FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2040600319> ?p ?o ?g. }

• W2040600319 endingPage "6914" @default.
• W2040600319 startingPage "6903" @default.
• W2040600319 abstract "The SCR1 gene, coding for the 7SL RNA of the signal recognition particle, is the last known class III gene ofSaccharomyces cerevisiae that remains to be characterized with respect to its mode of transcription and promoter organization. We show here that SCR1 represents a unique case of a non-tRNA class III gene in which intragenic promoter elements (the TFIIIC-binding A- and B-blocks), corresponding to the D and TΨC arms of mature tRNAs, have been adapted to a structurally different small RNA without losing their transcriptional function. In fact, despite the presence of an upstream canonical TATA box, SCR1transcription strictly depends on the presence of functional, albeit quite unusual, A- and B-blocks and requires all the basal components of the RNA polymerase III transcription apparatus, including TFIIIC. Accordingly, TFIIIC was found to protect from DNase I digestion an 80-bp region comprising the A- and B-blocks. B-block inactivation completely compromised TFIIIC binding and transcription capacity in vitro and in vivo. An inactivating mutation in the A-block selectively affected TFIIIC binding to this promoter element but resulted in much more dramatic impairment of in vivo than in vitrotranscription. Transcriptional competition and nucleosome disruption experiments showed that this stronger in vivo defect is due to a reduced ability of A-block-mutated SCR1 to compete with other genes for TFIIIC binding and to counteract the assembly of repressive chromatin structures through TFIIIC recruitment. A kinetic analysis further revealed that facilitated RNA polymerase III recycling, far from being restricted to typical small sized class III templates, also takes place on the 522-bp-long SCR1 gene, the longest known class III transcriptional unit. The SCR1 gene, coding for the 7SL RNA of the signal recognition particle, is the last known class III gene ofSaccharomyces cerevisiae that remains to be characterized with respect to its mode of transcription and promoter organization. We show here that SCR1 represents a unique case of a non-tRNA class III gene in which intragenic promoter elements (the TFIIIC-binding A- and B-blocks), corresponding to the D and TΨC arms of mature tRNAs, have been adapted to a structurally different small RNA without losing their transcriptional function. In fact, despite the presence of an upstream canonical TATA box, SCR1transcription strictly depends on the presence of functional, albeit quite unusual, A- and B-blocks and requires all the basal components of the RNA polymerase III transcription apparatus, including TFIIIC. Accordingly, TFIIIC was found to protect from DNase I digestion an 80-bp region comprising the A- and B-blocks. B-block inactivation completely compromised TFIIIC binding and transcription capacity in vitro and in vivo. An inactivating mutation in the A-block selectively affected TFIIIC binding to this promoter element but resulted in much more dramatic impairment of in vivo than in vitrotranscription. Transcriptional competition and nucleosome disruption experiments showed that this stronger in vivo defect is due to a reduced ability of A-block-mutated SCR1 to compete with other genes for TFIIIC binding and to counteract the assembly of repressive chromatin structures through TFIIIC recruitment. A kinetic analysis further revealed that facilitated RNA polymerase