FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2040522025> ?p ?o ?g. }

• W2040522025 endingPage "27861" @default.
• W2040522025 startingPage "27853" @default.
• W2040522025 abstract "Lung-endothelial cell adhesion molecule-1 (Lu-ECAM-1) is an endothelial cell surface molecule that mediates adhesion of metastatic melanoma cells to lung endothelium. Here we analyze the organization of the Lu-ECAM-1 protein complex, report the sequence of Lu-ECAM-1 cDNAs, and reveal a novel function of the protein. Lu-ECAM-1 immunopurified from bovine aortic endothelial cells (BAEC) consists of tightly associated glycoproteins of 90, 38, and 32 kDa, with minor components of 130 and 120 kDa. We present evidence that all of these protein species are encoded by a single open reading frame whose initial translation product is proteolytically processed to yield the other products. Correct processing in vitro was demonstrated by transfection of the longest cDNA into human embryonic kidney 293 cells; immunoblot analysis showed that the ∼120-kDa precursor gave rise to 90- and 38-kDa products. RNA blots of BAEC mRNA detected messages in agreement with the sizes of the cDNA clones in addition to several of high molecular weight. DNA blot analysis showed that Lu-ECAM-1 is conserved throughout its length in all mammals tested, usually as a single or low copy gene. In the bovine, Lu-ECAM-1 protein is 88% identical to a calcium-dependent chloride channel described recently in tracheal epithelium, Ca-CC. Probes for Lu-ECAM-1 mRNA and protein confirmed the presence of a homolog in this tissue. We show that messages for both proteins are present in lung while only Ca-CC is present in trachea and only Lu-ECAM-1 is present in BAEC. These results suggest that endothelial cells express a chloride channel that is related to, but distinct from, that expressed in tracheal epithelium. They further suggest that an adhesion molecule can also be a chloride channel. Lung-endothelial cell adhesion molecule-1 (Lu-ECAM-1) is an endothelial cell surface molecule that mediates adhesion of metastatic melanoma cells to lung endothelium. Here we analyze the organization of the Lu-ECAM-1 protein complex, report the sequence of Lu-ECAM-1 cDNAs, and reveal a novel function of the protein. Lu-ECAM-1 immunopurified from bovine aortic endothelial cells (BAEC) consists of tightly associated glycoproteins of 90, 38, and 32 kDa, with minor components of 130 and 120 kDa. We present evidence that all of these protein species are encoded by a single open reading frame whose initial translation product is proteolytically processed to yield the other products. Correct processing in vitro was demonstrated by transfection of the longest cDNA into human embryonic kidney 293 cells; immunoblot analysis showed that the ∼120-kDa precursor gave rise to 90- and 38-kDa products. RNA blots of BAEC mRNA detected messages in agreement with the sizes of the cDNA clones in addition to several of high molecular weight. DNA blot analysis showed that Lu-ECAM-1 is conserved throughout its length in all mammals tested, usually as a single or low copy gene. In the bovine, Lu-ECAM-1 protein is 88% identical to a calcium-dependent chloride channel described recently in tracheal epithelium, Ca-CC. Probes for Lu-ECAM-1 mRNA and protein confirmed the presence of a homolog in this tissue. We show that messages for both proteins are present in lung while only Ca-CC is present in trachea and only Lu-ECAM-1 is present in BAEC. These results suggest that endothelial cells express a chloride channel that is related to, but distinct from, that expressed in tracheal epithelium. They further suggest that an adhesion molecule can also be a chloride channel. The preference of metastasizing tumor cells for certain organs may be explained if such cells fortuitously recognize and adhere to organ-specific, endothelial cell-surface molecules. In studying this hypothesis, much emphasis has been placed on the role of members of the classic families of cell-cell adhesion molecules including selectins, the immunoglobulin superfamily, and integrins (1Pauli B.U. Lin H. Encyclopedia of Cancer. I. Academic Press Inc., San Diego, CA1997: 464-476Google Scholar, 2Elble R.C. Pauli B.U. Guenthert I.U. Birchmeier W. Current Topics in Microbiology and Immunology. 213. Springer-Verlag, Berlin, Germany1996: 107-122Google Scholar, 3Albelda S.M. Lab. Invest. 