FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2040358766> ?p ?o ?g. }

• W2040358766 endingPage "6045" @default.
• W2040358766 startingPage "6035" @default.
• W2040358766 abstract "We have analyzed the expression and function of Cecpz-1, a Caenorhabditis elegans cathepsin Z-like cysteine protease gene, during development of the worm. The cpz-1 gene is expressed in various hypodermal cells of all developmental stages and is specifically expressed in the gonads and the pharynx of adult worms. Disruption of cpz-1 function by RNA interference or cpz-1(ok497) deletion mutant suggests that cpz-1 has a role in the molting pathways. The presence of the native CPZ-1 protein in the hypodermis/cuticle of larval and adult stages and along the length of the pharynx of adult worms, as well as the cyclic expression of the transcript during larval development, supports such function. We hypothesize that the CPZ-1 enzyme functions directly as a proteolytic enzyme degrading cuticular proteins before ecdysis and/or indirectly by processing other proteins such as proenzymes and/or other proteins that have an essential role during molting. Notably, an impressive level of the CPZ-1 native protein is present in both the new and the old cuticles during larval molting, in particular in the regions that are degraded prior to shedding and ecdysis. The similar localization of the related Onchocerca volvulus cathepsin Z protein suggests that the function of CPZ-1 during molting might be conserved in other nematodes. Based on the cpz-1 RNA interference and cpz-1 (ok497) deletion mutant phenotypes, it appears that cpz-1 have additional roles during morphogenesis. Deletion of cpz-1 coding sequence or inhibition of cpz-1 function by RNA interference also caused morphological defects in the head or tail region of larvae, improperly developed gonad in adult worms and embryonic lethality. The CPZ-1 native protein in these affected regions may have a role in the cuticular and the basement membrane extracellular matrix assembly process. The present findings have defined a critical role for cathepsin Z in nematode biology. We have analyzed the expression and function of Cecpz-1, a Caenorhabditis elegans cathepsin Z-like cysteine protease gene, during development of the worm. The cpz-1 gene is expressed in various hypodermal cells of all developmental stages and is specifically expressed in the gonads and the pharynx of adult worms. Disruption of cpz-1 function by RNA interference or cpz-1(ok497) deletion mutant suggests that cpz-1 has a role in the molting pathways. The presence of the native CPZ-1 protein in the hypodermis/cuticle of larval and adult stages and along the length of the pharynx of adult worms, as well as the cyclic expression of the transcript during larval development, supports such function. We hypothesize that the CPZ-1 enzyme functions directly as a proteolytic enzyme degrading cuticular proteins before ecdysis and/or indirectly by processing other proteins such as proenzymes and/or other proteins that have an essential role during molting. Notably, an impressive level of the CPZ-1 native protein is present in both the new and the old cuticles during larval molting, in particular in the regions that are degraded prior to shedding and ecdysis. The similar localization of the related Onchocerca volvulus cathepsin Z protein suggests that the function of CPZ-1 during molting might be conserved in other nematodes. Based on the cpz-1 RNA interference and cpz-1 (ok497) deletion mutant phenotypes, it appears that cpz-1 have additional roles during morphogenesis. Deletion of cpz-1 coding sequence or inhibition of cpz-1 function by RNA interference also caused morphological defects in the head or tail region of larvae, improperly developed gonad in adult worms and embryonic lethality. The CPZ-1 native protein in these affected regions may have a role in the cuticular and the basement membrane extracellular matrix assembly process. The present findings have defined a critical role for cathepsin Z in nematode biology. Based on the identification and characterization of a cysteine protease in human brain, a new subfamily of cysteine proteases of the papain family, the cathepsin Z-like enzyme, was recently classified (1Santamaria I. Velasco G. Pendas A.M. Fueyo A. Lopez-Otin C. J. Biol. Chem. 1998; 273: 