III recycling, far from being restricted to typical small sized class III templates, also takes place on the 522-bp-long SCR1 gene, the longest known class III transcriptional unit. The most represented RNA polymerase III (Pol III) 1Pol IIIRNA polymerase IIIntnucleotide(s)WTwild typesnRNAsmall nuclear RNA 1Pol IIIRNA polymerase IIIntnucleotide(s)WTwild typesnRNAsmall nuclear RNA -transcribed genes, those coding for the tRNAs and the 5 S rRNA, have a highly conserved intragenic promoter comprising the binding sites for the general transcription factor TFIIIC (A- and B-blocks) and for the 5 S-specific factor TFIIIA (C-block). This conservation probably reflects the dual function of the above elements as both nucleation sites for transcription complex assembly and key determinants of tRNA and 5 S rRNA structure. Within the same genes, in fact, an extremely high sequence variability is displayed by the structurally unconstrained, vicinal upstream region. This region provides the binding surface for the initiation factor TFIIIB (1Kassavetis G.A. Riggs D.L. Negri R. Nguyen L.H. Geiduschek E.P. Mol. Cell. Biol. 1989; 9: 2551-2566Crossref PubMed Scopus (185) Google Scholar) and can modulate the strength of the intragenic promoter (see Refs. 2Yukawa Y. Sugita M. Choisne N. Small I. Sugiura M. Plant J. 2000; 22: 439-447Crossref PubMed Scopus (39) Google Scholar, 3Lee Y. Wong W.M. Guyer D. Erkine A.M. Nazar R.N. J. Mol. Biol. 1997; 269: 676-683Crossref PubMed Scopus (14) Google Scholar, 4Ouyang C. Martinez M.J. Young L.S. Sprague K.U. Mol. Cell. Biol. 2000; 20: 1329-1343Crossref PubMed Scopus (25) Google Scholar and references therein). TFIIIB, which in yeast is minimally composed of the TATA-box-binding protein, the TFIIB-related factor BRF (or TFIIIB70), and the Pol III-specific factor B“ (or TFIIIB90), is generally assembled on tRNA genes in a TFIIIC-dependent manner (5White R.J. RNA Polymerase III Transcription. 2nd Ed. Springer-Verlag, Berlin, Germany1998Crossref Google Scholar). One extreme case of 5′-flanking sequence effect, however, has recently been documented for some tRNA genes of Saccharomyces cerevisiae, which, due to the presence of a canonical TATA box in their 5′-flanking region, are capable of autonomous TFIIIB binding and TFIIIC-independent in vitro transcription (6Dieci G. Percudani R. Giuliodori S. Bottarelli L. Ottonello S. J. Mol. Biol. 2000; 299: 601-613Crossref PubMed Scopus (53) Google Scholar). Another indication of the constraints imposed on intragenic promoter elements by their overlapping structural and functional roles is the remarkable variability of promoter organization displayed by the minority of class III genes not coding for tRNAs and 5 S rRNAs. One group of such genes, well exemplified by the metazoan U6 snRNA and the human 7SK RNA genes, entirely relies for transcription on upstream promoter elements similar to those of RNA polymerase II-transcribed genes. Another group, which includes theXenopus selenocysteine tRNA gene and theEBER2 gene of the Epstein-Barr virus, is characterized by mixed promoters composed of both intragenic and extragenic elements (reviewed in Ref. 5White R.J. RNA Polymerase III Transcription. 2nd Ed. Springer-Verlag, Berlin, Germany1998Crossref Google Scholar). The highly flexible organization of these genes is best illustrated by the 7SL RNA genes, coding for the conserved RNA component of the signal recognition particle, which in eukaryotes have undergone a remarkable variation in their mode of transcription. In humans, 7SL RNA gene transcription requires both an extended upstream region (7Ullu E. Weiner A.M. Nature. 