1993; 68: 4-17PubMed Google Scholar). The contribution of these adhesion molecules to organ preference of metastasis was suggested by a number of reports describing the presence of such molecules on endothelia of various tissues and vessel calibers and denoting corresponding ligands on malignant cells of tumors of various tissue origins (1Pauli B.U. Lin H. Encyclopedia of Cancer. I. Academic Press Inc., San Diego, CA1997: 464-476Google Scholar, 2Elble R.C. Pauli B.U. Guenthert I.U. Birchmeier W. Current Topics in Microbiology and Immunology. 213. Springer-Verlag, Berlin, Germany1996: 107-122Google Scholar, 3Albelda S.M. Lab. Invest. 1993; 68: 4-17PubMed Google Scholar, 4Takada A. Ohmori K. Yoneda T. Tsuyoka K. Hasegawa A. Kiso M. Kannagi R. Cancer Res. 1993; 53: 354-361PubMed Google Scholar, 5Walz G. Aruffo A. Kolanus W. Bevilacqua M. Seed B. Science. 1990; 250: 1132-1135Crossref PubMed Scopus (883) Google Scholar, 6Albelda S.M. Am. J. Respir. Cell Mol. Biol. 1991; 4: 193-203Crossref Scopus (263) Google Scholar, 7Qian F. Vaus D.L. Weissman I.L. Cell. 1994; 77: 335-347Abstract Full Text PDF PubMed Scopus (207) Google Scholar). In our laboratory, a different approach was chosen to testing the contribution of specific endothelial cell adhesion molecules to organ preference of metastasis. It relied on an endothelial cell culture system that could be modulated by growing unspecific, large vessel-derived endothelial cells (e.g.bovine aortic endothelial cells (BAEC) 1The abbreviations used are: BAEC, bovine aortic endothelial cells; KLH, keyhole limpet hemocyanin; DST, disuccinimidyl tartarate; RT-PCR, reverse transcription-polymerase chain reaction; RACE, rapid amplification of cDNA ends; HEK293, human embryonic kidney 293; CMV, cytomegalovirus; ORF, open reading frame; mAb, monoclonal antibody; bp, base pair(s); nt, nucleotide(s); kb, kilobase(s); wtLu-ECAM-1, wild-type Lu-ECAM-1; rLu-ECAM-1, recombinant Lu-ECAM-1; PBS, phosphate-buffered saline. 1The abbreviations used are: BAEC, bovine aortic endothelial cells; KLH, keyhole limpet hemocyanin; DST, disuccinimidyl tartarate; RT-PCR, reverse transcription-polymerase chain reaction; RACE, rapid amplification of cDNA ends; HEK293, human embryonic kidney 293; CMV, cytomegalovirus; ORF, open reading frame; mAb, monoclonal antibody; bp, base pair(s); nt, nucleotide(s); kb, kilobase(s); wtLu-ECAM-1, wild-type Lu-ECAM-1; rLu-ECAM-1, recombinant Lu-ECAM-1; PBS, phosphate-buffered saline.) on organ-specific matrix to express phenotypic traits of the microvasculature of that organ (8Augustin-Voss H.G. Johnson R.C. Pauli B.U. Exp. Cell Res. 1991; 192: 346-351Crossref PubMed Scopus (39) Google Scholar, 9Pauli B.U. Lee C.L. Lab. Invest. 1988; 58: 379-387PubMed Google Scholar). Tumor cells with distinct metastatic dissemination patterns were then evaluated for adhesion to these endothelial cells, observing that tumor cells only bound in large numbers to those endothelial cells that were modulated with matrix from the preferred organ site of metastasis (9Pauli B.U. Lee C.L. Lab. Invest. 1988; 58: 379-387PubMed Google Scholar). To identify the adhesion-receptor/ligand pair that mediated binding of lung-metastatic melanoma cells to lung matrix-modulated BAEC, monoclonal antibodies directed against endothelial lumenal membrane vesicles were produced that inhibited the specific adhesion of melanoma cells to endothelium (10Zhu D. Pauli B.U. J. Histochem. Cytochem. 1991; 39: 1137-1142Crossref PubMed Scopus (26) Google Scholar, 11Zhu D. Cheng C.-F. Pauli B.U. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 9568-9572Crossref PubMed Scopus (123) Google Scholar). Such a mAb was 6D3. The antibody selectively recognized endothelia of pleural and subpleural venules and, to a lesser extent, endothelia of peribronchiolar and parenchymal venules of mouse lung (11Zhu D. Cheng C.-F. Pauli B.U. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 9568-9572Crossref PubMed Scopus (123) Google Scholar, 12Zhu D. Pauli B.U. Int. J. Cancer. 1993; 53: 628-633Crossref PubMed Scopus (20) Google Scholar). This vascular distribution was highly correlated with the position of emerging tumor colonies three weeks after intravenous inoculation of B16-F10 melanoma cells; i.e. most metastases were observed in pleural and subpleural tissues (12Zhu D. Pauli B.U. Int. J. Cancer. 