16816-16823Abstract Full Text Full Text PDF PubMed Scopus (114) Google Scholar). The human brain cathepsin Z was, however, found to be widely expressed in many tissues, suggesting that this enzyme is possibly involved in the normal intracellular protein degradation that takes place in all cell types. Notably, the enzyme was also found in many cancer cell lines and in primary tumors from different sources, which also suggested a role for this enzyme in tumor progression (1Santamaria I. Velasco G. Pendas A.M. Fueyo A. Lopez-Otin C. J. Biol. Chem. 1998; 273: 16816-16823Abstract Full Text Full Text PDF PubMed Scopus (114) Google Scholar). The human cathepsin Z contains distinctive features that separate it from other human cysteine proteases (2Nagler D.K. Menard R. FEBS Lett. 1998; 434: 135-139Crossref PubMed Scopus (91) Google Scholar). Cathepsin Z is characterized by an unusual and unique 3-amino acid insertion (HIP) in the highly conserved region between the glutamine of the putative oxyanion hole and the active site cysteine, which might confer special properties to the enzyme (3Nagler D.K. Zhang R. Tam W. Sulea T. Purisima E.O. Menard R. Biochemistry. 1999; 38: 12648-12654Crossref PubMed Scopus (115) Google Scholar). It functional diversity is generated by the addition of the HIP residues including His23 in the mature enzyme that provides an anchor for the C terminus of a substrate, thereby allowing favorable enzyme-substrate interaction independent of the P2-P1 sequence. In another study, cathepsin Z-like enzyme (CPZ) 1The abbreviations used are: CPZcysteine protease cathepsin Z-like proteinama-1α-amanitin-resistant geneBLASTbasic local alignment search toolcpz-1cysteine protease cathepsin Z-like geneDAPI4′6-diamidino-2-phenylindoledsRNAdouble-stranded RNAGFPgreen fluorescence proteinkbkilobase(s)L1first-stage larvaeL2second-stage larvaeL3third-stage larvaeL4fourth-stage larvaelacZβ-galactosidase geneRNAiRNA interferenceRTreverse transcriptasePBSphosphate-buffered salineNLSnuclear localization signalNGMnematode growth mediumECMextracellular matrixGSTglutathione S-transferase.1The abbreviations used are: CPZcysteine protease cathepsin Z-like proteinama-1α-amanitin-resistant geneBLASTbasic local alignment search toolcpz-1cysteine protease cathepsin Z-like geneDAPI4′6-diamidino-2-phenylindoledsRNAdouble-stranded RNAGFPgreen fluorescence proteinkbkilobase(s)L1first-stage larvaeL2second-stage larvaeL3third-stage larvaeL4fourth-stage larvaelacZβ-galactosidase geneRNAiRNA interferenceRTreverse transcriptasePBSphosphate-buffered salineNLSnuclear localization signalNGMnematode growth mediumECMextracellular matrixGSTglutathione S-transferase. was shown to exhibit carboxymonopeptidase as well as carboxydipeptidase activity (4Guncar G. Klemencic I. Turk B. Turk V. Karaoglanovic-Carmona A. Juliano L. Turk D. Structure. 2000; 8: 305-313Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar). Moreover, the pro-region of the cathepsin Z is the shortest known to exist in the papain family, and it does not share any significant similarity with the other cathepsin family sequences (1Santamaria I. Velasco G. Pendas A.M. Fueyo A. Lopez-Otin C. J. Biol. Chem. 1998; 273: 16816-16823Abstract Full Text Full Text PDF PubMed Scopus (114) Google Scholar), suggesting that the structural basis for regulating the activity and the processing of this zymogen might be different from that of the other members of the papain family. cysteine protease cathepsin Z-like protein α-amanitin-resistant gene basic local alignment search tool cysteine protease cathepsin Z-like gene 4′6-diamidino-2-phenylindole double-stranded RNA green fluorescence protein kilobase(s) first-stage larvae second-stage larvae third-stage larvae fourth-stage larvae β-galactosidase gene RNA interference reverse transcriptase phosphate-buffered saline nuclear localization signal nematode growth medium extracellular matrix glutathione S-transferase. cysteine protease cathepsin Z-like protein α-amanitin-resistant gene basic local alignment search tool cysteine protease cathepsin Z-like gene 4′6-diamidino-2-phenylindole double-stranded RNA green fluorescence protein kilobase(s) first-stage larvae second-stage larvae third-stage larvae fourth-stage larvae β-galactosidase gene RNA interference reverse transcriptase phosphate-buffered saline nuclear localization signal nematode growth medium extracellular matrix glutathione S-transferase. Interestingly, cDNA sequences encoding cathepsin Z-like enzymes have been identified among both parasitic and free-living nematodes (5Falcone F.H. Tetteh K.K. Hunt P. Blaxter M.L. Loukas A. Maizels R.M. Exp. Parasitol. 