1985; 318: 371-374Crossref PubMed Scopus (124) Google Scholar), including a binding site for the RNA polymerase II activator ATF (8Bredow S. Surig D. Muller J. Kleinert H. Benecke B.J. Nucleic Acids Res. 1990; 18: 6779-6784Crossref PubMed Scopus (38) Google Scholar), and an unusual intragenic promoter element that stimulates transcription through a structural motif at the 5′ end of the nascent transcript (9Kleinert H. Gladen A. Geisler M. Benecke B.J. J. Biol. Chem. 1988; 263: 11511-11515Abstract Full Text PDF PubMed Google Scholar, 10Bredow S. Kleinert H. Benecke B.J. Gene (Amst.). 1990; 86: 217-225Crossref PubMed Scopus (28) Google Scholar, 11Emde G. Frontzek A. Benecke B.J. RNA. 1997; 3: 538-549PubMed Google Scholar). At variance with the human genes, plant 7SL gene transcription only requires an upstream promoter composed of a TATA box and an upstream stimulatory element identical to that of all plant U-snRNA gene promoters (12Heard D.J. Filipowicz W. Marques J.P. Palme K. Gualberto J.M. Nucleic Acids Res. 1995; 23: 1970-1976Crossref PubMed Scopus (19) Google Scholar). Yet another promoter organization is found in the 7SL genes of protozoans of the family Trypanosomatidae, whose transcription depends on the A- and B-blocks of a divergently oriented, companion tRNA gene positioned 100 bp upstream of the 7SL transcription start site (13Nakaar V. Dare A.O. Hong D. Ullu E. Tschudi C. Mol. Cell. Biol. 1994; 14: 6736-6742Crossref PubMed Scopus (75) Google Scholar, 14Ben-Shlomo H. Levitan A. Beja O. Michaeli S. Nucleic Acids Res. 1997; 25: 4977-4984Crossref PubMed Scopus (22) Google Scholar). As a final example of promoter divergence, the 7SL genes of the yeastsSchizosaccharomyces pombe and S. cerevisiae both contain intragenic sequences resembling the A- and B-blocks (15Felici F. Cesareni G. Hughes J.M. Mol. Cell. Biol. 1989; 9: 3260-3268Crossref PubMed Scopus (83) Google Scholar, 16Willis I.M. Eur. J. Biochem. 1993; 212: 1-11Crossref PubMed Scopus (191) Google Scholar), but an upstream TATA box has been shown to play an essential transcriptional role in the fission yeast 7SL RNA gene (17Rödicker F. Ossenbuhl F. Michels D. Benecke B.J. Gene Expr. 1999; 8: 165-174PubMed Google Scholar). Despite the critical evolutionary position of S. cerevisiae as one of the most primitive lower eukaryotes and the fact that its RNA polymerase III transcription system is by far the best characterized biochemically, the 7SL RNA gene of this organism, SCR1, is still uncharacterized. This single copy gene was identified more than a decade ago because of the extremely high abundance of its RNA product (15Felici F. Cesareni G. Hughes J.M. Mol. Cell. Biol. 1989; 9: 3260-3268Crossref PubMed Scopus (83) Google Scholar) but was never subjected to transcriptional analysis, and only very recently was it shown to be transcribed by RNA polymerase III (18Briand J.F. Navarro F. Gadal O. Thuriaux P. Mol. Cell. Biol. 2001; 21: 189-195Crossref PubMed Scopus (31) Google Scholar). In particular, the contribution of the putative A- and B-blocks and the factor requirement for SCR1 transcription are unknown. Another interesting, as yet unanswered question is how the very abundant SCR1 product, which accounts for ∼0.2% of total yeast RNA (15Felici F. Cesareni G. Hughes J.M. Mol. Cell. Biol. 1989; 9: 3260-3268Crossref PubMed Scopus (83) Google Scholar), can be efficiently synthesized from a single copy gene. RNA polymerase III nucleotide(s) wild type small nuclear RNA RNA polymerase III nucleotide(s) wild type small nuclear RNA By taking advantage of a highly purified and well characterized RNA polymerase III in vitro transcription system and of a viable, slow growth S. cerevisiae strain lackingSCR1 (19Hann B.C. Walter P. Cell. 1991; 67: 131-144Abstract Full Text PDF PubMed Scopus (254) Google Scholar), we have carried out an extensive in vitro and in vivo analysis of SCR1 promoter architecture, initiation complex assembly, and transcription elongation and reinitiation properties. 