1993; 53: 628-633Crossref PubMed Scopus (20) Google Scholar). The purified antibody effectively increased the clearance of B16-F10 cells from murine lungs, exerting its most dramatic effect during the first 30 min after intravenous inoculation of tumor cells (13Zhu D. Cheng C.-F. Pauli B.U. J. Clin. Invest. 1992; 89: 1718-1724Crossref PubMed Scopus (51) Google Scholar). Accordingly this antibody was efficient in preventing metastatic colonization of the lungs by B16-F10 melanoma cells (11Zhu D. Cheng C.-F. Pauli B.U. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 9568-9572Crossref PubMed Scopus (123) Google Scholar, 13Zhu D. Cheng C.-F. Pauli B.U. J. Clin. Invest. 1992; 89: 1718-1724Crossref PubMed Scopus (51) Google Scholar). Purification of the endothelial cell adhesion molecule was performed by immunoprecipitation from extracts of lung matrix-modulated BAEC using mAb 6D3 (11Zhu D. Cheng C.-F. Pauli B.U. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 9568-9572Crossref PubMed Scopus (123) Google Scholar). A major component at 90 kDa was identified and termedlung-endothelial celladhesion molecule-1 (Lu-ECAM-1; Ref. 11Zhu D. Cheng C.-F. Pauli B.U. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 9568-9572Crossref PubMed Scopus (123) Google Scholar). The purified molecule promotes strong adhesion of B16-F10 cells under static and hydrodynamic conditions (14Goetz D.J. El-Sabban M.E. Hammer D.A. Pauli B.U. Int. J. Cancer. 1995; 65: 192-199Crossref Scopus (39) Google Scholar) and, in soluble form, competitively inhibits adhesion of these tumor cells to immobilized Lu-ECAM-1 (11Zhu D. Cheng C.-F. Pauli B.U. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 9568-9572Crossref PubMed Scopus (123) Google Scholar, 13Zhu D. Cheng C.-F. Pauli B.U. J. Clin. Invest. 1992; 89: 1718-1724Crossref PubMed Scopus (51) Google Scholar). Here, we identify other components of the Lu-ECAM-1 complex and define their interrelationships. The sequences of cDNAs that encode these proteins are reported, and it is shown that the Lu-ECAM-1 gene is conserved in humans as well as other mammals. Lu-ECAM-1 is not a member of any of the classic families of cell-cell adhesion molecules introduced above but is a homolog of the recently described calcium-activated chloride channel, Ca-CC (15Cunningham S.A. Awayda M.S. Bubien J.K. Ismailov I.I. Arrate M.P. Berdiev B.K. Benos D.J. Fuller C.M. J. Biol. Chem. 1995; 270: 31016-31026Abstract Full Text Full Text PDF PubMed Scopus (198) Google Scholar). In light of this homology, our previous characterization of sites of expression of the Lu-ECAM-1 complex is extended and compared with the localization of Ca-CC. The dual adhesion/chloride channel function of Lu-ECAM-1 is novel and intriguing and is discussed here in the context of channel regulation and importance to metastasis. Lu-ECAM-1 was immunopurified from BAEC and lung with mAb 6D3 as described by Zhuet al. (11Zhu D. Cheng C.-F. Pauli B.U. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 9568-9572Crossref PubMed Scopus (123) Google Scholar). Proteins were fractionated by SDS-PAGE (10%) and stained with silver (see Fig. 1) or transferred to polyvinylidene difluoride membrane (Bio-Rad) and sequenced at the Northwestern or Harvard University protein sequencing facilities. Molecular weights were determined relative to unstained size markers (Life Technologies, Inc. and Molecular Probes). For deglycosylation, immunopurified proteins were treated with recombinant N-glycosidase F according to the manufacturer (N-Glycanase; Genzyme, Cambridge, MA). The general strategy for assembly of Lu-ECAM-1 cDNA Clone 1 from fragments obtained by PCR is schematized in Fig. 2. First, the amino-terminal and internal protein sequences of the 38-kDa component (see Table I) were used to design degenerate primers for primary and nested PCR using reverse transcribed BAEC total RNA as template. Upstream primers corresponded to amino acids 685–693 and 698–705. Downstream antisense primers corresponded to amino acids 839–832 and 852–846. A product of ∼450 bp was obtained and sequenced (see Fig. 2, P1). From this sequence, nondegenerate primers for 3′-RACE were designed (nt 2562–2588 and 2590–2611 of Clone 1, GenBankTM Data Bank accession number AF001261; 3′ Amplifinder RACE kit,CLONTECH). An ∼750-bp product was obtained