2000; 94: 201-207Crossref PubMed Scopus (20) Google Scholar, 6Lustigman S. McKerrow J.H. Shah K. Lui J. Huima T. Hough M. Brotman B. J. Biol. Chem. 1996; 271: 30181-30189Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar). The only two published nematode cathepsin Z-like enzymes were postulated to function during molting (6Lustigman S. McKerrow J.H. Shah K. Lui J. Huima T. Hough M. Brotman B. J. Biol. Chem. 1996; 271: 30181-30189Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar), which is an obligatory process for nematode development and potentially in other fundamental biochemical processes that are still undefined (5Falcone F.H. Tetteh K.K. Hunt P. Blaxter M.L. Loukas A. Maizels R.M. Exp. Parasitol. 2000; 94: 201-207Crossref PubMed Scopus (20) Google Scholar). The role of the Onchocerca volvulus CPZ during molting was evidenced by its distinct localization, as determined by using monospecific antibodies raised against the O. volvulus LOVCP enzyme (renamed Ov-CPZ) and thin sections of the parasitic nematode. The native enzyme was localized in the region where the separation between the cuticles of the third-stage larvae (L3) and the fourth-stage larvae (L4) during molting takes place (6Lustigman S. McKerrow J.H. Shah K. Lui J. Huima T. Hough M. Brotman B. J. Biol. Chem. 1996; 271: 30181-30189Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar). The homologous enzyme in Toxocara canis (Tc-CPZ), however, was also highly expressed in adult stages, which precluded its exclusive role during T. canis molting. Unfortunately, it is still difficult to elucidate gene functions directly in parasitic nematodes because of the lack of molecular genetic approaches to directly investigate the role of a desired gene in the biology/biochemistry of these organisms. To conclusively uncover the broad range of the cathepsin Z enzyme function in the parasitic nematodes, we took advantage of the presence of CPZ-encoding sequences in the free-living nematode, Caenorhabditis elegans, and the availability of molecular tools that provide for high throughput characterization of genes in this powerful model system. The C. elegans has only two genes that encode cathepsin Z-like cysteine proteases, which we named Ce-cpz-1 (F32B5.8) and Ce-cpz-2 (M04G12.2); this makes it an ideal in vivo system for studying the putative functions of the homologous genes in the parasitic nematodes for which the most important biochemical interactions are likely to be conserved (7Hashmi S. Wilson T. Lustigman S. Trends Parasitol. 2001; 17: 387-393Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar, 8Burling R.T. Lobos E. Blaxter M.L. Int. J. Parasitol. 1998; 28: 395-411Crossref PubMed Scopus (143) Google Scholar). The use of the C. elegans model system for the study of homologous genes found in many other organisms including humans has already revolutionized the progress toward the confirmation of genes that can become targets for new drug development (7Hashmi S. Wilson T. Lustigman S. Trends Parasitol. 2001; 17: 387-393Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar, 8Burling R.T. Lobos E. Blaxter M.L. Int. J. Parasitol. 1998; 28: 395-411Crossref PubMed Scopus (143) Google Scholar). The amino acid sequence of Ce-CPZ-1 is 82 and 73% identical to the O. volvulus and T. canis CPZ enzymes, whereas Ce-CPZ-2 shows only 57 and 53% identity, respectively. Because of the greater identity of Ce-CPZ-1 to the parasitic nematode sequences, we chose to study the functional role of Ce-CPZ-1 during C. elegans development as the model system for the parasitic CPZ enzymes, and consequently validate whether these enzymes in the parasitic nematodes could become potential targets for the development of therapeutic intervention. Cysteine proteases in many other parasite systems have been identified as potential targets for drug or vaccine development (9Tort J. Brindley P.J. Knox D. Wolfe K.H. Dalton J.P. Adv. Parasitol. 1999; 48: 161-266Crossref Google Scholar, 10Dalton J.P. McGonigle S. Rolph T.P. Andrew S.J. Infect. Immun. 