198 types of A-block sequences and 60 types of B-block sequences were derived from the alignment of 931 eukaryotic tRNA gene sequences. 2R. Percudani, unpublished results. These unique sequences were used to construct updated weight matrices for Pol3scan (available on the World Wide Web at irisbioc.bio.unipr.it/pol3scan.html), a program based on weight matrix analysis of tRNA gene promoters (20Pavesi A. Conterio F. Bolchi A. Dieci G. Ottonello S. Nucleic Acids Res. 1994; 22: 1247-1256Crossref PubMed Scopus (87) Google Scholar). Pol3scan, with properly modified cut-off parameters, was then used to locate A- and B-block-like elements in SCR1. The S. cerevisiae SCR1 gene was PCR-amplified from yeast genomic DNA (strain S288C) using the high fidelity Deep Vent DNA polymerase (New England Biolabs) and the following oligonucleotide primers: SCR1fw (5′-TGATCAACTTAGCCAGGACATCC) and SCR1rev (5′-GTTCTAAGTATTCTCATTTTATCC). Amplification conditions and insertion into the pBlueScript KS (+) vector (Stratagene) were as described (6Dieci G. Percudani R. Giuliodori S. Bottarelli L. Ottonello S. J. Mol. Biol. 2000; 299: 601-613Crossref PubMed Scopus (53) Google Scholar). The identity of the 992-bp amplified fragment, containing the SCR1 coding sequence (522 bp) plus 246 bp of 5′-flanking and 224 bp of 3′-flanking sequences, was verified by dideoxy chain termination sequencing. The sequence of the amplified SCR1 fragment, which exactly matches the one retrieved from the Munich Information Center for Protein Sequences (MIPS) Web site (mips.gsf.de/proj/yeast/CYGD), presents some differences in the coding region with respect to the originally published SCR1 sequence (15Felici F. Cesareni G. Hughes J.M. Mol. Cell. Biol. 1989; 9: 3260-3268Crossref PubMed Scopus (83) Google Scholar). These are three insertions (G at position +49, G at position +98, and C and A at positions +362 and +363, respectively) and one deletion (a missing G between positions +403 and +404); numbering refers to the MIPS (and our) sequence of theSCR1 coding region. The 5′Δ-32, TATAdown, Adown, and C4T SCR1mutants were obtained by PCR using wild type SCR1 in pBlueScript-KS (pBlueScript-SCR1) as template and the SCR1rev oligonucleotide (see above) together with the following mutagenic 5′ oligonucleotides (mutated positions are underlined) as primers: 5′Δ-32, 5′-GTATAAAATCGAAAGTTTATTCCAATTG; TATAdown, 5′-GTGTAAAATCGAAAGTTTATTCCAATTG; Adown, 5′-GTATAAAATCGAAAGTTTATTCCAATTGTGCTAGGCTGTAATGGCTTTCTCCTGGGATGGGATACG; C4T, 5′-GTATAAAATCGAAAGTTTATTCCAATTGTGCTAGGTTGTAATGG. The (A/TATA)down mutant was derived from SCR1 Adown by mutagenic PCR using TATAdown and SCR1rev primers. The BdownSCR1 mutant was constructed by recombinant PCR (21Higuchi R. Innis M.A. Gelfand D.H. Sninsky J.J. White T.J. PCR Protocols: A Guide to Methods and Applications. Academic Press, Inc., San Diego1990: 177-183Google Scholar). Two overlapping PCR primary products were generated using the 5′Δ-32 oligonucleotide in combination with Bdown-rev (5′-CGCGAGGAAGGATTTCTTCCTGGCC) and