FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2040415055> ?p ?o ?g. }

• W2040415055 endingPage "19370" @default.
• W2040415055 startingPage "19361" @default.
• W2040415055 abstract "Ubiquitination is essential for the endocytic sorting of various G protein-coupled receptors to lysosomes. Here we identify a distinct function of this covalent modification in controlling the later proteolytic processing of receptors. Mutation of all cytoplasmic lysine residues in the murine δ-opioid receptor blocked receptor ubiquitination without preventing ligand-induced endocytosis of receptors or their subsequent delivery to lysosomes, as verified by proteolysis of extramembrane epitope tags and down-regulation of radioligand binding to the transmembrane helices. Surprisingly, a functional screen revealed that the E3 ubiquitin ligase AIP4 specifically controls down-regulation of wild type receptors measured by radioligand binding without detectably affecting receptor delivery to lysosomes defined both immunochemically and biochemically. This specific AIP4-dependent regulation required direct ubiquitination of receptors and was also regulated by two deubiquitinating enzymes, AMSH and UBPY, which localized to late endosome/lysosome membranes containing internalized δ-opioid receptor. These results identify a distinct function of AIP4-dependent ubiquitination in controlling the later proteolytic processing of G protein-coupled receptors, without detectably affecting their endocytic sorting to lysosomes. We propose that ubiquitination or ubiquitination/deubiquitination cycling specifically regulates later proteolytic processing events required for destruction of the receptor's hydrophobic core. Ubiquitination is essential for the endocytic sorting of various G protein-coupled receptors to lysosomes. Here we identify a distinct function of this covalent modification in controlling the later proteolytic processing of receptors. Mutation of all cytoplasmic lysine residues in the murine δ-opioid receptor blocked receptor ubiquitination without preventing ligand-induced endocytosis of receptors or their subsequent delivery to lysosomes, as verified by proteolysis of extramembrane epitope tags and down-regulation of radioligand binding to the transmembrane helices. Surprisingly, a functional screen revealed that the E3 ubiquitin ligase AIP4 specifically controls down-regulation of wild type receptors measured by radioligand binding without detectably affecting receptor delivery to lysosomes defined both immunochemically and biochemically. This specific AIP4-dependent regulation required direct ubiquitination of receptors and was also regulated by two deubiquitinating enzymes, AMSH and UBPY, which localized to late endosome/lysosome membranes containing internalized δ-opioid receptor. These results identify a distinct function of AIP4-dependent ubiquitination in controlling the later proteolytic processing of G protein-coupled receptors, without detectably affecting their endocytic sorting to lysosomes. We propose that ubiquitination or ubiquitination/deubiquitination cycling specifically regulates later proteolytic processing events required for destruction of the receptor's hydrophobic core. A fundamental cellular mechanism contributing to homeostatic regulation of receptor-mediated signal transduction involves ligand-induced endocytosis of receptors followed by proteolysis in lysosomes. The importance of such proteolytic down-regulation has been documented extensively for a number of seven-transmembrane or G protein-coupled receptors (GPCRs), 3The abbreviations used are: GPCRG protein-coupled receptorDORδ-opioid peptide receptorE3ubiquitin-protein isopeptide ligaseGFPgreen fluorescent proteinHAhemagglutininPBSphosphate-buffered salineBisTris2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diolHRPhorseradish peroxidaseDADLEd-Ala-d-Leu-enkephalinDPNdiprenorphinesiRNAsmall interfering RNAANOVAanalysis of variance.3The abbreviations used are: GPCRG protein-coupled receptorDORδ-opioid peptide receptorE3ubiquitin-protein isopeptide ligaseGFPgreen fluorescent proteinHAhemagglutininPBSphosphate-buffered salineBisTris2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diolHRPhorseradish peroxidaseDADLEd-Ala-d-Leu-enkephalinDPNdiprenorphinesiRNAsmall interfering RNAANOVAanalysis of variance. which comprise the largest known family of signaling receptors expressed in animals, as well as for other important signaling receptors, such as the epidermal growth factor receptor tyrosine kinase (1.Ferguson S.S. Pharmacol. Rev. 2001; 53: 1-24PubMed Google Scholar, 2.Hanyaloglu A.C. von Zastrow M. Annu. Rev. Pharmacol. Toxicol. 