FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2040583506> ?p ?o ?g. }

• W2040583506 endingPage "20633" @default.
• W2040583506 startingPage "20621" @default.
• W2040583506 abstract "Heme oxygenase-1 (HO-1), the rate-limiting enzyme in heme degradation, is an integral membrane protein of the smooth endoplasmic reticulum. However, we detected an HO-1 immunoreactive signal in the nucleus of cultured cells after exposure to hypoxia and heme or heme/hemopexin. Under these conditions, a faster migrating HO-1 immunoreactive band was enriched in nuclear extracts, suggesting that HO-1 was cleaved to allow nuclear entry. This was confirmed by the absence of immunoreactive signal with an antibody against the C terminus and the lack of a C-terminal sequence by gas chromatographymass spectrometry. Incubation with leptomycin B prior to hypoxia abolished nuclear HO-1 and the faster migrating band on Western analysis, suggesting that this process was facilitated by CRM1. Furthermore, preincubation with a cysteine protease inhibitor prevented nuclear entry of green fluorescent protein-labeled HO-1, demonstrating that protease-mediated C-terminal cleavage was also necessary for nuclear transport of HO-1. Nuclear localization was also associated with reduction of HO activity. HO-1 protein, whether it was enzymatically active or not, mediated activation of oxidant-responsive transcription factors, including activator protein-1. Nevertheless, nuclear HO-1 protected cells against hydrogen peroxide-mediated injury equally as well as cytoplasmic HO-1. We speculate that nuclear localization of HO-1 protein may serve to up-regulate genes that promote cytoprotection against oxidative stress. Heme oxygenase-1 (HO-1), the rate-limiting enzyme in heme degradation, is an integral membrane protein of the smooth endoplasmic reticulum. However, we detected an HO-1 immunoreactive signal in the nucleus of cultured cells after exposure to hypoxia and heme or heme/hemopexin. Under these conditions, a faster migrating HO-1 immunoreactive band was enriched in nuclear extracts, suggesting that HO-1 was cleaved to allow nuclear entry. This was confirmed by the absence of immunoreactive signal with an antibody against the C terminus and the lack of a C-terminal sequence by gas chromatographymass spectrometry. Incubation with leptomycin B prior to hypoxia abolished nuclear HO-1 and the faster migrating band on Western analysis, suggesting that this process was facilitated by CRM1. Furthermore, preincubation with a cysteine protease inhibitor prevented nuclear entry of green fluorescent protein-labeled HO-1, demonstrating that protease-mediated C-terminal cleavage was also necessary for nuclear transport of HO-1. Nuclear localization was also associated with reduction of HO activity. HO-1 protein, whether it was enzymatically active or not, mediated activation of oxidant-responsive transcription factors, including activator protein-1. Nevertheless, nuclear HO-1 protected cells against hydrogen peroxide-mediated injury equally as well as cytoplasmic HO-1. We speculate that nuclear localization of HO-1 protein may serve to up-regulate genes that promote cytoprotection against oxidative stress. Heme oxygenase (HO) 3The abbreviations used are: HO, heme oxygenase; sER, smooth endoplasmic reticulum; TM, transmembrane; NLS, nuclear localization sequence; NES, nuclear export sequence; LMB, Leptomycin-B; DE1 and -2, distal enhancer 1 and 2, respectively; NSS, nuclear shuttling sequence; DMEM, Dulbecco's modified Eagle's medium; FBS, fetal bovine serum; MEF, mouse embryo fibroblast; PBS, phosphate-buffered saline; GFP, green fluorescent protein; EGFP, enhanced green fluorescent protein; MALDI, matrix-assisted laser desorption ionization; TOF, time-of-flight; MS, mass spectrometry; EMSA, electrophoretic mobility shift assay; HIV, human immunodeficiency virus; AP, activator protein; CBF, core-binding factor; CDP, CCAT displacement protein; H/HPX, heme-hemopexin; 3T3, NIH3T3. catalyzes the degradation of heme and the formation of biliverdin and carbon monoxide. It is highly inducible in response to various stimuli, including oxidative stress, heavy metals, UV radiation, and inflammation (1Alam J. Shibahara S. Smith A. J. Biol. Chem. 1989; 264: 6371-6375Abstract Full Text PDF PubMed Google Scholar, 2Applegate L.A. Luscher P. Tyrrell R.M. Cancer Res. 1991; 51: 974-978PubMed Google Scholar, 3Keyse S.M. Tyrrell R.M. