr. S. Duncan (Medical College of Wisconsin). Rabbit anti-PS-GAP polyclonal antibody was a gift from Dr. W.-C. Xiong (University of Alabama at Birmingham, Birmingham, AL). Anti-FLAG monoclonal antibody, agarose-conjugated anti-FLAG monoclonal antibody, and anti-hemagglutinin (HA) monoclonal antibody were obtained from Sigma. Agarose-conjugated anti-HA polyclonal antibody was obtained from Santa Cruz Biotechnology. Mammalian expression vectors pExpress/HA and pRetroIRES/GFP were generated previously (42Jakobi R. McCarthy C.C. Koeppel M.A. Stringer D.K. J. Biol. Chem. 2003; 278: 38675-38685Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar, 45Jakobi R. McCarthy C.C. Koeppel M.A. BioTechniques. 2002; 33: 1218-1222Crossref PubMed Scopus (9) Google Scholar). Mammalian expression clones for FLAG-tagged PAK-2p34 and PAK-2p34-K278R in pRetroIRES/GFP (42Jakobi R. McCarthy C.C. Koeppel M.A. Stringer D.K. J. Biol. Chem. 2003; 278: 38675-38685Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar) and for FLAG-tagged PAK-2, PAK-2-L106F, and PAK-2-K278R in pRevTRE 2R. Jakobi, unpublished data. were generated previously. Plasmid pMT107 encoding His-tagged ubiquitin (46Treier M. Staszewski L.M. Bohmann D. Cell. 1994; 78: 787-798Abstract Full Text PDF PubMed Scopus (845) Google Scholar) was provided by Dr. D. Bohmann (University of Rochester, Rochester, NY). The TnT T7 coupled reticulocyte lysate system for in vitro transcription/translation was from Promega. Yeast Two-hybrid Library Screening and Analysis—The kinase-deficient PAK-2p34-K278R mutant was subcloned into the Gal4 DNA-binding domain vector pAS2-1 in-frame with the Gal4 DNA-binding domain. The PAK-2p34-K278R bait was used to screen a mouse embryonic fibroblast cDNA library in vector pACT2 (47Fields S. Song O. Nature. 1989; 340: 245-247Crossref PubMed Scopus (4799) Google Scholar). Yeast PJ69-4a cells were cotransformed with 0.2 mg of both bait and library plasmids using the Frozen-EZ yeast transformation II kit and plated onto leucine-, tryptophan-, and histidine-deficient medium. Yeast cells were allowed to grow and form colonies on this medium for 2 weeks before replating onto adenine-deficient medium. Adenine-deficient medium allows for stringent growth selection of yeast cells that are capable of transcribing the ADE2 reporter gene, which is under the control of the GAL4 promoter in strain PJ69-4a (44James P. Halladay J. Craig E.A. Genetics. 1996; 144: 1425-1436Crossref PubMed Google Scholar). All colonies capable of growth on adenine-deficient medium were considered potential positive clones. Plasmid DNA was isolated from these clones by digestion with lyticase using QIAGEN spin column miniprep kits. Plasmid DNA was propagated in E. coli XL2-Blue and analyzed by restriction digestion and DNA sequencing. Unique library clones were transformed into yeast strain Y190 with various PAK-2 constructs in pAS2-1 or in a pAS2-1 empty vector control. Filter-lift β-galactosidase assays were performed to assay for interactions and to eliminate false positives. Glutathione S-Transferase (GST) Pull-down Assays—GST fusion proteins of wild-type and mutant PAK-2 were expressed in E. coli or baculovirus-infected insect cells and purified as described previously (37Walter B.N. Huang Z. Jakobi R. Tuazon P.T. Alnemri E.S. Litwack G. Traugh J.A. J. Biol. Chem. 1998; 273: 28733-28739Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar, 48Jakobi R. Huang Z. Walter B.N. Tuazon P.T. Traugh J.A. Eur. J. Biochem. 