1996; 64: 5066-5074Crossref PubMed Google Scholar). The Cathepsin Z-like Cysteine Proteases of C. elegans—A BLAST search (11Altschul S.F. Gish W. Miller W. Myers E.W. Lipman D.J. J. Mol. Biol. 1990; 215: 403-410Crossref PubMed Scopus (69694) Google Scholar) of ACeDB, the C. elegans data base (www.sanger.ac.uk/projects/C_elegans/wormpep/1) using the O. volvulus Ov-CPZ amino acid sequence (U71150) identified two predicted C. elegans cathepsin Z-like genes (F32B5.8 and M04G12.2), which we named Ce-cpz-1 and Ce-cpz-2, respectively. Alignment of the CPZ protein sequences within the GenBank™ data base was made using ClusterW multiple sequence alignment. The Ce-CPZ-1 protein encoded by the F32B5.8 gene had the highest similarity with the Ov-CPZ protein (82%) in comparison to 57% identity of Ce-CPZ-2 with Ov-CPZ, and is therefore the focus of the studies outlined below. Few cDNA clones corresponding to the F32B5.8 gene were identified in the Expressed Sequence Tag Data Base, one of which contained the full-length Ce-cpz-1 cDNA sequence (clone yk94b1, accession no. D66235). The pBluescript phagemid of the λZAPII phage of clone yk94b1 (obtained from Yuji Kohara, C. elegans Consortium, National Institute of Genetics, Mishima, Japan) was excised and the DNA sequenced in both directions to confirm the predicted amino acid sequence of the F32B5.8 gene. Based on the cDNA sequence and trans-splicing patterns, there appear to be 5 exons in the F32B5.8 gene instead of 7 exons as predicted by Genefinder. In addition, we amplified the corresponding SL1 trans-spliced cDNA product from total RNA, and its sequence has confirmed the first ATG codon in the yk94b1 cDNA clone. The signal sequence and its putative cleavage site were identified using the SignalP Server (www.cbs.dtu.dk/services/SignalP). Analysis of the putative promoter region of Ce-cpz-1 gene was performed using Genefinder provided by the BCM server (www.hgsc.bcm.tmc.edu/searchlauncher). Stage-specific Profile of the Ce-cpz-1 mRNA Transcript Using Real-time PCR—A synchronous population of arrested first-stage larvae (L1) was prepared by treatment of gravid hermaphrodites with sodium hypochlorite and subsequent hatching from the embryos overnight in water (12Sulston J. Hodgkin J. Wood,. B. The Nematode, Caenorhabditis elegans. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1988: 587-606Google Scholar). The arrested L1 were then transferred onto NGM agarose plates seeded with bacteria, which allowed the collection of synchronous worms over a 40-h period during L1 to young adult C. elegans development at 2-h intervals (Fig. 2), as previously described (13Johnstone I.L. Barry J.D. EMBO J. 1996; 15: 3633-3639Crossref PubMed Scopus (133) Google Scholar). Approximately 40,000 worms collected from each stage were washed several times with autoclaved distilled water and stored at -70 °C until needed. Total RNA was prepared from embryos and from all the other developmental stages using TRIzol™ reagent (Invitrogen) according to manufacturer's instructions. First strand cDNA was generated from 1 μg of total RNA using the Omniscript RT kit (Qiagen, Valencia, CA) and priming with random hexamers. The specific cDNA fragment of Ce-cpz-1 was then amplified using the forward 5′-GCTTCTTCGGCTTATGGC-3′ and the reverse 5′-AACTGACAGATAGGCTTGTGG-3′ primers and the copy number quantified by real-time PCR using QuantiTech™ SYBR Green PCR kit (Qiagen). Another set of primers, forward 5′-GCATTGTCTCACGCGTTCAG-3′ and reverse 5′-TTCTTCCTTCTCCGCTGCTC-3′, was used for the specific amplification of an internal control, the ama-1 transcript (13Johnstone I.L. Barry J.D. EMBO J. 1996; 15: 3633-3639Crossref PubMed Scopus (133) Google Scholar). Both sets of primers were designed to span an intron to distinguish cDNA from contaminating gDNA products. The following PCR conditions, which allowed reactants to remain in excess, were used: 50 °C for 2 min, 95 °C for 15 min, followed by 45 cycles of 94 °C for 15 s, 62 °C for 30 s, and 72 °C for 45 s. To determine the copy number of each transcript within the stage-specific cDNA preparations, standard curves for cpz-1 and ama-1 were drawn based on quantitative PCR using known amounts of template DNA in a range of 10-106 copies. The relative content of the transcript corresponding to cpz-1 is expressed in each developmental stage as the ratio between its copy