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 99-103Crossref PubMed Scopus (1118) Google Scholar, 4Wagener F.A. Eggert A. Boerman O.C. Oyen W.J. Verhofstad A. Abraham N.G. Adema G. van Kooyk Y. de Witte T. Figdor C.G. Blood. 2001; 98: 1802-1811Crossref PubMed Scopus (359) Google Scholar). Cytoprotective roles for HO have been demonstrated in many models; however, the mechanisms by which this occurs are still under intensive study. Many have speculated that either heme catabolites, such as biliverdin, or its derivative, bilirubin, and carbon monoxide or the degradation of the pro-oxidant heme results in cytoprotection against oxidative stress (5Otterbein L.E. Kolls J.K. Mantell L.L. Cook J.L. Alam J. Choi A.M. J. Clin. Invest. 1999; 103: 1047-1054Crossref PubMed Scopus (470) Google Scholar, 6Sarady J.K. Otterbein S.L. Liu F. Otterbein L.E. Choi A.M. Am. J. Respir. Cell Mol. Biol. 2002; 27: 739-745Crossref PubMed Scopus (125) Google Scholar, 7Stocker R. Yamamoto Y. McDonagh A.F. Glazer A.N. Ames B.N. Science. 1987; 235: 1043-1046Crossref PubMed Scopus (2942) Google Scholar). Nevertheless, all of the by-products of the HO reaction, despite being potentially cytoprotective, are also cytotoxic. Bilirubin is a potent neurotoxin (8Brodersen R. J. Biol. Chem. 1979; 254: 2364-2369Abstract Full Text PDF PubMed Google Scholar), as is carbon monoxide (9Zhang J. Piantadosi C.A. J. Clin. Invest. 1992; 90: 1193-1199Crossref PubMed Scopus (277) Google Scholar). Furthermore, the HO reaction releases iron, which could interact with cellular oxidants to generate the hydroxyl radical (10Keyse S.M. Tyrrell R.M. Carcinogenesis. 1990; 11: 787-791Crossref PubMed Scopus (104) Google Scholar). Transfection with an inactive HO-1 mutant protein results in cytoprotection against chemically induced oxidative stress (11Hori R. Kashiba M. Toma T. Yachie A. Goda N. Makino N. Soejima A. Nagasawa T. Nakabayashi K. Suematsu M. J. Biol. Chem. 2002; 277: 10712-10718Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar). Because this effect of the mutant HO-1 could not be attributable to changes in heme catabolites, it alludes to a role for the HO-1 protein itself. Furthermore, the inactive form of HO-1 increased catalase and glutathione content (11Hori R. Kashiba M. Toma T. Yachie A. Goda N. Makino N. Soejima A. Nagasawa T. Nakabayashi K. Suematsu M. J. Biol. Chem. 2002; 277: 10712-10718Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar). This suggests that the HO-1 protein itself may play a role in cellular signaling. If this were true, HO-1 would need to migrate to the nucleus or produce nuclear changes that affect transcription. There are several examples of cytoplasmic enzymes serving in nuclear functions. The steroid regulatory element-binding protein is usually bound to the smooth endoplasmic reticulum (sER) at its C terminus and locates to the nucleus after proteolytic cleavage (12Feramisco J.D. Goldstein J.L. Brown M.S. J. Biol. Chem. 2004; 279: 8487-8496Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar). The amphitrophic protein, CTP:phosphocholine cytidylyltransferase is activated when bound to the sER but is enzymatically inactive in a nuclear reservoir (13Cornell R.B. Northwood I.C. Trends Biochem. Sci. 2000; 25: 441-447Abstract Full Text Full Text PDF PubMed Scopus (182) Google Scholar). The transcription factor ATF6 is a type II transmembrane (TM) glycoprotein that is usually anchored to the sER, but it can be proteolytically cleaved at its N terminus and migrate to the nucleus in response to ER stress (14Yoshida H. Okada T. Haze K. Yanagi H. Yura T. Negishi M. Mori K. Mol. Cell. Biol. 2000; 20: 6755-6767Crossref PubMed Scopus (796) Google Scholar). HO-1 was first identified as an integral type I membrane protein of the sER, oriented such that most of the protein, including the active site, resides in the cytoplasm. A short C terminus resides within the lumen of the sER (15Yoshinaga T. Sassa S. Kappas A. J. Biol. Chem. 1982; 257: 7803-7807Abstract Full Text PDF PubMed Google Scholar). Translocation of HO-1 to the nucleus would require one or more proteolytic cleavages, on the cytosolic side of the TM region and/or within the TM domain to release a large HO-1 fragment, containing the N terminus, into the cytosol. In vitro experiments document tryptic cleavage of the C terminus of purified HO-1 protein (16Yoshida T. Ishikawa K. Sato M. Eur. J. Biochem. 