the SCR1rev oligonucleotide in combination with the Bdown-fw primer (5′-GGCCAGGAAGAAATCCTTCCTCGCG). Mutated positions in Bdown-rev and Bdown-fw are underlined. After gel purification, primary amplification products were mixed and used as templates in a subsequent amplification reaction, employing SCR1fw and SCR1rev as “outside” primers, which yielded the desired full-length secondary product. The 3′Δ+90 mutant was obtained by PCR using WTSCR1 as template, the 5′Δ-32 oligonucleotide as a forward primer, and the 3′Δ+90 oligonucleotide (5′-AAAAAAACGTGCAATCCGTGTCTAGCCGCG) as a reverse primer, which allowed us to introduce an artificial Pol III terminator. All of the mutatedSCR1 fragments were inserted into the pGEM-T Easy vector (Promega) and sequence-verified. For in vivo analyses,SCR1 variants were subcloned asBamHI-HindIII (WT SCR1) orSphI-SacI (all of the mutants) fragments into the YEp352 vector (22Hill J.E. Myers A.M. Koerner T.J. Tzagoloff A. Yeast. 1986; 2: 163-167Crossref PubMed Scopus (1076) Google Scholar) cut with the same enzymes. All restriction and modification enzymes were from Amersham Biosciences, Inc. Multiple round and single round in vitro transcription of SCR1 using recombinant or purified Pol III transcription components was carried out as described (6Dieci G. Percudani R. Giuliodori S. Bottarelli L. Ottonello S. J. Mol. Biol. 2000; 299: 601-613Crossref PubMed Scopus (53) Google Scholar) except for the use of SUPERase-In (Ambion) as an RNase inhibitor. In the single round transcription experiments of Fig.7, B and C, UTP was present at a concentration of 100 μm. The heparin resistance of the 12-mer RNA-containing ternary complex assembled on SCR1-C4T (Fig.7 A) was evaluated as follows. Ternary complexes were assembled by incubating SCR1-C4T template and transcription components in the presence of 0.5 mm ATP and GTP and 2.5 μm [α-32P]UTP (Amersham Biosciences; 800 Ci/mmol). The output of a single round of transcription was then evaluated by adding CTP (0.5 mm), together with excess unlabeled UTP (2 mm), with or without 100 μmheparin, and allowing transcript elongation to proceed for 1 min. RNA size markers were generated by T7 RNA polymerase (Amersham Biosciences)in vitro transcription (23Dieci G. Bottarelli L. Ballabeni A. Ottonello S. Protein Expr. Purif. 2000; 18: 346-354Crossref PubMed Scopus (31) Google Scholar) of linearized pBlueScript-KS constructs bearing inserts of different sizes in the SmaI site: the S. cerevisiae I(TAT)LR1 tRNA gene and flanking regions (302 bp (6Dieci G. Percudani R. Giuliodori S. Bottarelli L. Ottonello S. J. Mol. Biol. 2000; 299: 601-613Crossref PubMed Scopus (53) Google Scholar)) and the sequences coding for yeast ribosomal proteins L13 (600 bp (23Dieci G. Bottarelli L. Ballabeni A. Ottonello S. Protein Expr. Purif. 2000; 18: 346-354Crossref PubMed Scopus (31) Google Scholar)) and S24 (408 bp). 3L. Bottarelli and G. Dieci, unpublished results. For the DNase I footprinting experiment in Fig. 4 A, a 992-bpSCR1 fragment, 5′-end-labeled on the sense strand, was generated by PCR using 5′-labeled SCR1fw and unlabeled SCR1rev as primers and pBlueScript-SCR1 as a template. The fragments utilized for the footprinting experiments of Fig. 4 B (256 bp) were 5′-end-labeled on the antisense strand by PCR using a 5′-labeled oligonucleotide primer hybridizing between positions +224 and +200 (5′-GCCGGGACACTTCAGAACGGAC), the 5′Δ-32 oligonucleotide as a forward primer, and the SCR1 5′Δ-32, Adown, and Bdown mutants as PCR templates. Radiolabeled fragments were