2008; 48: 537-568Crossref PubMed Scopus (469) Google Scholar, 3.Marchese A. Paing M.M. Temple B.R. Trejo J. Annu. Rev. Pharmacol. Toxicol. 2008; 48: 601-629Crossref PubMed Scopus (351) Google Scholar, 4.Shenoy S.K. Circ. Res. 2007; 100: 1142-1154Crossref PubMed Scopus (88) Google Scholar, 5.Sorkin A. Goh L.K. Exp. Cell Res. 2008; 314: 3093-3106Crossref PubMed Scopus (199) Google Scholar). G protein-coupled receptor δ-opioid peptide receptor ubiquitin-protein isopeptide ligase green fluorescent protein hemagglutinin phosphate-buffered saline 2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diol horseradish peroxidase d-Ala-d-Leu-enkephalin diprenorphine small interfering RNA analysis of variance. G protein-coupled receptor δ-opioid peptide receptor ubiquitin-protein isopeptide ligase green fluorescent protein hemagglutinin phosphate-buffered saline 2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diol horseradish peroxidase d-Ala-d-Leu-enkephalin diprenorphine small interfering RNA analysis of variance. One GPCR that is well known to undergo endocytic trafficking to lysosomes is the δ-opioid peptide receptor (DOR or DOP-R) (6.Law P.Y. Wong Y.H. Loh H.H. Annu. Rev. Pharmacol. Toxicol. 2000; 40: 389-430Crossref PubMed Scopus (542) Google Scholar). Following endocytosis, DOR traffics efficiently to lysosomes in both neural and heterologous cell models (6.Law P.Y. Wong Y.H. Loh H.H. Annu. Rev. Pharmacol. Toxicol. 2000; 40: 389-430Crossref PubMed Scopus (542) Google Scholar, 7.Law P.Y. Hom D.S. Loh H.H. J. Biol. Chem. 1984; 259: 4096-4104Abstract Full Text PDF PubMed Google Scholar, 8.Tsao P. von Zastrow M. Curr. Opin. Neurobiol. 2000; 10: 365-369Crossref PubMed Scopus (133) Google Scholar), whereas many membrane proteins, including various GPCRs, recycle rapidly to the plasma membrane (9.Maxfield F.R. McGraw T.E. Nat. Rev. Mol. Cell Biol. 2004; 5: 121-132Crossref PubMed Scopus (1475) Google Scholar, 10.Vickery R.G. von Zastrow M. J. Cell Biol. 1999; 144: 31-43Crossref PubMed Scopus (197) Google Scholar, 11.Tsao P.I. von Zastrow M. J. Biol. Chem. 2000; 275: 11130-11140Abstract Full Text Full Text PDF PubMed Scopus (193) Google Scholar, 12.Tanowitz M. von Zastrow M. J. Biol. Chem. 2003; 278: 45978-45986Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar). Such molecular sorting of internalized receptors between divergent recycling and degradative pathways is thought to play a fundamental role in determining the functional consequences of regulated endocytosis (2.Hanyaloglu A.C. von Zastrow M. Annu. Rev. Pharmacol. Toxicol. 2008; 48: 537-568Crossref PubMed Scopus (469) Google Scholar, 3.Marchese A. Paing M.M. Temple B.R. Trejo J. Annu. Rev. Pharmacol. Toxicol. 2008; 48: 601-629Crossref PubMed Scopus (351) Google Scholar, 13.Carman C.V. Benovic J.L. Curr. Opin. Neurobiol. 1998; 8: 335-344Crossref PubMed Scopus (233) Google Scholar, 14.Tsao P.I. von Zastrow M. Pharmacol. Ther. 2001; 89: 139-147Crossref PubMed Scopus (62) Google Scholar). The sorting process that directs internalized DOR to lysosomes is remarkably efficient and appears to occur rapidly (within several min) after receptor endocytosis (11.Tsao P.I. von Zastrow M. J. Biol. Chem. 2000; 275: 11130-11140Abstract Full Text Full Text PDF PubMed Scopus (193) Google Scholar). Nevertheless, biochemical mechanisms that control lysosomal trafficking and proteolysis of DOR remain poorly understood. A conserved mechanism that promotes lysosomal trafficking of a number of membrane proteins, including various signaling receptors, is mediated by covalent modification of cytoplasmic lysine residues with ubiquitin (4.Shenoy S.K. Circ. Res. 2007; 100: 1142-1154Crossref PubMed Scopus (88) Google Scholar, 15.Hicke L. Trends Cell Biol. 1999; 9: 107-112Abstract Full Text Full Text PDF PubMed Scopus (386) Google Scholar, 16.Urbé S. Essays Biochem. 