and sequenced (see Fig. 2, P2). Nondegenerate primers were designed for the first round of 5′-RACE (nt 2643–2619 and 2523–2505; 5′ RACE System, Life Technologies, Inc.). An ∼1000-bp product was obtained and sequenced (Fig. 2, P3). Its 5′ end (nt 1572) lacked a Kozak-context ATG (17Kozak M. Nucleic Acids Res. 1981; 9: 5233-5253Crossref PubMed Scopus (826) Google Scholar) and signal sequence and so appeared to be an abortive reverse transcription product. A further 5′-RACE reaction using an internal primer (nt 1599–1572) was performed to obtain the entire 5′ end (see Fig. 2, P4), containing a Kozak-context ATG, a signal sequence, and the amino-terminal sequence of the 90-kDa protein (see Fig. 3). To reconstitute the cDNA, these overlapping PCR products were assembled into one ORF by an overlap-extension strategy using a high fidelityTaq/Pfu polymerase combination (Stratagene) (18Horton R.M. Hunt H.D. Ho S.N. Pullen J.K. Pease L.R. Gene (Amst.). 1989; 77: 61-68Crossref PubMed Scopus (2633) Google Scholar). The order of assembly was ((P1 + P2) + P3) + P4. Products were cloned into a T-vector (Invitrogen) and sequenced. To obtain other clones, total RNA was isolated from BAEC by the guanidinium chloride procedure (19Chirgwin J.J. Przbyla A.E. MacDonald R.J. Rutter W.J. Biochemistry. 1979; 18: 5294-5299Crossref PubMed Scopus (16621) Google Scholar) and used to prepare a cDNA library in Lambda Zap II (Stratagene). Internal peptide sequences of the 90-kDa component were used to design degenerate primers for RT-PCR with BAEC RNA as template. Primers corresponding to amino acids 143–148 and 310–305 (Fig. 3) yielded an ∼520-bp product. This product was used to screen the library by filter hybridization. Oligonucleotide primers were prepared by Life Technologies, Inc., and DNA sequencing was by the Sanger method. Sequences were analyzed with GCG software (University of Wisconsin).Table IPeptide sequences derived from immunopurified proteinsPeptideDerivation (kDa protein)Location in Clone 1 ORFSMVNLINNGYDGIVIAIN901–18QESYDQADVIVANPYL9074–89HEWAHLRWGIFDEYNV90134–149DQPFYISR90150–157STWDVIMNSSDFQNTSPMTEMNPP90251–274LFQMNQAAELYLIQVIEKG90306–324VLYVPGYVENGKIILNPPRPEVKDDLAK32 and 38683–710KEDYIQLSWTAPGNV38752–766FYISVQAINEANLISEVSHIVQAIK38828–851 Open table in a new tab Figure 3Sequence comparison of Lu-ECAM-1 cDNAs and Ca-CC. Dots indicate identity, and dashesindicate missing amino acid residues. PotentialN-glycosylation sites are indicated by asterisks, and the signal sequence is indicated by a double overline. Transmembrane segments proposed by Cunningham et al. (15Cunningham S.A. Awayda M.S. Bubien J.K. Ismailov I.I. Arrate M.P. Berdiev B.K. Benos D.J. Fuller C.M. J. Biol. Chem. 1995; 270: 31016-31026Abstract Full Text Full Text PDF PubMed Scopus (198) Google Scholar) are underlined. The proposed processing site is indicated by a solid arrowhead.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Polyclonal antibodies were generated against peptides based on the cDNA sequences or against purified Lu-ECAM-1 components (Table II). Antibodies CU11 and CU8 were generated against synthetic peptides. Peptides were synthesized at the Dept. of Genetic Engineering (University of Illinois, Urbana), partially purified by HPLC, and conjugated to KLH using the Activated Immunogen Conjugation kit (Pierce). Antibody CU19 was prepared after cloning theBsaBI-StyI fragment containing the 3′ end of Clone 3 (amino acids 624–799) into the PvuII site of pRSET A (Invitrogen) to produce a fusion protein bearing a six-histidine metal affinity tag. The protein was purified over nickel-resin (Invitrogen) and conjugated to KLH. Rabbit polyclonal antisera were prepared by Cocalico Biologicals (Reamstown, PA). Polyclonal antibodies R4 and R41 were prepared by immunizing rats with the 90- and 38-kDa bands, respectively, excised from polyacrylamide gels, pulverized, and mixed with complete Freund's adjuvant. Immunoblots were performed according to standard methods (20Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989Google Scholar) using horseradish peroxidase-conjugated secondary antibodies (Life Technologies, Inc. or Pierce) and chemiluminescence (ECL, Amersham Corp., or Super Signal, Pierce). For biotinylation, BAEC were treated with NHS (long arm)-biotin (Vector Laboratories, Inc., Burlingame, CA) as recommended by the