1991; 199: 729-733Crossref PubMed Scopus (42) Google Scholar). Whether this occurs in intact cells is still unknown. Most proteins that migrate to the nucleus have nuclear localization sequences (NLSs) that are essential for nuclear uptake (reviewed in Ref. 17Schlenstedt G. FEBS Lett. 1996; 389: 75-79Crossref PubMed Scopus (50) Google Scholar). Nonetheless, small proteins (less than 50 kDa) that lack an NLS do migrate to the nucleus (18Macara I.G. Microbiol. Mol. Biol. Rev. 2001; 65: 570-594Crossref PubMed Scopus (746) Google Scholar). So far, no NLS has been identified on HO-1. In addition to NLSs, nuclear export sequences (NESs) are also important for the proper localization of some cytoplasmic proteins (19Connor M.K. Kotchetkov R. Cariou S. Resch A. Lupetti R. Beniston R.G. Melchior F. Hengst L. Slingerland J.M. Mol. Biol. Cell. 2003; 14: 201-213Crossref PubMed Scopus (161) Google Scholar). These are leucine-rich regions, which bind with the export receptor CRM1, forming a complex with Ran-GTP. This allows for passage through the nuclear pore (20Yan C. Lee L.H. Davis L.I. EMBO J. 1998; 17: 7416-7429Crossref PubMed Scopus (205) Google Scholar). Leptomycin-B (LMB) can inhibit the binding of CRM1 to the NES region (19Connor M.K. Kotchetkov R. Cariou S. Resch A. Lupetti R. Beniston R.G. Melchior F. Hengst L. Slingerland J.M. Mol. Biol. Cell. 2003; 14: 201-213Crossref PubMed Scopus (161) Google Scholar, 20Yan C. Lee L.H. Davis L.I. EMBO J. 1998; 17: 7416-7429Crossref PubMed Scopus (205) Google Scholar). This block in nuclear export results in a predominant nuclear expression of a protein. No one has evaluated whether HO-1 has a functional NES; however, there is a highly conserved region on the rat HO-1 protein at amino acids 207-221 (LNIELSEELQALL) with greater than 90% homology to the NES motif (LX1-3LX2-3LXL) on the human immunodeficiency virus type 1 Rev protein (HIV-Rev), which binds to unspliced HIV-1 pre-mRNA and exports it from the nucleus (21Henderson B.R. Percipalle P. J. Mol. Biol. 1997; 274: 693-707Crossref PubMed Scopus (203) Google Scholar). Once HO-1 accesses the nucleus, it is important to understand how it affects cellular functions. One likely signaling mechanism is modulation of gene transcription. Kravets et al. (22Kravets A. Hu Z. Miralem T. Torno M.D. Maines M.D. J. Biol. Chem. 2004; 279: 19916-19923Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar) reported that biliverdin reductase, which catalyzes reduction of the HO activity product, biliverdin, to bilirubin, can induce the expression of HO-1 protein, suggesting that various components of the bilirubin system could regulate the expression of genes in the pathway. This occurred through activation of transcription factors found within the genomic sequence upstream of the HO-1 gene. Distal enhancer 1 (DE1) and DE2 located at -4 and -10 kb upstream of the transcription start site, respectively, are critical for HO-1 induction by most oxidative stimuli, including heme, heavy metals, and hydrogen peroxide (2Applegate L.A. Luscher P. Tyrrell R.M. Cancer Res. 1991; 51: 974-978PubMed Google Scholar, 23Alam J. Cook J.L. Curr. Pharm. Des. 2003; 9: 2499-2511Crossref PubMed Scopus (288) Google Scholar, 24Keyse S.M. Applegate L.A. Tromvoukis Y. Tyrrell R.M. Mol. Cell. Biol. 1990; 10: 4967-4969Crossref PubMed Scopus (200) Google Scholar, 25Ricchetti G.A. Williams L.M. Foxwell B.M. J. Leukocyte Biol. 2004; 76: 719-726Crossref PubMed Scopus (112) Google Scholar). Both the DE1 and DE2 regions contain multiple stress-responsive elements that represent binding sites of regulatory proteins, such as activator protein (AP)-1, Jun, cAMP-response element-binding protein, Maf, and the Cap'n'collar/basic leucine zipper (CNC-bZIP) transcription factors (26Alam J. J. Biol. Chem. 1994; 269: 25049-25056Abstract Full Text PDF PubMed Google Scholar, 27Alam J. Stewart D. Touchard C. Boinapally S. Choi A.M. Cook J.L. J. Biol. Chem. 1999; 274: 26071-26078Abstract Full Text Full Text PDF PubMed Scopus (1073) Google Scholar). Unlike biliverdin reductase, HO-1 is not a transcription factor; therefore, it is more likely