2005; 41: 81-98Crossref PubMed Google Scholar, 17.Raiborg C. Rusten T.E. Stenmark H. Curr. Opin. Cell Biol. 2003; 15: 446-455Crossref PubMed Scopus (405) Google Scholar). Ubiquitination was first identified as an endocytic sorting determinant in studies of vacuolar trafficking of the yeast GPCR Ste2p (18.Hicke L. Riezman H. Cell. 1996; 84: 277-287Abstract Full Text Full Text PDF PubMed Scopus (667) Google Scholar). Subsequent studies have established numerous examples of lysyl-ubiquitination being required for sorting endocytic cargo to lysosomes and have identified conserved machinery responsible for the targeting of ubiquitinated cargo to lysosomes (3.Marchese A. Paing M.M. Temple B.R. Trejo J. Annu. Rev. Pharmacol. Toxicol. 2008; 48: 601-629Crossref PubMed Scopus (351) Google Scholar, 17.Raiborg C. Rusten T.E. Stenmark H. Curr. Opin. Cell Biol. 2003; 15: 446-455Crossref PubMed Scopus (405) Google Scholar, 19.Katzmann D.J. Babst M. Emr S.D. Cell. 2001; 106: 145-155Abstract Full Text Full Text PDF PubMed Scopus (1116) Google Scholar, 20.Katzmann D.J. Odorizzi G. Emr S.D. Nat. Rev. Mol. Cell Biol. 2002; 3: 893-905Crossref PubMed Scopus (1012) Google Scholar, 21.Saksena S. Sun J. Chu T. Emr S.D. Trends Biochem. Sci. 2007; 32: 561-573Abstract Full Text Full Text PDF PubMed Scopus (244) Google Scholar, 22.Russell M.R. Nickerson D.P. Odorizzi G. Curr. Opin. Cell Biol. 2006; 18: 422-428Crossref PubMed Scopus (86) Google Scholar). The CXCR4 chemokine receptor provides a clear example of ubiquitin-dependent lysosomal sorting of a mammalian GPCR. Ubiquitination of the carboxyl-terminal cytoplasmic domain of the CXCR4 receptor, mediated by the E3 ubiquitin ligase AIP4, is specifically required for the HRS- and VPS4-dependent trafficking of internalized receptors to lysosomes. Blocking this ubiquitination event by Lys → Arg mutation of the receptor specifically inhibits trafficking of internalized receptors to lysosomes, resulting in recycling rather than lysosomal proteolysis of receptors after ligand-induced endocytosis (23.Marchese A. Benovic J.L. J. Biol. Chem. 2001; 276: 45509-45512Abstract Full Text Full Text PDF PubMed Scopus (390) Google Scholar, 24.Marchese A. Raiborg C. Santini F. Keen J.H. Stenmark H. Benovic J.L. Dev. Cell. 2003; 5: 709-722Abstract Full Text Full Text PDF PubMed Scopus (314) Google Scholar, 25.Bhandari D. Trejo J. Benovic J.L. Marchese A. J. Biol. Chem. 2007; 282: 36971-36979Abstract Full Text Full Text PDF PubMed Scopus (160) Google Scholar). Lysosomal trafficking of DOR, in contrast, is not prevented by mutation of cytoplasmic lysine residues (26.Tanowitz M. Von Zastrow M. J. Biol. Chem. 2002; 277: 50219-50222Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar) and can be regulated by ubiquitination-independent protein interaction(s) (27.Whistler J.L. Enquist J. Marley A. Fong J. Gladher F. Tsuruda P. Murray S.R. Von Zastrow M. Science. 2002; 297: 615-620Crossref PubMed Scopus (269) Google Scholar, 28.Simonin F. Karcher P. Boeuf J.J. Matifas A. Kieffer B.L. J. Neurochem. 2004; 89: 766-775Crossref PubMed Scopus (83) Google Scholar). Nevertheless, both wild type and lysyl-mutant DORs traffic to lysosomes via a similar pathway as ubiquitin-dependent membrane cargo and require both HRS and active VPS4 to do so (29.Hislop J.N. Marley A. Von Zastrow M. J. Biol. Chem. 2004; 279: 22522-22531Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar). These observations indicate that DOR engages the same core endocytic mechanism utilized by ubiquitination-directed membrane cargo but leave unresolved whether ubiquitination of DOR plays any role in this important cellular mechanism of receptor down-regulation. There is no doubt that DOR can undergo significant ubiquitination in mammalian cells, including HEK293 cells (30.Petaja-Repo U.E. Hogue M. Laperriere A. Bhalla S. Walker P. Bouvier M. J. Biol. Chem. 2001; 276: 4416-4423Abstract Full Text Full Text PDF PubMed Scopus (186) Google Scholar, 31.Petaja-Repo U.E. Hogue M. Laperriere A. Walker P. Bouvier M. J. Biol. Chem. 2000; 275: 13727-13736Abstract Full Text Full Text PDF PubMed Scopus (261) Google Scholar, 32.Chaturvedi K. Bandari P. Chinen N. Howells R.D. J. Biol. Chem. 2001; 276: 12345-12355Abstract Full Text Full Text PDF PubMed Scopus (119) Google Scholar), where lysosomal trafficking of lysyl-mutant receptors was first observed (26.Tanowitz M. Von Zastrow M. J. Biol. Chem. 2002; 277: 50219-50222Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar). Ubiquitination