2000; 267: 4414-4421Crossref PubMed Scopus (19) Google Scholar). p/K18 cDNA was subcloned into pcDNA3.1, and protein was synthesized and labeled with [35S]methionine by a coupled in vitro transcription/translation reaction. An aliquot of 10 μg of GST fusion protein was mixed with 10% of the in vitro transcription/translation reaction in 200 μl of pull-down buffer (50 mm HEPES (pH 7.5), 150 mm NaCl, 1 mm EGTA, 1.5 mm MgCl2, and 1% Triton X-100) plus 0.8% bovine serum albumin and incubated on ice for 1 h. An aliquot of 20 μl of glutathione-Sepharose beads was added, and the mixture was incubated for 1 h at 4 °C. Beads were washed with pull-down buffer and analyzed by SDS-PAGE and autoradiography. Molecular Cloning—To obtain full-length PS-GAP cDNA, mouse heart cDNA was amplified by PCR (49Mullis K.B. Faloona F.A. Methods Enzymol. 1987; 155: 335-350Crossref PubMed Scopus (3797) Google Scholar) using the forward primer PS-GAP-5′ (5′-TTGTGTTCATATGGGGCTGCAGCCCCTGGAGTTTA), corresponding to the start codon region of PS-GAP (43Ren X.R. Du Q.S. Huang Y.Z. Ao S.Z. Mei L. Xiong W-C. J. Cell Biol. 2001; 152: 971-984Crossref PubMed Scopus (99) Google Scholar), and the reverse primer PS-GAP-3′ (5′-ACATTCTAGACTACAGGAGCTTGACATAATTCTGTGGA), corresponding to the stop codon region of clone p/K18 and elongated using the Advantage 2 PCR kit according to the manufacturer's instructions. PCR products were purified by agarose gel electrophoresis and extraction using the Geneclean III kit and ligated into the pDRIVE vector. Clones were identified through plasmid isolation using QIAprep spin miniprep kits, followed by restriction digestion and agarose gel electrophoresis. Selected clones were analyzed by DNA sequencing. Sequences were assembled and analyzed using Vector NTI Suite 7.1 (Informax). BLAST (NCBI Protein Database) was used for homology searches. To facilitate subcloning of PS-GAP, an internal BamHI site in PS-GAP-a was disrupted by site-directed mutagenesis according to the megaprimer PCR method (50Sarkar G. Sommer S.S. BioTechniques. 1990; 8: 404-407PubMed Google Scholar, 51Jakobi R. Traugh J.A. J. Biol. Chem. 1992; 267: 23894-23902Abstract Full Text PDF PubMed Google Scholar) without changing the amino acid sequence. The megaprimer was amplified with PS-GAP-5′ and ΔBamHI-3′ (TCCTCTTCGAGCTCCGCTTCGTGCGCGCGCGTATCCTCTCCCGGAACCA) using full-length PS-GAP-a as a template. Then, the megaprimer was used together with PS-GAP-3′ to amplify full-length PS-GAP-a. The cDNA encoding PS-GAP-a with the disrupted BamHI site was subcloned into pExpress/HA and pExpress/Myc for expression in mammalian cells. Reverse Transcription (RT)-PCR—cDNA was reverse-transcribed using total RNA from mouse brain, heart, kidney, liver, and testes and BALB/3T3 mouse fibroblasts with the Thermoscript RT-PCR kit. Primer pair P1/P2 (P1, 5′-AACTACGCATATGATTCCATTTGAGCACAGATC; and P2, 5′-CAATCTGCAGAATTCTCCAGG) and primer pair P3/P4 (P3, 5′-TAACAGTCATATGAAGATTTTTCGAACCTCGCCTG; and P4, 5′-CTGATGGATCCTTATGCCCGAGCCTTTCGATTGAT) were used at 0.2 μm to amplify an aliquot of the RT reactions by PCR for 40 cycles with Platinum Taq polymerase. Products were separated by gel electrophoresis on 2% agarose gels and visualized by ethidium bromide staining. Cell Culture and Transfection—Human embryonic kidney 293T cells (American Tissue Culture Collection) were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and penicillin/streptomycin and grown at 37 °C in a humidified atmosphere of 5% CO2. For transfection, cells were seeded at densities that will allow them to reach 50% confluency within 16-24 h. Plasmid DNAs for epitope-tagged PS-GAP-a and PAK-2 constructs were transfected into cells using Genejammer or TransIT-LT1 transfection reagent. At 48 h after transfection, cells were harvested and lysed. To stabilize recombinant PAK-2p34, cells were cotransfected with pMT107 encoding His-tagged ubiquitin (42Jakobi R. McCarthy C.C. Koeppel