to have an indirect effect on gene transcription, perhaps through modulation of transcription factor binding. Here, we demonstrate that, in response to three different stimuli (hypoxia (3% oxygen) or incubation with hemin or heme-hemopexin (H/HPX)), HO-1 can migrate to the nucleus. Nuclear translocation is associated with truncation of the C terminus of HO-1. In addition, a motif, which we term a putative “nuclear shuttling sequence (NSS),” is important for nuclear import of HO-1. Furthermore, C-terminal truncation of the protein and nuclear migration is also modified by proteolytic cleavage. Nuclear migration resulted in loss of HO activity. We further show that inntracytoplasmic delivery of HO-1 protein activated several transcription factors involved in oxidative stress and that delivery of HO-1 protein or transfection of HO-1 cDNA resulted in activation of a 15-kb oxidant-responsive HO-1 promoter attached to luciferase and protected against hydrogen peroxide-mediated injury, whether the HO-1 protein was active or not. The NIH3T3 mouse fibroblast (3T3) cell line was obtained from the American Type Culture Collection (ATCC) (Manassas, VA). The cells were grown in Dulbecco's minimal essential medium (DMEM) (Invitrogen) supplemented with 10% FBS and 1% antibiotic-antimycotic. Mouse hepatoma cells (Hepa) were cultured in DMEM containing 2% FBS and 0.5% gentamicin as described (28Smith A. Ledford B.E. Biochem. J. 1988; 256: 941-950Crossref PubMed Scopus (38) Google Scholar). Human HEK293 cells were stably transfected with a FLAG tag at the N terminus of the rat HO-1 cDNA (293 FLAGHO-1) and were similarly maintained in DMEM as with the 3T3 cells. NIH3T3 cells stably transfected with a 15-kb oxidant-responsive HO-1 promoter-luciferase construct (3T3-HO-1/luc cells) were also maintained in DMEM. To obtain mouse embryonic fibroblasts (MEF), mice heterozygous for HO-1 mutant allele were timely mated. Embryonic day 13.5 embryos were collected and minced in PBS. The minced tissue was placed in trypsin/EDTA and incubated at 37 °C for 10 min. The suspension was spun at 1000 rpm for 5 min at 10 °C. The pellet was resuspended in DMEM with 10% FBS, 1% nonessential amino acids, and 1% antibiotic/antimycotic and plated on a cell culture flask. The medium was changed the next day to remove cellular debris. Cells were maintained at subconfluence by passaging every 3-4 days with 0.05% trypsin-EDTA. Approximately 48 h prior to the start of experiments, cells were plated to a confluence of 60-70%. All cells were grown in a 5% CO2 humidified atmosphere at 37 °C in 75-cm2 tissue culture flasks. Hypoxic Exposure—3T3 and the 293 FLAGHO-1 cells were exposed to hypoxia (3% O2) for 0-48 h. Incubation with Hemin in Vitro—3T3 cells were incubated with hemin 30 μm for 0-48 h. Incubation with H/HPX in Vitro—Intact rabbit hemopexin was purified, and stoichiometric 1:1 H/HPX complexes (>90-95% saturation) were characterized and quantitated using heme dissolved in Me2SO, as previously described (28Smith A. Ledford B.E. Biochem. J. 1988; 256: 941-950Crossref PubMed Scopus (38) Google Scholar, 29Wilks A. Medzihradszky K.F. Ortiz de Montellano P.R. Biochemistry. 1998; 37: 2889-2896Crossref PubMed Scopus (27) Google Scholar). The extinction coefficients used were 1.1 × 105 m-1 cm-1 at 280 nm for apohemopexin, 1.2 × 105 m-1 cm-1 at 280 nm, and 1.4 × 105 m-1 cm-1 at 405 nm for rabbit mesoheme-hemopexin. Mesoheme was used, because it is more soluble than protoheme and has been shown to have similar biological and regulatory effects in the hemopexin system (30Morgan W.T. Alam J. Deaciuc V. Muster P. Tatum F.M. Smith A. J. Biol. Chem. 1988; 263: 8226-8231Abstract Full Text PDF PubMed Google Scholar). Heme-hemopexin complexes were dialyzed against PBS at 4 °C before use. While in exponential growth, Hepa cells were rinsed and then incubated for up to3hin serum-free HEPES-buffered DMEM, pH 7.4, supplemented with heme-hemopexin (10 μm), heme (10 μm), or equivalent volumes of their control solvents: PBS or Me2SO, respectively. Heme induction of HO-1 in whole cell extracts was used as a control. For this, cells were incubated in serum-free HEPES-buffered DMEM, pH 7.4, supplemented with heme (10 μm) for 3 h. This was performed according to published methods (31Dignam J.D. Lebovitz R.M. Roeder R.G. Nucleic Acids Res. 1983; 11: 1475-1489Crossref PubMed Scopus (9164) Google Scholar) with modifications (32Yang G. Abate A. George A.G. Weng Y.H. Dennery P.A. J. Clin. Invest. 