was shown previously to promote proteolysis of DOR by proteasomes and to function in degrading misfolded receptors from the biosynthetic pathway (30.Petaja-Repo U.E. Hogue M. Laperriere A. Bhalla S. Walker P. Bouvier M. J. Biol. Chem. 2001; 276: 4416-4423Abstract Full Text Full Text PDF PubMed Scopus (186) Google Scholar, 31.Petaja-Repo U.E. Hogue M. Laperriere A. Walker P. Bouvier M. J. Biol. Chem. 2000; 275: 13727-13736Abstract Full Text Full Text PDF PubMed Scopus (261) Google Scholar). A specific role of ubiquitination in promoting proteasome- but not lysosome-mediated proteolysis of DOR has been emphasized (32.Chaturvedi K. Bandari P. Chinen N. Howells R.D. J. Biol. Chem. 2001; 276: 12345-12355Abstract Full Text Full Text PDF PubMed Scopus (119) Google Scholar) and proposed to contribute to proteolytic down-regulation of receptors also from the plasma membrane (33.Yadav P.N. Chaturvedi K. Howells R.D. J. Pharmacol. Exp. Ther. 2007; 320: 1186-1194Crossref PubMed Scopus (8) Google Scholar). To our knowledge, no previous studies have determined if DOR ubiquitination plays any role in controlling receptor proteolysis mediated by lysosomes, although this represents a predominant pathway by which receptors undergo rapid down-regulation following ligand-induced endocytosis in a number of cell types, including HEK293 cells (8.Tsao P. von Zastrow M. Curr. Opin. Neurobiol. 2000; 10: 365-369Crossref PubMed Scopus (133) Google Scholar). In the present study, we have taken two approaches to addressing this fundamental question. First, we have investigated in greater detail the effects of lysyl-mutation on DOR ubiquitination and trafficking. Second, we have independently investigated the role of ubiquitination in controlling lysosomal proteolysis of wild type DOR. Our results clearly establish the ability of DOR to traffic efficiently to lysosomes in the absence of any detectable ubiquitination. Further, they identify a distinct and unanticipated function of AIP4-dependent ubiquitination in regulating the later proteolytic processing of receptors and show that this distinct ubiquitin-dependent regulatory mechanism operates effectively downstream of the sorting decision that commits internalized receptors for delivery to lysosomes. The Myc-tagged AIP4 and the C830A inactive mutant AIP4 have been previously described (24.Marchese A. Raiborg C. Santini F. Keen J.H. Stenmark H. Benovic J.L. Dev. Cell. 2003; 5: 709-722Abstract Full Text Full Text PDF PubMed Scopus (314) Google Scholar). Nedd4-1, Nedd4-2, WWP1, WWP2, Smurf1, and their corresponding inactive mutant versions were a gift from Laurent Coscoy and Brian Sullivan (University of California, Berkeley). Smurf2, NEDL1, and NEDL2 were a gift of Wes Sundquist (University of Utah School of Medicine) (34.Chung H.Y. Morita E. von Schwedler U. Müller B. Kräusslich H.G. Sundquist W.I. J. Virol. 2008; 82: 4884-4897Crossref PubMed Scopus (128) Google Scholar). Point mutations of the conserved catalytic cysteine residue were introduced by oligonucleotide-directed site-directed mutagenesis (QuikChange; Stratagene). GFP-AMSH, GFP-AMSH-D348A (D/A), GFP-UBPY, and GFP-UBPY-C786S (C/S) were a gift from Sylvie Urbé (University of Liverpool) and were previously described (35.McCullough J. Clague M.J. Urbé S. J. Cell Biol. 2004; 166: 487-492Crossref PubMed Scopus (305) Google Scholar, 36.Row P.E. Prior I.A. McCullough J. Clague M.J. Urbé S. J. Biol. Chem. 2006; 281: 12618-12624Abstract Full Text Full Text PDF PubMed Scopus (195) Google Scholar). The FLAG-tagged DOR and the lysine mutant version (DOR-0cK) have been previously described (26.Tanowitz M. Von Zastrow M. J. Biol. Chem. 2002; 277: 50219-50222Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar). A COOH-terminal HA epitope was added to the F-DOR and F-DOR-0cK using PCR and encoding the HA epitope sequence (YPYDVDDYA) in the reverse primer. The resulting F-DOR-HA and F-DOR-0cK-HA coding sequences were cloned into pcDNA3 (Invitrogen) for generation of stable cell lines. Stably transfected cells expressing epitope-tagged receptors were generated by selection for neomycin resistance using 500 μg/ml G418 (Geneticin; Invitrogen). Resistant colonies were clonally isolated and selected for further study based on comparable levels of receptor expression as assessed by fluorescence