manufacturer. Disuccinimidyl tartarate (DST, Pierce) cross-linking was as described (21Kunz S. Ziegler U. Kunz B. Sonderegger P. J. Cell Biol. 1996; 135: 253-267Crossref PubMed Scopus (63) Google Scholar). Proteins were immunoprecipitated from lysates, analyzed by SDS-PAGE, transferred to nitrocellulose, and detected using avidin-horseradish peroxidase and chemiluminescence.Table IIDerivation of antibodies used in this workAntibodyAntigenProteins detectedkDa6D3Lu-ECAM-12-aWhole protein.90, 120, 130CU11Amino acids 23–402-bSynthetic peptide: amino acid positions in Clone 1 ORF.90, 120, 130CU8Amino acids 514–5302-bSynthetic peptide: amino acid positions in Clone 1 ORF.90, 120, 130CU19Amino acids 618–7672-cBacterially expressed fusion protein.32, 38, 90,2-dWeak. 120, 130R490-kDa protein90, 120, 130R4138-kDa protein32, 38, 120, 1302-a Whole protein.2-b Synthetic peptide: amino acid positions in Clone 1 ORF.2-c Bacterially expressed fusion protein.2-d Weak. Open table in a new tab For expression in HEK293 cells, Lu-ECAM-1 cDNA was placed under control of a tetracycline-regulated promoter in pTet-Splice (Life Technologies, Inc.). The construction was accomplished in two steps. A PCR product was first generated that corresponded to the 3′ end of Clone 1 cDNA (nt 2391 to 2780). The 5′ primer was 5′-ACTGAATTCAGCAGACTAACCTCTGGAGGGTC-3′ and contained anEcoRI restriction site. The 3′ primer was 5′-TCTACTAGTAGCTTTAGCTACTGAAGAACAAG-3′ and contained aSpeI site. The product was cleaved with SpeI andEcoRI and then cloned into corresponding sites in pTet-Splice. A plasmid clone was selected and sequenced to confirm the absence of mutations. This plasmid was then cleaved withEcoRI and BglII. To reconstitute the Lu-ECAM-1 ORF, the 2.3-kb EcoRI-BglII fragment was excised from Clone 3 and inserted into the plasmid. The resulting plasmid, pTet-Splice-Lu-ECAM-1, was then transfected into HEK293 cells along with pTet-tTAK, which encodes a transcriptional activator specific for the pTet-Splice vector. Transfection was by the LipofectAMINE (Life Technologies, Inc.) method according to the manufacturer instructions. Cells were harvested 24 h after the start of transfection. Control cells were transfected in parallel with a plasmid expressing rat dipeptidyl peptidase IV under control of the CMV promoter (RcCMV, Invitrogen) (22Hong W. Doyle D. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 7962-7966Crossref PubMed Scopus (46) Google Scholar). For in vitro expression, Lu-ECAM-1 cDNA Clone 1 was placed under control of the phage T7 promoter in pGEM3. The EcoRI-SpeI fragment containing Lu-ECAM-1 was excised from pTet-Splice and inserted into theEcoRI and XbaI sites of pGEM3. Plasmid DNA was translated using the TNT-coupled transcription-translation system (Promega) and [35S]methionine (Amersham Life Science, Inc.). Glycosylation was accomplished with canine pancreatic microsomes (Amersham Life Science, Inc.). The genomic DNA blot was hybridized for 14 h at 37 °C in 5 × SSC, 50% formamide, 4 × Denhardt's solution, 10% polyethylene glycol (M r = 8000) and 100 μg/ml denatured salmon testis DNA. The blot was stripped after exposure by boiling in 0.1 × SSC. For RNA blots, lung and spleen mRNA preparations were purchased from CLONTECH. Alternatively, mRNA was prepared from confluent BAEC and freshly scraped epithelium from bovine trachea using the Fast Track system (Invitrogen, San Diego, CA). mRNA was electrophoresed on a 1.2% agarose-formaldehyde gel, blotted onto Nytran (Schleicher & Schuell), and hybridized overnight at 65 °C in QuickHyb solution (Stratagene). 32P-labeled probes were prepared by random priming (RadPrime kit, Life Technologies, Inc.). Radioisotopes were purchased from Amersham Life Science, Inc. Formalin-fixed sections of bovine trachea were first boiled for ten min in 4 m urea in a microwave oven and then probed with polyclonal antibody R4. The sections were incubated with biotinylated donkey anti-rat IgG and Neutravidin-peroxidase conjugate (Molecular Probes). The peroxidase conjugate was detected using diamino-benzidine as substrate and the slides were counterstained with hematoxylin. Lung sections were prepared and probed with mAb 6D3 according to Zhu et al.(12Zhu D. Pauli B.U. Int. J. Cancer. 