M.A. Stringer D.K. J. Biol. Chem. 2003; 278: 38675-38685Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar). Immunoprecipitation and Western blotting—293T cells transfected with epitope-tagged PS-GAP-a and PAK-2 constructs were lysed in modified radioimmune precipitation assay buffer (50 mm HEPES (pH 7.5), 150 mm NaCl, 1% Triton X-100, 0.25% deoxycholate, 10 μg/ml aprotinin, 10 μg/ml leupeptin, 1 mm phenylmethylsulfonyl fluoride, and 0.2 mm sodium orthovanadate). Protein concentrations were determined by the Bradford assay using bovine γ-globulin as a protein standard. 500 μg of lysate protein was diluted with PBS to a final concentration of ∼5 μg/μl and incubated overnight with 20 μl of agarose-conjugated anti-FLAG or anti-HA antibody at 4 °C. Immunocomplexes were washed with pull-down buffer (50 mm HEPES (pH 7.5), 150 mm NaCl, 1 mm EGTA, 1.5 mm MgCl2, and 1% Triton X-100) and analyzed by Western blotting. Western blotting was performed using cell lysates (30 μg of protein) or immunoprecipitates (from 150-250 μg of cell lysate) by SDS-PAGE, followed by semidry transfer to polyvinylidene membranes. Chemiluminescence detection was performed using SuperSignal reagent and horseradish peroxidase-conjugated secondary antibodies. Rho-GAP Assays—RhoA, Rac1, and Cdc42 were expressed in E. coli XL2-Blue as GST fusion proteins using pGEX2-T, whereas PS-GAP-a was expressed as a GST fusion protein in TN-5B1-4 cells using pAcG2T. Recombinant GST fusion proteins were absorbed to glutathione-Sepharose as described above and eluted with 10 mm reduced glutathione. Purified GST-RhoA, GST-Rac1, and GST-Cdc42 were dialyzed overnight at 4 °C in 40 mm Tris-HCl (pH 7.5), 5 mm EDTA, 1% β-mercaptoethanol, and 10% glycerol. For Rho-GAP assays, G-proteins were preloaded at 30 °C for 5 min using 50 mm Tris-HCl (pH 7.6), 2 mm EDTA, 100 mm NH4Cl, 0.5 mg/ml bovine serum albumin, 1 mm dithiothreitol, and 0.1 mm [γ-32P]GTP (800 cpm/pmol) and placed on ice. MgCl2 and GTP were added to 12 and 2 mm, respectively. GTPase activity was monitored by incubating preloaded Rho GTPase for 5 min at room temperature in the absence or presence of PS-GAP and spotting on nitrocellulose filters. Filters were washed with 10 ml of wash buffer (50 mm Tris-HCl (pH 7.6), 100 mm NH4Cl, 1 mm MgCl2, and 7 mm β-mercaptoethanol) and dried, and the remaining [γ-32P]GTP was analyzed by scintillation counting. The effects of PAK-2p34 on GTPase activity were measured by preincubation of PS-GAP-a with 10 mm MgCl2 and 200 μm ATP for 15 min at 30 °C in the presence or absence of GST-PAK-2p34 prior to performing the GAP assay as outlined above. Kinase Assays—Autophosphorylation and kinase activity of purified recombinant GST-PAK-2p34 (0.1-0.2 μg) and GST-PAK-2-T402E (0.1-0.2 μg) were determined in 50 mm Tris-HCl (pH 7.4), 10 mm MgCl2, 2 mm dithiothreitol, and 200 μm [γ-32P]ATP (1000 cpm/pmol) for 30 min at 30 °C. 1 μg of myelin basic protein or histone H4 was used as substrate. Kinase assays were performed in the presence and absence of puri" @default.
• W2040317062 created "2016-06-24" @default.
• W2040317062 creator A5000654125 @default.
• W2040317062 creator A5002709834 @default.
• W2040317062 creator A5004787238 @default.
• W2040317062 creator A5053562135 @default.
• W2040317062 date "2004-12-01" @default.
• W2040317062 modified "2023-10-03" @default.
• W2040317062 title "Identification and Characterization of PS-GAP as a Novel Regulator of Caspase-activated PAK-2" @default.
• W2040317062 cites W118096402 @default.
• W2040317062 cites W1481746756 @default.
• W2040317062 cites W1517480469 @default.
• W2040317062 cites W1524340844 @default.
• W2040317062 cites W1548084460 @default.
• W2040317062 cites W1556727056 @default.