numbers relative to that of ama-1. Construction of cpz-1 Transgenic C. elegans Strains—Two types of reporter fusion construct were generated. The transcriptional fusion construct designated pSL108A contained a 2.3-kb promoter region of the Ce-cpz-1 and was generated by PCR from C. elegans genomic DNA (Fig. 1C). It was cloned into the lacZ reporter vector pPD90.23, which contains the nuclear localization signal (NLS) motif. The translational fusion gene constructs designated pSL103 and pSL107A contained a genomic fragment of Ce-cpz-1, which included a 1.4-kb promoter region and the first 4 exons (Fig. 1C). The gene fragment for these constructs was amplified from C. elegans genomic DNA and subsequently cloned into the PCR 2.1 cloning vector (TOPO cloning kit, Invitrogen) before excision and subcloning into two C. elegans expression vectors: 1) pPD95.75 (pSL103), which expressed the gene in frame with gfp; and 2) pPD90.23, which expressed the gene in frame with β-galactosidase (pSL107A) and in the nuclei of the worms. Sequencing of the final constructs was performed to confirm that the coding sequence of cpz-1 in both translational constructs was in frame with gfp or the lacZ sequences.Fig. 1A, sequence of the Ce-CPZ-1 promoter, cDNA, and the encoded protein. The promoter is in lowercase, and the cDNA sequence is in uppercase. The signal peptide of the protein is boxed. An arrow indicates the predicted post-translational cleavage site of the propeptide from the mature enzyme, and the asterisks indicate the cysteine, histidine, and asparagine residues within the active site. The conserved HIP motif, the cysteine active site CGSCWAF, and the CGSCW repeat amino acid sequences are in bold letters. The primers used for subcloning the gene fragments into the C. elegans expression vectors are underlined (transcription construct, pSL108A) and double underlined (translation constructs, pSL103; pSL107A). The transcriptional motifs within the putative promoter region are in uppercase. B, multiple alignment of the deduced amino acid sequence of O. volvulus cathepsin Z-like cysteine protease (Ov-CPZ) and its homologues, two C. elegans sequences (Ce-CPZ-1 and Ce-CPZ-2), T. canis (Tc-CPZ), and the human cathepsin Z-like enzyme from brain (Hs-CPZ). Arrow indicates the putative cleavage site of the signal peptide, the block arrow indicates the putative cleavage between the propeptide and the mature enzyme, and the asterisks indicate the cysteine, histidine, and asparagine residues within the active sites. ### indicates the conserved HIP motif in all the cathepsin Z sequences; the nematode-specific CGSCW repeat and the cysteine active site CGSCWAF sequence are boxed. C, genomic organization of the C. elegans Ce-cpz-1 gene. Exons are indicated as shaded boxes, and the numbers underneath indicate the amino acid residues within that exon. D, genomic organization of the O. volvulus Ov-cpz gene. Exons are indicated as shaded boxes; the size of the box indicates the size of exon in each gene. The conserved HIP motif, the cysteine (CGSCWAF), histidine, and the asparagine residues within the active site, the CGSCW repeat, and the cleavage sites for the signal peptide (arrowhead) and the propeptide (arrow) are marked in B and C. E, reporter constructs used to generate transgenic lines. Translational fusion constructs were generated by fusing a 1.4-kb promoter region upstream of cpz-1 and its first four exons in frame with gfp (pSL103) or lacZ (pSL107A). The transcriptional fusion construct was created by fusing a 2.3-kb promoter region upstream of the cpz-1 cDNA to a lacZ reporter construct (pSL108A). NLS, nuclear localization signal within the lacZ reporter constructs; ATG, the codon for the first methionine within the expression constructs.View Large Image Figure ViewerDownload Hi-res image Download (PPT) C. elegans adult hermaphrodites were transformed by microinjecting ∼80 ng/μl recombinant plasmid DNA, prepared using the Concert™ rapid plasmid miniprep system (Invitrogen), into their gonadal syntium as described previously (14Fire A. EMBO J. 1986; 5: 2673-2680Crossref PubMed Google Scholar, 15Mello C.C. Kramer J.M. Stinchcomb D. Ambros V. EMBO J. 1991; 10: 3959-3970Crossref PubMed Scopus (2425) Google Scholar). A plasmid DNA (pRF4) containing the dominant selectable marker gene rol-6 (su1006), which encodes a