microscopy and saturation binding analysis (supplemental Fig. 1). HEK293 cells (ATCC, Manassas, VA) were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (University of California, San Francisco, Cell Culture Facility). For all transient expression of ligases and deubiquitinating enzymes, cells were transfected using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. Cells expressing FLAG-tagged receptors were harvested by washing with EDTA and plated in 60-mm dishes at 80% confluence before transfection with plasmid DNA. Cells were reseeded into polylysine-coated 6-well or 24-well plates and cultured for a further 24 h before experimentation. For knockdown of endogenous AIP4, AMSH, or UBPY levels, the following siRNA duplexes were obtained from Qiagen: AIP4-3 (Hs_ITCH_3), CAAGAGCTATGAGCAACTGAA; AIP4-6 (Hs_ITCH_6), TGCCGCCGACAAATACAAATA; AMSH-7 (Hs_STAMBP_7), ATCACGCTCTTTATTGAGAAA; AMSH-8 (Hs_STAMBP_8), CCGCTCTGGAGTTGAGATTAT; UBPY-1 (Hs_USP8_1), CAGGGTCAATTCAAATCTACA; UBPY-2 (HS_USPB_2), AAGGCTCGTATTCATGCAGAA. They were transfected using Lipofectamine RNAi-max according to the manufacturer's instructions. Immunoblotting to assess total cellular receptor levels was carried out as previously described (29.Hislop J.N. Marley A. Von Zastrow M. J. Biol. Chem. 2004; 279: 22522-22531Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar). Briefly, cell monolayers were washed three times in ice-cold phosphate-buffered saline (PBS) and lysed in extraction buffer (0.5% Triton X-100, 150 mm NaCl, 25 mm KCl, 25 mm Tris, pH 7.4, 1 mm EDTA) supplemented with a standard protease inhibitor mixture (Roche Applied Science). Extracts were clarified by centrifugation (12,000 × g for 10 min) and then mixed with SDS sample buffer for denaturation. Proteins present in the extracts were resolved by SDS-PAGE using 4–12% BisTris gels (NuPAGE; Invitrogen), transferred to nitrocellulose membranes, and probed for protein by immunoblotting using horseradish peroxidase-conjugated sheep anti-mouse IgG or donkey anti-rabbit IgG (Amersham Biosciences) and SuperSignal detection reagent (Pierce). Apparent molecular mass was estimated using commercial protein standards (SeeBlue Plus2; Invitrogen). Band intensities of unsaturated immunoblots were analyzed and quantified by densitometry using FluorChem 2.0 software (AlphaInnotech Corp.). Antibodies used were anti-FLAG-M1, anti-FLAG-M2-HRP (Sigma), anti-HA-11 (Covance), anti-HA(3F10)-HRP (Roche Applied Science), anti-AIP4/ITCH (BD Biosciences), anti-UBPY (Sigma), and anti-AMSH (a gift from Sylvie Urbé, University of Liverpool). To specifically label and follow the fate of the surface receptor pool, a previously described cell surface biotinylation assay was used to label FLAG-tagged receptors present in the plasma membrane (26.Tanowitz M. Von Zastrow M. J. Biol. Chem. 2002; 277: 50219-50222Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar, 29.Hislop J.N. Marley A. Von Zastrow M. J. Biol. Chem. 2004; 279: 22522-22531Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar). Briefly, stably transfected HEK293 cells were grown on 60-mm dishes, washed with ice-cold PBS, and incubated with 300 μg/ml sulfo-N-hydroxysuccinimide-biotin (Pierce) in PBS for 30 min at 4 °C to biotinylate surface proteins. Following washing with Tris-buffered saline to remove and quench unreacted biotinylation reagent, cells were returned to 37 °C for incubation in media, in the absence or presence of 10 μm d-Ala-d-Leu-enkephalin (DADLE) for the indicated time period and extracted as described above. Extracts were clarified by centrifugation (12,000 × g for 10 min), and biotinylated proteins were isolated by immobilization on streptavidin-conjugated Sepharose beads (Pierce). Washed beads were eluted with SDS sample buffer before resolving by SDS-PAGE, transferred to nitrocellulose membranes, and probed for FLAG-tagged receptor (M1 antibody; Sigma). Some samples, as indicated, were deglycosylated by the addition of 500 units of peptide N-glycosidase F (New England Biolabs) and incubated for 1 h at 37 °C before the elution with SDS sample buffer. To ensure the removal of any proteins that might be associated with the receptor, denaturing conditions were used. Cells were transiently transfected with HA-ubiquitin and treated before being lysed in 400 μl of extraction buffer and clarified by centrifugation (12,000 × g for 10 min), mixed with 200 μl of 3× radioimmune precipitation buffer (450 mm NaCl, 150 mm Tris, pH 7.4, 15 mm EDTA, 3% Triton X-100, 1.5% sodium deoxycholate, 30 mm NaF, 30 mm Na2-pyrophosphate, 0.3% SDS), and incubated overnight at 4 °C with 2 μg of M2 anti-FLAG antibody (Sigma). 