• W2040317062 cites W1605336763 @default.
• W2040317062 cites W1662447390 @default.
• W2040317062 cites W174780749 @default.
• W2040317062 cites W1826215572 @default.
• W2040317062 cites W1826874877 @default.
• W2040317062 cites W1903792504 @default.
• W2040317062 cites W1969814333 @default.
• W2040317062 cites W1973891472 @default.
• W2040317062 cites W1975183482 @default.
• W2040317062 cites W1977186059 @default.
• W2040317062 cites W1980149853 @default.
• W2040317062 cites W1984967137 @default.
• W2040317062 cites W1989987282 @default.
• W2040317062 cites W2002223631 @default.
• W2040317062 cites W2003111282 @default.
• W2040317062 cites W2009461629 @default.
• W2040317062 cites W2009575166 @default.
• W2040317062 cites W2011756230 @default.
• W2040317062 cites W2015932636 @default.
• W2040317062 cites W2022807358 @default.
• W2040317062 cites W2025646149 @default.
• W2040317062 cites W2030140160 @default.
• W2040317062 cites W2030192350 @default.
• W2040317062 cites W2032515511 @default.
• W2040317062 cites W2033737458 @default.
• W2040317062 cites W2038333370 @default.
• W2040317062 cites W2041966576 @default.
• W2040317062 cites W2043444434 @default.
• W2040317062 cites W2048643631 @default.
• W2040317062 cites W2055289589 @default.
• W2040317062 cites W2061987693 @default.
• W2040317062 cites W2064785971 @default.
• W2040317062 cites W2067046669 @default.
• W2040317062 cites W2076398093 @default.
• W2040317062 cites W2095291395 @default.
• W2040317062 cites W2103164402 @default.
• W2040317062 cites W2106140806 @default.
• W2040317062 cites W2107164894 @default.
• W2040317062 cites W2107960969 @default.
• W2040317062 cites W2123951853 @default.
• W2040317062 cites W2127221803 @default.
• W2040317062 cites W2129277563 @default.
• W2040317062 cites W2137618759 @default.
• W2040317062 cites W2161340336 @default.
• W2040317062 cites W2163321605 @default.
• W2040317062 cites W2166432534 @default.
• W2040317062 cites W2167630501 @default.
• W2040317062 cites W4313379450 @default.
• W2040317062 doi "https://doi.org/10.1074/jbc.m410530200" @default.
• W2040317062 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15471851" @default.
• W2040317062 hasPublicationYear "2004" @default.
• W2040317062 type Work @default.
• W2040317062 sameAs 2040317062 @default.
• W2040317062 citedByCount "23" @default.
• W2040317062 countsByYear W20403170622012 @default.
• W2040317062 countsByYear W20403170622014 @default.
• W2040317062 countsByYear W20403170622018 @default.
• W2040317062 countsByYear W20403170622019 @default.
• W2040317062 countsByYear W20403170622021 @default.
• W2040317062 countsByYear W20403170622022 @default.
• W2040317062 countsByYear W20403170622023 @default.
• W2040317062 crossrefType "journal-article" @default.
• W2040317062 hasAuthorship W2040317062A5000654125 @default.
• W2040317062 hasAuthorship W2040317062A5002709834 @default.
• W2040317062 hasAuthorship W2040317062A5004787238 @default.
• W2040317062 hasAuthorship W2040317062A5053562135 @default.
• W2040317062 hasBestOaLocation W20403170621 @default.
• W2040317062 hasConcept C104317684 @default.
• W2040317062 hasConcept C116834253 @default.
• W2040317062 hasConcept C171250308 @default.
• W2040317062 hasConcept C185592680 @default.
• W2040317062 hasConcept C192562407 @default.
• W2040317062 hasConcept C2780841128 @default.
• W2040317062 hasConcept C55493867 @default.
• W2040317062 hasConcept C59822182 @default.
• W2040317062 hasConcept C6929976 @default.
• W2040317062 hasConcept C70721500 @default.
• W2040317062 hasConcept C86803240 @default.
• W2040317062 hasConcept C95444343 @default.
• W2040317062 hasConceptScore W2040317062C104317684 @default.
• W2040317062 hasConceptScore W2040317062C116834253 @default.
• W2040317062 hasConceptScore W2040317062C171250308 @default.
• W2040317062 hasConceptScore W2040317062C185592680 @default.

• next