mutant collagen, was co-injected (∼80 ng/μl) with the Ce-cpz-1:lacZ or Ce-cpz-1:gfp fusion constructs. C. elegans expressing the rol-6 gene continuously roll over, thereby providing a visible phenotype for the selection of transgenic worms (16Kramer J.M. French R.P. Park E.C. Johnson J.J. Mol. Cell Biol. 1990; 10: 2081-2089Crossref PubMed Scopus (262) Google Scholar). F2 rollers were picked and transferred into individual Escherichia coli plates to establish a number of independent lines. Lines in which F3 and subsequent generations showed the roller phenotype were stained for β-galactosidase expression using DAPI (4′,6-diamidino-2-phenylindole, final concentration 0.1%) as a co-stain to aid in the identification of cell types (17Fire A. Genet. Anal. Tech. Appl. 1992; 9: 151-158Crossref PubMed Scopus (97) Google Scholar). cpz-1:gfp transgenes were visualized by mounting live transgenic worms on a 2% agarose pad in 0.01% sodium azide as described (18Hashmi S. Britton C. Liu J. Guiliano D.B. Oksov Y. Lustigman S. J. Biol. Chem. 2002; 277: 3477-3486Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar). Double-stranded RNA (dsRNA) Preparation and RNA Interference (RNAi)—RNAi procedure was carried out using dsRNA as described by Fire et al. (19Fire A. Xu S. Montgomery M.K. Kostas S.A. Driver S.E. Mello C.C. Nature. 1998; 391: 806-811Crossref PubMed Scopus (11650) Google Scholar) and Tabara et al. (20Tabara H. Grishok A. Mello C.C. Science. 1998; 282: 430-431Crossref PubMed Scopus (518) Google Scholar). The full-length Ce-cpz-1 cDNA clone (yk94b1) in pBluescript was used as the template for RNA synthesis. The cDNA was first amplified with commercially available T3 and T7 primers (Invitrogen) and then used with either T3 or T7 RNA polymerase for the single-stranded sense or antisense RNA synthesis using the MEGAscript high yield transcription kit (Ambion Inc., Austin, TX). To obtain dsRNA, equal amounts of T3 and T7 reaction products were mixed and incubated for 10 min at 68 °C, followed by 37 °C for 30 min to yield a final concentration of dsRNA at ∼5 μg/μl. Soaking with dsRNA (20Tabara H. Grishok A. Mello C.C. Science. 1998; 282: 430-431Crossref PubMed Scopus (518) Google Scholar) and feeding (21Timmons L. Fire A. Nature. 1998; 395: 854Crossref PubMed Scopus (1415) Google Scholar) with E. coli transformed with a plasmid DNA encoding cpz-1 were employed in the RNAi experiments. To determine the effect of cpz-1 gene disruption during post-embryonic development of C. elegans, RNAi was performed on synchronized L1, L2, L3, and L4 worms. The synchronized C. elegans population was prepared as described for stage-specific real-time PCR except that the L1, L2, L3, and L4 worms were collected at one point during their development: 8, 14, 21, and 28 h after transfer of hatched L1 worms to NGM plate, respectively. For RNAi using the soaking method, 40 C. elegans L1 and L2, 25 L3, and 20 L4 worms were incubated in 20 μl of 0.2 m sucrose in 0.1× PBS premixed with 1 μl of Lipofectin (Invitrogen) and containing cpz-1 dsRNA at a final concentration of 2 μg/μl. After 24 h, soaked larvae were transferred to individual E. coli plates and their development examined for 2-3 days. Stage-specific larvae soaked in 0.2 m sucrose, 0.1× PBS and Lipofectin but without dsRNA served as the control. For RNAi using the feeding method, stage-specific larvae were fed on HT115(DE3) bacteria expressing dsRNA of cpz-1. Briefly, full-length cpz-1 cDNA fragment (∼1 kb) was amplified from total RNA and was cloned into the L4440 feeding vector (21Timmons L. Fire A. Nature. 1998; 395: 854Crossref PubMed Scopus (1415) Google Scholar). The resulting plasmid was transformed into the HT115(DE3) RNase III-deficient E. coli strain. Single colonies of HT115 bacteria containing the cloned L4440 plasmid were selected on tetracycline plates and then were grown overnight in culture in Luria Broth with 50 μg/ml ampicillin, and seeded directly onto NGM plates with 1 mm isopropyl-1-thio-β-d-galactopyranoside and 50 μg/ml ampicillin. The induction of the Ce-cpz-1 dsRNA was carried out at room temperature overnight. Staged larvae obtained from synchronous culture were placed onto NGM plates containing seeded bacteria expressing cpz-1 dsRNA for 36 h using optimal induction and feeding conditions as described (22Kamath R.S. Martinez-Campos M. Zipperlen P. Fraser A.G. Ahringer J. Genome Biol. 2000; 2: 1-10Crossref Google Scholar). Non-induced bacteria served as a control. The treated worms were observed under light microscope using Nomarski optics. To detect the early effect on embryonic development in F1 generation, RNAi was also performed by injecting adult hermaphrodite worms with dsRNA (concentration ∼1 μg/μl) as previously described (20Tabara H. Grishok A. Mello C.C. Science. 