30 μl of protein A/G-agarose (Pierce) was added for 2 h at 4 °C. Immunoprecipitates were pelleted by centrifugation (3000 rpm, 1 min, 4 °C) and washed three times with 500 μl of radioimmune precipitation buffer before the addition of 20 μl of SDS sample buffer (Invitrogen) supplemented with β-mercaptoethanol and analysis by Western blotting using anti-HA-HRP (Roche Applied Science). Blots were then stripped (Restore Western blot stripping buffer; Pierce) and reprobed with anti-FLAG M2-HRP to verify relative receptor levels. Receptor down-regulation was determined by radioligand binding, as previously described (11.Tsao P.I. von Zastrow M. J. Biol. Chem. 2000; 275: 11130-11140Abstract Full Text Full Text PDF PubMed Scopus (193) Google Scholar). Following transfection, HEK293 cells stably expressing FLAG-tagged receptors were replated into 12-well plates. 24 h later, 10 μm DADLE was added to the cells for the indicated time period, cells were washed twice with ice-cold PBS, 300 μl of PBS was added to the cells, and the plates were frozen. Plates were thawed, and cells were resuspended. Binding assays were performed in triplicate in 96-well plates using a 10 nm concentration of the radiolabeled opioid receptor antagonist [3H]diprenorphine (DPN) (88 Ci/mmol; Amersham Biosciences) and incubated for 1 h at room temperature, a saturating concentration that is sufficient to access both surface and internal receptors (11.Tsao P.I. von Zastrow M. J. Biol. Chem. 2000; 275: 11130-11140Abstract Full Text Full Text PDF PubMed Scopus (193) Google Scholar). Incubations were terminated by vacuum filtration through glass fiber filters (Whatman), and unbound radioligand was removed by repeated washes with Tris-buffered saline. Bound radioactivity was determined by liquid scintillation counting of washed filters. Nonspecific binding was determined by carrying out parallel determinations in the presence of excess unlabeled competitive antagonist (10 μm naloxone). Data presented represent the specific binding (total minus nonspecific binding) at each time point, expressed as a percentage of specific binding in similarly transfected but agonist-naive cells. Colocalization of receptors with late endosome/lysosome markers was visualized using HEK293 cells stably expressing the indicated FLAG-tagged receptor constructs plated on polylysine-coated glass coverslips (Corning Glass). Cells were incubated in the presence of 10 μm DADLE for 2 h before fixation with 4% formaldehyde and permeabilization with 0.1% Triton X-100 in PBS. Cells were labeled using rabbit anti-FLAG (Sigma) and mouse antibodies recognizing LAMP-1 and -2 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA), followed by secondary detection using Alexa594-conjugated anti-mouse and Alexa647 anti-rabbit secondary antibodies (Invitrogen). Colocalization of receptors with ubiquitin hydrolases was carried out using an identical procedure but with cells transiently transfected with GFP-ASMH-D348A or GFP-UBPY-C786S. Specimens were imaged by confocal fluorescence microscopy using a Zeiss LSM 510 microscope fitted with a Zeiss ×63, numeric aperture 1.4 objective operated in single photon mode, with standard filter sets verified for lack of detectable cross-channel bleed-through and standard (1 Airy disc) pinhole. Acquired optical sections were analyzed with LSM Image Examiner (Zeiss) and rendered with Adobe Photoshop software. Quantitative data were averaged across multiple independent experiments, with the number of experiments specified in the corresponding figure legend. Unless indicated otherwise, the error bars represent the S.E. value determined after compiling mean determinations across experiments. The statistical significance of the indicated differences was analyzed using the appropriate variations of one-way ANOVA and post-test and Student's t test, as specified in the figure legends, calculated using Prism 4.0 software (GraphPad Software, Inc.). The relative significance of each of the reported differences