2004; 114: 669-678Crossref PubMed Scopus (101) Google Scholar). To determine which regions of the protein are responsible for nuclear localization, various rat HO-1 cDNA constructs were inserted into a pEGFP-c1 vector (Clontech, Palo Alto, CA). A mutant expressing an HO-1 protein lacking the C-terminal amino acids 267-289 fused to EGFP protein (EGFPHO-1CΔ23) was generated with appropriate primers (see Table 1). The PCR product was cloned into the BglII/BamHI site of the pEGFP-C1 vector.TABLE 1Primer sequences for HO-1 constructsHO-1 cDNA constructsPrimer sequencespEGFPHO-15′-TTCAGATCTATGGAGCGCCCACAGCAC-3′3′-TGGGAATTTATCGCATGTAAGGATCCACC-5′pEGFPHO-1CΔ235′-TTCAGATCTATGGAGCGCCCACAGCAC-3′3′-ACTAGTTCATCCCAGACACCGGGATCCACC-5′pEGFPHO-1ΔNSS5′-TTCAGATCTATGGAGCGCCCACAGCAC-3′ (first step)3′-AGAAGAGGCTAAGACCGCCTTCGGTACCTTA-5′5′-ATAGGTACCACAGAGGAACACAAAGACCA-3′ (second step)3′-TGGGAATTTATCGCATGTAAGGATCCACC-5′pEGFPHO-1CΔ23ΔNSS5′-TTCAGATCTATGGAGCGCCCACAGCAC-3′ (first step)3′-AGAAGAGGCTAAGACCGCCTTCGGTACCTTA-5′5′- ATAGGTACCACAGAGGAACACAAAGACCA -3′ (second step)3′-ACTAGTTCATCCCAGACACCGGGATCCACC-5′pEGFPHO-1ΔRandom5′-TTCAGATCTATGGAGCGCCCACAGCAC-3′ (first step)3′-TCTCAGGGGGTCAGGTCCTGGGTACCTTA-5′5′-ATAGGTACCATGGCCTTGCCAAGCTCT-3′ (second step)3′-TGGGAATTTATCGCATGTAAGGATCCACC-5′pcDNA3.1/HisHO-1myc5′-AGGATCCAGATGGAGCGCCCACAG-3′3′-GACTCGAGCCAGATCCTCTTCTGAGATG-3′pEGFP NSS5′-TTCAGCAGATCTTTCCTGCTCAACATTGAGCTGTTTGAGGAG CTGCAGGCACTGCTGACAGATATCGGTACCATCATA-3′3′-TATGATGGTACCGATATCTGTCAGCAGTGCCTGCAGCTCCTC AAACAGCTCAATGTTGAGCAGGAAAGATCTGCTGAA-5′ Open table in a new tab A mutant expressing HO-1 protein lacking amino acids 207-221 with >90% homology to a known NES (termed NSS; EGF-PHO-1ΔNSS) was also generated in a two-step process with PCR primer pairs (see Table 1). The first PCR product was cloned into the BglII/KpnI site, and the second PCR fragment was cloned into the KpnI/BamHI site of the pEGFP-c1 vector. A double deletion mutant lacking the C terminus and the NSS (EGFPHO-1CΔ23ΔNSS) was generated as above with substitution of the last PCR primer as shown in Table 1. Full-length rat HO-1 cDNA (1-867 bp) was amplified by PCR (see Table 1). The PCR product was cloned into the BamHI/XhoI site of pcDNA3.1/His (Invitrogen) to generate the HisHO1myc construct. The HisHO1myc fragment was then subcloned into p3XFLAGCMV (Sigma) to generate HisHO1FLAG. A rat HO-1 cDNA (HisHO1mutFLAG) expressing an enzymatically inactive HO-1 with a substitution of histidine 25 to alanine was derived from the HisHO1FLAG by PCR using a site-directed mutagenesis kit from Stratagene (QuikChange II; catalog number 200523-4). These constructs were verified by DNA sequencing and then transfected into 3T3 cells using Lipofectamine 2000 (Invitrogen). The transfected cells were grown on slides and visualized by conventional fluorescence microscopy or laser confocal microscopy as previously described (33Dennery P.A. Spitz D.R. Yang G. Tatarov A. Lee C.S. Shegog M.L. Poss K.D. J. Clin. Invest. 1998; 101: 1001-1011Crossref PubMed Scopus (184) Google Scholar). Fluorescence in the 484 nm excitation and 510 nm emission ranges was used to detect EGFP. To test whether the NSS alone mediates compartmentalization of protein into the nucleus, an oligonucleotide containing the NSS sequence corresponding to amino acids 206-222 of rat HO-1 was generated (see Table 1). This sequence was fused to the C terminus of the EGFP protein (NSSEGFP), and the sequence was confirmed by DNA sequencing. The NSS EGFP or EGFP were transiently transfected into the 3T3 cells. The localization of the EGFP protein was determined using immunocytostaining with the GFP antibody (Molecular Probes, Inc. Eugene, OR). Co-staining with the cytoplasmic protein marker calnexin and nuclear marker 4′,6-diamidino-2-phenylindole was performed to demonstrate the subcellular localization using fluorescence microscopy. Cultured 3T3 cells were exposed to hypoxia as described above. The media were changed to DMEM containing 0.5% FBS. Cells were then incubated with a 50 μm concentration of the cysteine protease inhibitor E64d (catalog number E 3132; Sigma) 20 min prior to exposure to hypoxia. Cells were