1993; 53: 628-633Crossref PubMed Scopus (20) Google Scholar) except that a biotinylated secondary antibody was used followed by Neutravidin-peroxidase conjugate. For RT-PCR analysis of bovine lung, spleen, tracheal epithelium, and cultured BAEC, 500 ng of each mRNA was reverse transcribed with random oligonucleotide primers and Superscript II reverse transcriptase (Life Technologies, Inc.) in a 20-μl reaction volume. Primers specific for Lu-ECAM-1 cDNA (LU primers) or Ca-CC cDNA (TC primers) were selected such that the last one, two, or three 3′ nucleotides were complementary only to the Lu-ECAM-1 or the Ca-CC cDNA sequence, respectively. The selectivity of the primers was confirmed in control experiments with a Lu-ECAM-1 cDNA clone. The primer sequences and their locations in the respective cDNA sequence are given in Table III. The cycling protocol was as follows: 94 °C, 20 s; 55 °C, 10 s; and 72 °C, 10 s, for 35 cycles with a time increment of 2 s/cycle for annealing and extension times and a final extension step at 72 °C for 10 min.Table IIISequences, specificity, and location of primers used for RT-PCR analysisPrimer namePolaritySpecificityNucleotide sequence3-aNucleotide sequence is given in 5′ → 3′ orientation.Location3-bLocation is given as nucleotide number of Lu-ECAM-1 cDNA sequence or Ca-CC cDNA sequence (15).LU-1UpstreamLu-ECAM-1ATGTTCAACTCATATTACTGGTAT741–764TC-1UpstreamCa-CCATGTTCAACTCATATTACTGGTAC576–599LU-2UpstreamLu-ECAM-1CACAGACAGGGCTGTATGAA827–846TC-2UpstreamCa-CCCACAGACAGGGCTGTATGAG659–678LU-3DownstreamLu-ECAM-1TGTAGGTTTGGAGCTTCTGT974–955TC-3DownstreamCa-CCTGTAGGTTTGGAGCTTCCAC806–787LU-4DownstreamLu-ECAM-1GGAGATGTATTCTGAAAGTCAAC1044–1024TC-4DownstreamCa-CCGGAGATGTATTTTGAAAGTCAGT876–8563-a Nucleotide sequence is given in 5′ → 3′ orientation.3-b Location is given as nucleotide number of Lu-ECAM-1 cDNA sequence or Ca-CC cDNA sequence (15Cunningham S.A. Awayda M.S. Bubien J.K. Ismailov I.I. Arrate M.P. Berdiev B.K. Benos D.J. Fuller C.M. J. Biol. Chem. 1995; 270: 31016-31026Abstract Full Text Full Text PDF PubMed Scopus (198) Google Scholar). Open table in a new tab Adhesion of lung-metastatic B16-F10 melanoma cells to wild-type (wtLu-ECAM-1) and recombinant Lu-ECAM-1 (rLu-ECAM-1) was tested in a static adhesion assay as described in detail elsewhere (13Zhu D. Cheng C.-F. Pauli B.U. J. Clin. Invest. 1992; 89: 1718-1724Crossref PubMed Scopus (51) Google Scholar). wtLu-ECAM-1 and rLu-ECAM-1 were purified by immunoaffinity chromatography from extracts of BAEC and Lu-ECAM-1 cDNA (Clone 1)-transfected HEK293 cells, respectively. Proteins were used at a coating concentration of 100 μg/ml in PBS (overnight, 4 °C). The Lu-ECAM-1 complex was immunopurified from BAEC and analyzed by SDS-PAGE and silver-staining (Fig. 1). Major bands corresponded to sizes of 90, 55, 38, and 32 kDa. The amino-terminal sequence of each of the polypeptides was determined after resolution on SDS-PAGE and transfer to Immobilon. The sequences of the 38- and 32-kDa components were identical but differed from that of the 90-kDa component (Fig. 1). The 55-kDa protein was found to be an IgG contaminant. Internal peptide sequences of the 90- and 38-kDa proteins were obtained after tryptic cleavage of the respective proteins and HPLC purification of the cleavage products. The amino acid sequences of these peptides were all found in the ORF of the longest Lu-ECAM-1 cDNA as shown below (Table I). Lu-ECAM-1 cDNAs were obtained using degenerate PCR primers based on peptide sequences from the 90-, 38-, and 32-kDa polypeptides (see “Experimental Procedures”). PCR products were then extended by RACE or used as probes to isolate cDNAs from a BAEC library (schematized in Fig. 2 and detailed under “Experimental Procedures”). Four clones were obtained (Figs. 2 and 3). The first, Clone 1, was generated entirely by PCR using primers based on sequences of the 38- and 32-kDa components. Its length was 3.3 kb, and it encodes a 905-amino acid protein. Clones 2, 3, and 4 were isolated from a BAEC library using a probe based on sequences of the 90-kDa component. Clone 2 was identical to Clone 1 from nucleotide 252–2438 but diverged at the 3′ end and was incomplete at the 5′ end, lacking an initiation codon. A complete 5′-end sequence was obtained using 5′-RACE with primers corresponding to nucleotides 1599–1572 and 524–502. The ORFs of Clones 2 and 3 are identical to that of Clone 1 until amino acid 772 then diverge to yield proteins of 794 and 820 