1998; 282: 430-431Crossref PubMed Scopus (518) Google Scholar). The development of the F1 was observed over 2 days after egg laying. Each of the RNAi experiments described above was repeated at least three times. Initial Characterization of cpz-1 Mutant Worms—We obtained a C. elegans cpz-1 mutant strain RB732 (allele ok497) from the C. elegans Gene Knockout Consortium (Oklahoma Medical Research Foundation). The ok497 allele has a deletion that covers part of exon 1 and complete removal of exons 2, 3, and 4 within the F32B5.8 gene. This mutant was back-crossed four times using wild type N2 strain males at the beginning of the cross according to standard protocol and maintained as homozygous. The homozygous mutant was sequenced to confirm the deletion site, using inner right sequence primer ATCTTGAACCATCCGTGCTC corresponding to position 59-79 in relation to ATG start codon and inner left sequence CTTATGGCAAGGTTCGGAAG corresponding to position 2614-2633 in relation to ATG start codon. Individual homozygous cpz-1 (ok497) mutant hermaphrodites were grown on plates at 20 °C, and their self-progeny were used in several experiments. For temperature shift experiments, the cpz-1 mutants L3 or L4 were raised at 15, 20, or 25 °C to see the effects of different temperatures on the growth and development of the mutant worms. For morphological comparison between mutant and wild type strains, living animals were observed using Nomarski differential interference contrast microscopy. RT-PCR was performed on cpz-1 mutant strain to determine the effect of mutation on the production of the cpz-1 transcript. Production of Recombinant C. elegans CPZ-1 Fusion Polypeptide—A fragment of Ce-cpz-1 cDNA encoding the pro-region and the mature enzyme (amino acids 23-306, Fig. 1A) was amplified and cloned into the BamHI and XhoI sites of the pGEX4T-3 expression vector (Amersham Biosciences). The recombinant GST-CPZ-1 protein was expressed in E. coli strain HB101. As the recombinant protein was mostly expressed in the inclusion bodies, it was purified as follows: bacterial cells from a 500-ml culture were harvested and lysed by sonication in 40 ml of 50 mm Tris-HCl buffer, pH 8.0. The insoluble proteins were recovered by centrifugation at 12,000 × g for 15 min and re-sonicated in the same buffer one more time. After centrifugation, the pellet was suspended in 20 ml of 6 m urea in 50 mm Tris-HCl buffer, pH 8.0, and incubated at 37 °C for 10 min, followed by centrifugation at 14,000 rpm for 20 min. The soluble fraction was then subjected to preparative separation using the Prep Cell (Bio-Rad) according to the instructions from the manufacturer. Specific fractions containing the purified recombinant protein were identified by Western blot using antibodies against GST or antibodies against the homologous O. volvulus Ov-CPZ protein and pooled. The CPZ-1 protein was then cleaved from the GST fusion peptide by thrombin according to the recommendation from the manufacturer. A mouse anti-serum was raised against the purified CPZ-1 recombinant protein using the repetitive immunizations/multiple sites strategy (23Bynum J. Andrews J.L. Ellis B. Kull Jr., F.C. Austin E.A. Kilpatrick K.E. Hybridoma. 1999; 18: 407-411Crossref PubMed Scopus (13) Google Scholar, 24Ki" @default.
• W2040358766 created "2016-06-24" @default.
• W2040358766 creator A5004667433 @default.
• W2040358766 creator A5019664521 @default.
• W2040358766 creator A5071672663 @default.
• W2040358766 creator A5080685366 @default.
• W2040358766 date "2004-02-01" @default.
• W2040358766 modified "2023-09-30" @default.
• W2040358766 title "The Caenorhabditis elegans Cathepsin Z-like Cysteine Protease, Ce-CPZ-1, Has a Multifunctional Role during the Worms' Development" @default.
• W2040358766 cites W106780798 @default.
• W2040358766 cites W1486450190 @default.
• W2040358766 cites W1505828408 @default.
• W2040358766 cites W1525805237 @default.