visualized by fluorescent microscopy after immunohistochemical staining with HO-1 antibodies. Cell lysates and nuclear extracts were also subjected to Western analysis. An antibody specific for the C-terminal amino acids of the HO-1 protein (M19) was obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). An N-terminal antibody to a 30-residue synthetic peptide based on the human HO-1 (SPA-896) was obtained from Stressgen (Assay Designs). In order to characterize the nuclear HO-1, 293 FLAGHO-1-transfected cells were exposed to hypoxia. The nuclear FLAGHO-1 was isolated and enriched using a FLAG affinity column as per the manufacturer's instruction (anti-FLAG M2; catalog number A 2220; Sigma). Molecular mass of the nuclear HO-1 was determined using MALDI-TOF mass spectrometry (ABI/PerSeptive Voyager DE-PRO MALDI-TOF; Framingham, MA). Identity of the protein was obtained by trypsin digestion of the colloidal blue-stained protein band followed by liquid chromatography/MS/MS analysis (ThermoElectron LTQ ion trap mass spectrometer; Wistar Proteomic Core Facility, Wistar institute, Philadelphia, PA). The resulting masses and MS/MS spectra were searched against the nonredundant NCBI data base using the TurboSEQUEST browser. Heme oxygenase activity was measured by detecting the amount of carbon monoxide generated from cell lysates, as previously described (34Vreman H.J. Stevenson D.K. Anal. Biochem. 1988; 168: 31-38Crossref PubMed Scopus (191) Google Scholar). A GST HO-1 fusion construct was expressed in the Escherichia coli strain BL21 (Invitrogen). Bacteria were grown to an OD of 0.6-0.8. Thereafter, the fusion protein was induced with 100 μm isopropyl 1-thio-β-d-galactopyranoside at 30 °C. After 5 h, bacteria were harvested and sonicated for 5 min. The fusion protein was purified using a GST purification module (Amersham Biosciences) according to the manufacturer's instructions. Ten μg of GST HO-1 protein was delivered in the 3T3-HO-1/luc or MEF cells using the Pro-Ject™ system (Pierce) as per the manufacturer. Briefly, the Pro-Ject™ reagent was solubilized in 250 μl of methanol. The methanol was evaporated overnight under a sterile hood, and the dried Pro-Ject™ was stored at -20 °C until use. Purified HO-1 protein was diluted in PBS and added to the dried Pro-Ject™ reagent. After a 5-min incubation, the mixture was added to the cell culture medium with 5% serum. After 3 h, cells were washed with PBS and maintained in serum-free medium for the first4hofthe incubation. Thereafter, 5% FBS was reincorporated. In other experiments, purified mutant HO-1 protein (H25A) devoid of catalytic activity (gift of Paul Ortiz de Montellano, University of California, San Francisco) was delivered to the cells as described above. Transient transfection was performed in NIH3T3 cells using Lipofectamine 2000 (Invitrogen). Briefly, 1 day before transfection, 105 cells were seeded in 24-well plates with antibiotic-free growth medium. DNA (0.8 μg) and 2 μl of Lipofectamine 2000 reagent were diluted into 50 μl of DMEM separately. After a 5-min incubation, the DNA and Lipofectamine solution were mixed and incubated for additional 20 min at room temperature. The DNA-Lipofectamine complex was then added to the cells. Cells were grown for 48 h before being subjected to assays. To determine whether HO-1 modulates cellular signaling, lysates from cells receiving GST-purified wild type and mutant HO-1 protein were evaluated for changes in transcription factor activation compared with controls. This was done using a commercially available kit (TransSignal™ Protein/DNA array I, Panomics, Redwood City, CA) according to the manufacturer's instructions. This array did not include Nrf2 or Bach-1. Activations observed with the transcription factor array were verified by electrophoretic mobility shift assay (EMSA) using the appropriate transcription factor consensus DNA binding sequence. After protein delivery, cells were harvested, and the nuclear extract was obtained using a commercially available kit (Pierce) after the addition of a protease inhibitor mixture solution (Sigma). The 32P-labeled probes were incubated with 20 μg of the nuclear protein in a buffer containing 10 mm HEPES (pH 7.9), 1 mm EDTA, 80 mm KCl, 1 μg of poly(dI-dC), and 4% Ficoll. The reaction mixture was incubated at room temperature