amino acids, respectively (Fig. 3). Clone 4 encodes a truncated, 321-amino acid version of Lu-ECAM-1 that may be secreted. Its derived amino acid sequence is identical to that of the other ORFs up to amino acid 303 (Fig. 3). The ORFs of all four cDNA clones contain the amino-terminal sequence of the 90-kDa component of Lu-ECAM-1 following a presumptive signal sequence of 21 amino acids. The amino-terminal sequence of the 38- and 32-kDa components lies near the carboxyl termini of the ORFs of Clones 1, 2, and 3 (Table I and Fig. 3, arrowhead). However, only the ORF of Clone 1 contains the sequence of the internal peptide (TableI and Fig. 3, residues 828–851) derived from the 38-kDa component. Hybridization of a genomic DNA blot with a Lu-ECAM-1 probe (EcoRI-BglII fragment) detected signals in all mammals tested (Fig. 4). However, searches of genetic data banks for similarity to Lu-ECAM-1 revealed only one extensive match, the chloride channel Ca-CC (GenBankTM/EBI Data Bank accession number U36455). Within their ORFs, the Lu-ECAM-1 Clone 1 and Ca-CC cDNAs share 92% identity at the DNA level and 88% identity at the amino acid level (aligned in Fig. 3). The differences appear randomly distributed, suggesting that Lu-ECAM-1 and Ca-CC represent products of different genes. Only one other significant match was detected in the data banks, a swine intestine partial cDNA (55% identity over 58 amino acid residues; GenBankTM/EBI Data Bank accession numberF15082). All of the ORFs predict hydrophobic amino termini (residues −21 to −1) with the features of a cleavable signal sequence (24von Heijne G. Nucleic Acids Res. 1986; 14: 4683-4690Crossref PubMed Scopus (3686) Google Scholar) preceding the mature amino terminus determined by protein sequencing (Fig. 3, double overline). Four other generally hydrophobic regions (Fig. 3, underline) were proposed by Cunningham et al. (15Cunningham S.A. Awayda M.S. Bubien J.K. Ismailov I.I. Arrate M.P. Berdiev B.K. Benos D.J. Fuller C.M. J. Biol. Chem. 1995; 270: 31016-31026Abstract Full Text Full Text PDF PubMed Scopus (198) Google Scholar) to comprise transmembrane segments in the cognate Ca-CC molecule. In particular, the hydrophobic segment starting at residue 595 conforms well to the established criteria for α-helical transmembrane segments, containing 23 amino acid residues with a total transfer free energy of 36.3 kcal/mol (25Engelman D.M. Steitz T.A. Goldman A. Ann. Rev. Biophys. Biophys. Chem. 1986; 15: 328-330Crossref Scopus (1195) Google Scholar). Nine potential sites exist for asparagine-linked glycosylation (Fig. 3, asterisks). The relationship between the high and low molecular weight Lu-ECAM-1 components was explored using antibodies that recognize distinct epitopes. To determine which components share the epitope for the mAb used for immunoprecipitation, affinity purified Lu-ECAM-1 was probed on an immunoblot with mAb 6D3. This antibody detected the 90-kDa component but not the 38- or 32-kDa components, indicating that the smaller components lack the epitope and are instead tightly complexed with the larger components (Fig.5 A). In addition, 6D3 detected two larger bands migrating at approximately 120- and 130-kDa, respectively, that were not clearly visible by silver staining. To determine which parts of the cDNAs correspond to which proteins, polyclonal antibodies were generated against synthetic peptides based on the cDNA sequences or against chimeric proteins obtained by expression of cDNAs in bacteria (TableII). CU11 (against amino acid residues 22–38" @default.
• W2040522025 created "2016-06-24" @default.
• W2040522025 creator A5008512186 @default.
• W2040522025 creator A5011653179 @default.
• W2040522025 creator A5014808886 @default.
• W2040522025 creator A5021888071 @default.
• W2040522025 creator A5026099931 @default.
• W2040522025 creator A5049724219 @default.
• W2040522025 creator A5049828198 @default.
• W2040522025 creator A5068993688 @default.
• W2040522025 date "1997-10-01" @default.
• W2040522025 modified "2023-10-13" @default.
• W2040522025 title "Cloning and Characterization of Lung-Endothelial Cell Adhesion Molecule-1 Suggest It Is an Endothelial Chloride Channel" @default.
• W2040522025 cites W1516353866 @default.
• W2040522025 cites W1932052686 @default.
• W2040522025 cites W1974540875 @default.
• W2040522025 cites W1998591058 @default.