is specified by calculated p values that are also listed in the figure legends and annotated graphically in the figures. Previous findings indicated that mutation of all cytoplasmic lysine residues in the murine DOR does not prevent proteolytic down-regulation of receptors mediated by endosomal sorting complex required for transport (ESCRT)-dependent trafficking of internalized receptors to lysosomes (26.Tanowitz M. Von Zastrow M. J. Biol. Chem. 2002; 277: 50219-50222Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar, 29.Hislop J.N. Marley A. Von Zastrow M. J. Biol. Chem. 2004; 279: 22522-22531Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar). This was unexpected, because lysyl-ubiquitination is known to be essential for lysosomal trafficking of several other GPCRs (3.Marchese A. Paing M.M. Temple B.R. Trejo J. Annu. Rev. Pharmacol. Toxicol. 2008; 48: 601-629Crossref PubMed Scopus (351) Google Scholar) and because DOR is known to undergo extensive ubiquitination in intact cells (30.Petaja-Repo U.E. Hogue M. Laperriere A. Bhalla S. Walker P. Bouvier M. J. Biol. Chem. 2001; 276: 4416-4423Abstract Full Text Full Text PDF PubMed Scopus (186) Google Scholar, 32.Chaturvedi K. Bandari P. Chinen N. Howells R.D. J. Biol. Chem. 2001; 276: 12345-12355Abstract Full Text Full Text PDF PubMed Scopus (119) Google Scholar). Because our previous analysis of receptor proteolysis relied primarily on biochemical detection of a FLAG epitope tag engineered into the NH2-terminal ectodomain of the receptor (F-DOR), we considered the possibility that receptor proteolysis detected in our previous work might reflect limited proteolysis of the proximal NH2-terminal ectodomain, perhaps analogous to proteolytic “shaving” reported for the Ste3p seven-transmembrane receptor in yeast (37.Chen L. Davis N.G. Traffic. 2002; 3: 110-123Crossref PubMed Scopus (50) Google Scholar). Such limited proteolysis might be insufficient to destroy receptor function, since mutational studies indicate that the proximal NH2 terminus of opioid receptors is not essential for ligand binding (37.Chen L. Davis N.G. Traffic. 2002; 3: 110-123Crossref PubMed Scopus (50) Google Scholar, 38.Befort K. Tabbara L. Bausch S. Chavkin C. Evans C. Kieffer B. Mol. Pharmacol. 1996; 49: 216-223PubMed Google Scholar, 39.Befort K. Tabbara L. Kling D. Maigret B. Kieffer B.L. J. Biol. Chem. 1996; 271: 10161-10168Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar). To further evaluate the ubiquitination dependence of receptor proteolysis, we engineered a distinct (HA) epitope tag into the COOH-terminal endodomain of F-DOR and F-DOR-0cK (F-DOR-HA and F-DOR-0cK-HA), to allow monitoring of receptor proteolysis involving both ends of the receptor protein in the primary structure on both sides of the membrane. Stable cell lines generated from these constructs showed expression levels of between 1 and 2 fmol/μg for all constructs used (supplemental Fig. 1), an expression level that is on a similar order as that reported endogenously in the brain (40.Scherrer G. Tryoen-Tóth P. Filliol D. Matifas A. Laustriat D. Cao Y.Q. Basbaum A.I. Dierich A. Vonesh J.L. Gavériaux-Ruff C. Kieffer B.L. Proc. Natl. Acad. Sci. U.S.A. 2006; 103: 9691-9696Crossref PubMed Scopus (187) Google Scholar) and one at which efficient endocytic sorting of receptors occurs in HEK293 cells (11.Tsao P.I. von Zastrow M. J. Biol. Chem. 2000; 275: 11130-11140Abstract Full Text Full Text PDF PubMed Scopus (193) Google Scholar). To specifically follow the fate of the mature surface receptor, HEK293 cells stably expressing F-DOR-HA were labeled by surface biotinylation, and proteolysis of receptors was evaluated by streptavidin affinity purification and immunoblotting after incubating cells for various time periods with an agonist ligand (10 μm concentration of the opioid peptide analogue DADLE) that promotes recep" @default.
• W2040415055 created "2016-06-24" @default.
• W2040415055 creator A5030399661 @default.
• W2040415055 creator A5039570616 @default.
• W2040415055 creator A5065893316 @default.
• W2040415055 creator A5080145217 @default.
• W2040415055 date "2009-07-01" @default.
• W2040415055 modified "2023-10-15" @default.
• W2040415055 title "Ubiquitination Regulates Proteolytic Processing of G Protein-coupled Receptors after Their Sorting to Lysosomes" @default.