for 30 min and electrophoresed on 6% polyacrylamide gels. To distinguish nonspecific binding of the nuclear proteins, competition reactions were performed by adding either a 10- or 100-fold excess of nonradiolabeled probe or of a mutated probe to exclude nonspecific binding. Oligonucleotides with the consensus DNA binding sequences for the given transcription factors were synthesized by the PAN Facility at Stanford University (see Table 2).TABLE 2Transcription factor consensus sequences used for EMSATranscription factorConsensus binding sequenceMutant sequenceCBFaAll oligonucleotides other than AP-1 were obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA).5′-AGA CCG TAC GTG ATT GGT TAA TCT CTT-3′5′-AGA CCG TAC GAA ATA CGG GAA TCT CTT-3′Brn-35′-CAC AGC TCA TTA ACG CGC-3′5′-CAC AGC TCA GCA ACG CGC-3′AP-1bObtained from Promega.5′-CGC TTG ATG ACT CAG CCG GAA-3′5′-CGC TTG ATG ACT TGG CCG GAA-3′AP-25′-GAT CGA ACT GAC CGC CCG CGG CCC GT-3′5′-GAT CGA ACT GAC CGC TTG CGG CCC GT-3′NF-kB5′-AGT TGA GGG GAC TTT CCC AGG C-3′5′-AGT TGA GGC GAC TTT CCC AGG C-3′a All oligonucleotides other than AP-1 were obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA).b Obtained from Promega. Open table in a new tab After transfection or protein delivery, the 3T3-HO-1/luc cells were incubated with DMEM containing 1% luciferin for 5 min. The cultures were imaged using the IVIS (In Vivo Imaging System) camera system (Xenogen, Alameda, CA). Pseudoimages of the photon emission were generated, and light intensity was expressed as a ratio to cell counts, as previously described (32Yang G. Abate A. George A.G. Weng Y.H. Dennery P.A. J. Clin. Invest. 2004; 114: 669-678Crossref PubMed Scopus (101) Google Scholar). For comparison between treatment groups, the null hypothesis that there is no difference between treatment means was tested by a single factor analysis of variance for multiple groups or unpaired t test for two groups (Statview 4.02; SAS, Berkeley, CA). Statistical significance (p < 0.05 or p < 0.001) between and within groups was determined by means of the Fischer method of multiple comparisons. HO-1 Protein Localizes to the Nucleus after Hypoxic Exposure—In cultured 3T3 cells, nuclear localization of HO-1 protein was observed after hypoxic exposure (Fig. 1A). The HO-1 signal was enriched in the nucleus as with other known nuclear proteins, such as acetylated histone 3 and CRM1 (data not shown). In the sER, HO-1 is oriented such that most of the protein, including the active site, resides in the cytoplasm. A short C terminus resides within the lumen of the sER (35Yoshinaga T. Sassa S. Kappas A. J. Biol. Chem. 1982; 257: 7778-7785Abstract Full Text PDF PubMed Google Scholar). With hypoxic exposure, two HO-1 immunoreactive bands were observed upon Western analysis in the whole cell extract, with one band migrating at ∼28 kDa and the other migrating at 32 kDa (Fig. 1B). Using the M19 antibody directed toward the C terminus of HO-1, loss of all HO-1 immunoreactivity was noted in the nuclear extracts, whereas one immunoreactive band migrating at 32 kDa was observed in the whole cell extracts (Fig. 1B). These data suggest that the nuclear HO-1 immunoreactive form does not contain the C terminus. Lack of nuclear localization of the M19 immunoreactive signal by fluorescence microscopy provides further evidence that the nuclear form of HO-1 is devoid of the C terminus (Fig. 1C). HO-1 Protein Localizes to the Nucleus after Hemin or H/HPX Incubation—To address whether the generation of a nuclear form of HO-1 was a general phenomenon, we also investigated whether other known inducers of HO-1 had a similar effect on HO-1 nuclear migration as hypoxia. In cultured Hepa cells, increased signal intensity and nuclear localization of HO-1 immunoreactive protein was observed after incubation with 10 μm heme for 4 h or 20 μm H/HPX for 5 h (Fig. 2A). Using confocal microscopy and co-staining with propidium iodide, the M19 immunoreactive signal was never localized to the nucl" @default.
• W2040583506 created "2016-06-24" @default.
• W2040583506 creator A5029013365 @default.
• W2040583506 creator A5029061671 @default.
• W2040583506 creator A5030930499 @default.
• W2040583506 creator A5039683677 @default.
• W2040583506 creator A5048214020 @default.
• W2040583506 creator A5049492104 @default.