• W2040522025 cites W2006271002 @default.
• W2040522025 cites W2017498808 @default.
• W2040522025 cites W2020828649 @default.
• W2040522025 cites W2029305793 @default.
• W2040522025 cites W2033490823 @default.
• W2040522025 cites W2033538534 @default.
• W2040522025 cites W2054483361 @default.
• W2040522025 cites W2060333964 @default.
• W2040522025 cites W2065808695 @default.
• W2040522025 cites W2067871056 @default.
• W2040522025 cites W2084295903 @default.
• W2040522025 cites W2098834645 @default.
• W2040522025 cites W2100802471 @default.
• W2040522025 cites W2115609278 @default.
• W2040522025 cites W2122841994 @default.
• W2040522025 cites W2126170493 @default.
• W2040522025 cites W2130561621 @default.
• W2040522025 cites W2138879032 @default.
• W2040522025 doi "https://doi.org/10.1074/jbc.272.44.27853" @default.
• W2040522025 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9346932" @default.
• W2040522025 hasPublicationYear "1997" @default.
• W2040522025 type Work @default.
• W2040522025 sameAs 2040522025 @default.
• W2040522025 citedByCount "97" @default.
• W2040522025 countsByYear W20405220252012 @default.
• W2040522025 countsByYear W20405220252013 @default.
• W2040522025 countsByYear W20405220252015 @default.
• W2040522025 countsByYear W20405220252016 @default.
• W2040522025 countsByYear W20405220252018 @default.
• W2040522025 countsByYear W20405220252019 @default.
• W2040522025 crossrefType "journal-article" @default.
• W2040522025 hasAuthorship W2040522025A5008512186 @default.
• W2040522025 hasAuthorship W2040522025A5011653179 @default.
• W2040522025 hasAuthorship W2040522025A5014808886 @default.
• W2040522025 hasAuthorship W2040522025A5021888071 @default.
• W2040522025 hasAuthorship W2040522025A5026099931 @default.
• W2040522025 hasAuthorship W2040522025A5049724219 @default.
• W2040522025 hasAuthorship W2040522025A5049828198 @default.
• W2040522025 hasAuthorship W2040522025A5068993688 @default.
• W2040522025 hasBestOaLocation W20405220251 @default.
• W2040522025 hasConcept C121050878 @default.
• W2040522025 hasConcept C123012128 @default.
• W2040522025 hasConcept C145822097 @default.
• W2040522025 hasConcept C1491633281 @default.
• W2040522025 hasConcept C16224149 @default.
• W2040522025 hasConcept C171250308 @default.
• W2040522025 hasConcept C178790620 @default.
• W2040522025 hasConcept C185592680 @default.
• W2040522025 hasConcept C192562407 @default.
• W2040522025 hasConcept C199360897 @default.
• W2040522025 hasConcept C202751555 @default.
• W2040522025 hasConcept C2778695967 @default.
• W2040522025 hasConcept C2780841128 @default.
• W2040522025 hasConcept C32909587 @default.
• W2040522025 hasConcept C41008148 @default.
• W2040522025 hasConcept C55493867 @default.
• W2040522025 hasConcept C84416704 @default.
• W2040522025 hasConcept C85789140 @default.
• W2040522025 hasConcept C86803240 @default.
• W2040522025 hasConcept C95444343 @default.
• W2040522025 hasConceptScore W2040522025C121050878 @default.
• W2040522025 hasConceptScore W2040522025C123012128 @default.
• W2040522025 hasConceptScore W2040522025C145822097 @default.
• W2040522025 hasConceptScore W2040522025C1491633281 @default.
• W2040522025 hasConceptScore W2040522025C16224149 @default.
• W2040522025 hasConceptScore W2040522025C171250308 @default.
• W2040522025 hasConceptScore W2040522025C178790620 @default.
• W2040522025 hasConceptScore W2040522025C185592680 @default.
• W2040522025 hasConceptScore W2040522025C192562407 @default.
• W2040522025 hasConceptScore W2040522025C199360897 @default.
• W2040522025 hasConceptScore W2040522025C202751555 @default.
• W2040522025 hasConceptScore W2040522025C2778695967 @default.
• W2040522025 hasConceptScore W2040522025C2780841128 @default.
• W2040522025 hasConceptScore W2040522025C32909587 @default.
• W2040522025 hasConceptScore W2040522025C41008148 @default.
• W2040522025 hasConceptScore W2040522025C55493867 @default.
• W2040522025 hasConceptScore W2040522025C84416704 @default.
• W2040522025 hasConceptScore W2040522025C85789140 @default.
• W2040522025 hasConceptScore W2040522025C86803240 @default.
• W2040522025 hasConceptScore W2040522025C95444343 @default.
• W2040522025 hasIssue "44" @default.

• next