• W2040415055 cites W1487442802 @default.
• W2040415055 cites W1537396671 @default.
• W2040415055 cites W1869253992 @default.
• W2040415055 cites W1960800354 @default.
• W2040415055 cites W1966903404 @default.
• W2040415055 cites W1968553219 @default.
• W2040415055 cites W1982201097 @default.
• W2040415055 cites W1988074381 @default.
• W2040415055 cites W1991668347 @default.
• W2040415055 cites W1991669847 @default.
• W2040415055 cites W1992950258 @default.
• W2040415055 cites W2003370087 @default.
• W2040415055 cites W2003733809 @default.
• W2040415055 cites W2004759810 @default.
• W2040415055 cites W2007277452 @default.
• W2040415055 cites W2015350147 @default.
• W2040415055 cites W2015836019 @default.
• W2040415055 cites W2019772485 @default.
• W2040415055 cites W2019987740 @default.
• W2040415055 cites W2023427033 @default.
• W2040415055 cites W2025046733 @default.
• W2040415055 cites W2026022235 @default.
• W2040415055 cites W2026669832 @default.
• W2040415055 cites W2043830212 @default.
• W2040415055 cites W2047809194 @default.
• W2040415055 cites W2051459755 @default.
• W2040415055 cites W2055242244 @default.
• W2040415055 cites W2058334083 @default.
• W2040415055 cites W2061069875 @default.
• W2040415055 cites W2064954087 @default.
• W2040415055 cites W2066604682 @default.
• W2040415055 cites W2069156204 @default.
• W2040415055 cites W2074877259 @default.
• W2040415055 cites W2075857898 @default.
• W2040415055 cites W2079520721 @default.
• W2040415055 cites W2080273350 @default.
• W2040415055 cites W2081678320 @default.
• W2040415055 cites W2083438995 @default.
• W2040415055 cites W2091366475 @default.
• W2040415055 cites W2096986888 @default.
• W2040415055 cites W2100880876 @default.
• W2040415055 cites W2105012896 @default.
• W2040415055 cites W2105080299 @default.
• W2040415055 cites W2106057113 @default.
• W2040415055 cites W2106417205 @default.
• W2040415055 cites W2108187046 @default.
• W2040415055 cites W2117754393 @default.
• W2040415055 cites W2145625720 @default.
• W2040415055 cites W2163352150 @default.
• W2040415055 cites W4211214945 @default.
• W2040415055 cites W4238524950 @default.
• W2040415055 cites W4245015527 @default.
• W2040415055 doi "https://doi.org/10.1074/jbc.m109.001644" @default.
• W2040415055 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/2740561" @default.
• W2040415055 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/19433584" @default.
• W2040415055 hasPublicationYear "2009" @default.
• W2040415055 type Work @default.
• W2040415055 sameAs 2040415055 @default.
• W2040415055 citedByCount "72" @default.
• W2040415055 countsByYear W20404150552012 @default.
• W2040415055 countsByYear W20404150552013 @default.
• W2040415055 countsByYear W20404150552014 @default.
• W2040415055 countsByYear W20404150552015 @default.
• W2040415055 countsByYear W20404150552016 @default.
• W2040415055 countsByYear W20404150552017 @default.
• W2040415055 countsByYear W20404150552018 @default.
• W2040415055 countsByYear W20404150552019 @default.
• W2040415055 countsByYear W20404150552020 @default.
• W2040415055 countsByYear W20404150552021 @default.
• W2040415055 countsByYear W20404150552022 @default.
• W2040415055 crossrefType "journal-article" @default.
• W2040415055 hasAuthorship W2040415055A5030399661 @default.
• W2040415055 hasAuthorship W2040415055A5039570616 @default.
• W2040415055 hasAuthorship W2040415055A5065893316 @default.
• W2040415055 hasAuthorship W2040415055A5080145217 @default.
• W2040415055 hasBestOaLocation W20404150551 @default.
• W2040415055 hasConcept C104317684 @default.
• W2040415055 hasConcept C111696304 @default.
• W2040415055 hasConcept C170493617 @default.
• W2040415055 hasConcept C181199279 @default.
• W2040415055 hasConcept C185592680 @default.
• W2040415055 hasConcept C199360897 @default.
• W2040415055 hasConcept C25602115 @default.
• W2040415055 hasConcept C2781307694 @default.
• W2040415055 hasConcept C41008148 @default.
• W2040415055 hasConcept C55493867 @default.
• W2040415055 hasConcept C86803240 @default.
• W2040415055 hasConcept C95444343 @default.
• W2040415055 hasConceptScore W2040415055C104317684 @default.

• next