• W2040583506 creator A5065910871 @default.
• W2040583506 creator A5082515168 @default.
• W2040583506 creator A5083304330 @default.
• W2040583506 creator A5083977886 @default.
• W2040583506 creator A5088375301 @default.
• W2040583506 date "2007-07-01" @default.
• W2040583506 modified "2023-10-06" @default.
• W2040583506 title "Heme Oxygenase-1 Protein Localizes to the Nucleus and Activates Transcription Factors Important in Oxidative Stress" @default.
• W2040583506 cites W1489079707 @default.
• W2040583506 cites W1522366213 @default.
• W2040583506 cites W1540020157 @default.
• W2040583506 cites W1598307552 @default.
• W2040583506 cites W1623210390 @default.
• W2040583506 cites W1631638135 @default.
• W2040583506 cites W1966582616 @default.
• W2040583506 cites W1966973099 @default.
• W2040583506 cites W1978391516 @default.
• W2040583506 cites W1981596580 @default.
• W2040583506 cites W1984216393 @default.
• W2040583506 cites W1985288736 @default.
• W2040583506 cites W1993243592 @default.
• W2040583506 cites W1995910926 @default.
• W2040583506 cites W1999554896 @default.
• W2040583506 cites W2001483373 @default.
• W2040583506 cites W2004815940 @default.
• W2040583506 cites W2005218056 @default.
• W2040583506 cites W2007789422 @default.
• W2040583506 cites W2009552582 @default.
• W2040583506 cites W2014189709 @default.
• W2040583506 cites W2028323326 @default.
• W2040583506 cites W2029010155 @default.
• W2040583506 cites W2041553103 @default.
• W2040583506 cites W2043162478 @default.
• W2040583506 cites W2047077257 @default.
• W2040583506 cites W2048841495 @default.
• W2040583506 cites W2050525007 @default.
• W2040583506 cites W2055801667 @default.
• W2040583506 cites W2062145087 @default.
• W2040583506 cites W2062589077 @default.
• W2040583506 cites W2063902684 @default.
• W2040583506 cites W2067040292 @default.
• W2040583506 cites W2067786896 @default.
• W2040583506 cites W2076000066 @default.
• W2040583506 cites W2076019855 @default.
• W2040583506 cites W2076032447 @default.
• W2040583506 cites W2081643570 @default.
• W2040583506 cites W2082249712 @default.
• W2040583506 cites W2082969427 @default.
• W2040583506 cites W2099361532 @default.
• W2040583506 cites W2102100103 @default.
• W2040583506 cites W2102585686 @default.
• W2040583506 cites W2102685783 @default.
• W2040583506 cites W2118040139 @default.
• W2040583506 cites W2122203755 @default.
• W2040583506 cites W2125824495 @default.
• W2040583506 cites W2134637205 @default.
• W2040583506 cites W2145287139 @default.
• W2040583506 cites W2158869723 @default.
• W2040583506 cites W2159820690 @default.
• W2040583506 cites W2162076197 @default.
• W2040583506 cites W2276049885 @default.
• W2040583506 cites W32952758 @default.
• W2040583506 cites W4238537242 @default.
• W2040583506 doi "https://doi.org/10.1074/jbc.m607954200" @default.
• W2040583506 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17430897" @default.
• W2040583506 hasPublicationYear "2007" @default.
• W2040583506 type Work @default.
• W2040583506 sameAs 2040583506 @default.
• W2040583506 citedByCount "354" @default.
• W2040583506 countsByYear W20405835062012 @default.
• W2040583506 countsByYear W20405835062013 @default.
• W2040583506 countsByYear W20405835062014 @default.
• W2040583506 countsByYear W20405835062015 @default.
• W2040583506 countsByYear W20405835062016 @default.
• W2040583506 countsByYear W20405835062017 @default.
• W2040583506 countsByYear W20405835062018 @default.
• W2040583506 countsByYear W20405835062019 @default.
• W2040583506 countsByYear W20405835062020 @default.
• W2040583506 countsByYear W20405835062021 @default.
• W2040583506 countsByYear W20405835062022 @default.
• W2040583506 countsByYear W20405835062023 @default.
• W2040583506 crossrefType "journal-article" @default.
• W2040583506 hasAuthorship W2040583506A5029013365 @default.
• W2040583506 hasAuthorship W2040583506A5029061671 @default.
• W2040583506 hasAuthorship W2040583506A5030930499 @default.
• W2040583506 hasAuthorship W2040583506A5039683677 @default.
• W2040583506 hasAuthorship W2040583506A5048214020 @default.
• W2040583506 hasAuthorship W2040583506A5049492104 @default.
• W2040583506 hasAuthorship W2040583506A5065910871 @default.
• W2040583506 hasAuthorship W2040583506A5082515168 @default.

• next