• W2040358766 cites W1541154872 @default.
• W2040358766 cites W1647075334 @default.
• W2040358766 cites W1921244251 @default.
• W2040358766 cites W1951953893 @default.
• W2040358766 cites W1968792770 @default.
• W2040358766 cites W1971233190 @default.
• W2040358766 cites W1972346069 @default.
• W2040358766 cites W1976057810 @default.
• W2040358766 cites W1977812451 @default.
• W2040358766 cites W1985832934 @default.
• W2040358766 cites W1994989080 @default.
• W2040358766 cites W1998923049 @default.
• W2040358766 cites W2002628474 @default.
• W2040358766 cites W2013460786 @default.
• W2040358766 cites W2015468345 @default.
• W2040358766 cites W2021458499 @default.
• W2040358766 cites W2037490831 @default.
• W2040358766 cites W2040748498 @default.
• W2040358766 cites W2043949040 @default.
• W2040358766 cites W2044391994 @default.
• W2040358766 cites W2047063316 @default.
• W2040358766 cites W2049810157 @default.
• W2040358766 cites W2055043387 @default.
• W2040358766 cites W2062522669 @default.
• W2040358766 cites W2063473501 @default.
• W2040358766 cites W2063969544 @default.
• W2040358766 cites W2072002687 @default.
• W2040358766 cites W2073007524 @default.
• W2040358766 cites W2076397118 @default.
• W2040358766 cites W2081868094 @default.
• W2040358766 cites W2083624688 @default.
• W2040358766 cites W2092742937 @default.
• W2040358766 cites W2098188916 @default.
• W2040358766 cites W2118270653 @default.
• W2040358766 cites W2122163057 @default.
• W2040358766 cites W2125983595 @default.
• W2040358766 cites W2128491398 @default.
• W2040358766 cites W2129293106 @default.
• W2040358766 cites W2130162256 @default.
• W2040358766 cites W2134427448 @default.
• W2040358766 cites W2134458376 @default.
• W2040358766 cites W2135979513 @default.
• W2040358766 cites W2143066563 @default.
• W2040358766 cites W2157157836 @default.
• W2040358766 cites W2164102584 @default.
• W2040358766 cites W2169441235 @default.
• W2040358766 cites W2181530934 @default.
• W2040358766 cites W2323436686 @default.
• W2040358766 cites W306302075 @default.
• W2040358766 doi "https://doi.org/10.1074/jbc.m312346200" @default.
• W2040358766 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/14630920" @default.
• W2040358766 hasPublicationYear "2004" @default.
• W2040358766 type Work @default.
• W2040358766 sameAs 2040358766 @default.
• W2040358766 citedByCount "59" @default.
• W2040358766 countsByYear W20403587662012 @default.
• W2040358766 countsByYear W20403587662013 @default.
• W2040358766 countsByYear W20403587662014 @default.
• W2040358766 countsByYear W20403587662015 @default.
• W2040358766 countsByYear W20403587662017 @default.
• W2040358766 countsByYear W20403587662019 @default.
• W2040358766 countsByYear W20403587662020 @default.
• W2040358766 countsByYear W20403587662021 @default.
• W2040358766 countsByYear W20403587662022 @default.
• W2040358766 countsByYear W20403587662023 @default.
• W2040358766 crossrefType "journal-article" @default.
• W2040358766 hasAuthorship W2040358766A5004667433 @default.
• W2040358766 hasAuthorship W2040358766A5019664521 @default.
• W2040358766 hasAuthorship W2040358766A5071672663 @default.
• W2040358766 hasAuthorship W2040358766A5080685366 @default.
• W2040358766 hasBestOaLocation W20403587661 @default.
• W2040358766 hasConcept C104317684 @default.
• W2040358766 hasConcept C167844969 @default.
• W2040358766 hasConcept C181199279 @default.
• W2040358766 hasConcept C185592680 @default.
• W2040358766 hasConcept C190283241 @default.
• W2040358766 hasConcept C2776714187 @default.
• W2040358766 hasConcept C2777283782 @default.
• W2040358766 hasConcept C2778944004 @default.
• W2040358766 hasConcept C2779201268 @default.
• W2040358766 hasConcept C2780034444 @default.
• W2040358766 hasConcept C28021979 @default.
• W2040358766 hasConcept C2908725733 @default.
• W2040358766 hasConcept C31573885 @default.
• W2040358766 hasConcept C55493867 @default.

• next