purified by agarose gel electrophoresis followed by elution with the QIAquick Gel Extraction Kit (Qiagen); the specific radioactivity of purified fragments (250 ng each) was about 1500 cpm/fmol. DNase I digestion mixtures (20 μl) contained 16 fmol of the SCR1 fragment, 10 ng/μl pBlueScript-KS, 20 mm Hepes/KOH (pH 8.0), 170 mm KCl, 5% (v/v) glycerol, 0.1 mg/ml ultrapure bovine serum albumin (Ambion), 0.5 mm dithiothreitol, and 50–100 ng of affinity-purified TFIIIC (24Huet J. Manaud N. Dieci G. Peyroche G. Conesa C. Lefebvre O. Ruet A. Riva M. Sentenac A. Methods Enzymol. 1996; 273: 249-267Crossref PubMed Google Scholar). Briefly, TFIIIC-DNA complexes, formed upon incubation for 15 min at 20 °C, were treated for exactly 1 min with 0.35 ng of pancreatic deoxyribonuclease I (Amersham Biosciences; E2215Y type), followed by the addition of 22 μl of blocking solution (20 mm EDTA, 1% (w/v) SDS, 0.2m NaCl). Footprinting mixtures were phenol-extracted, ethanol-precipitated in the presence of 30 μg of carrier RNA (Sigma; R 6625 type), and fractionated on 6% polyacrylamide, 7m urea sequencing gels, which were then dried and phosphorimaged with a Personal Imager FX (Bio-Rad). DNA fragments for gel retardation assays were radiolabeled by PCR, using 5′-labeled amplification primers as described above for the preparation of DNA fragments for footprinting analysis. DNA binding reactions were conducted in a final volume of 15 μl and contained 25 mmTris-HCl (pH 8.0), 10% glycerol, 90 mm(NH4)2SO4, 1 mg/ml ultrapure bovine serum albumin, 15 μg/ml supercoiled plasmid DNA (pBlueScript-KS), 4 fmol of radiolabeled DNA fragment (∼8,000 cpm), and varying amounts of TFIIIC purified up to the DEAE-Sephadex A-25 step (24Huet J. Manaud N. Dieci G. Peyroche G. Conesa C. Lefebvre O. Ruet A. Riva M. Sentenac A. Methods Enzymol. 1996; 273: 249-267Crossref PubMed Google Scholar). Native gel electrophoresis and subsequent analysis were carried out as described (25Pizzi S. Dieci G. Frigeri P. Piccoli G. Stocchi V. Ottonello S. J. Biol. Chem. 1999; 274: 2539-2548Abstract Full Text Full Text PDF PubMed Scopus (6) Google Scholar). The yeast strain YRA130 (a kind gift of Peter Walter, University of California, San Francisco), in which the entire SCR1 gene, except for the first 14 nucleotides, has been deleted and replaced with the HIS3 gene (19Hann B.C. Walter P. Cell. 1991; 67: 131-144Abstract Full Text PDF PubMed Scopus (254) Google Scholar), was utilized for in vivo complementation and expression assays. This strain was transformed with the different YEp352-SCR1constructs by the lithium acetate procedure (26Ito H. Fukuda Y. Murata K. Kimura A. J. Bacteriol. 1983; 153: 163-168Crossref PubMed Google Scholar), and the resulting transformants were selected for uracil auxotrophy on SD plates supplemented with tryptophan, lysine, and adenine. Total RNA was prepared according to a previously described procedure (27Wise J.A. Methods Enzymol. 1991; 194: 405-415Crossref PubMed Scopus (55) Google Scholar). Primer extension reactions were carried out as described (6Dieci G. Percudani R. Giuliodori S. Bottarelli L. Ottonello S. J. Mol. Biol. 2000; 299: 601-613Crossref PubMed Scopus (53) Google Scholar), using 5 μg of total yeast RNA and a 5′-labeled oligonucleotide primer (5′-CCCTTGCCAAAGGGCGTGCAATCCG) complementary to the coding region ofSCR1 between positions +90 and +115. Complementation of the YRA130 slow growth phenotype (19Hann B.C. Walter P. Cell. 1991; 67: 131-144Abstract Full Text PDF PubMed Scopus (254) Google Scholar) was qualitatively evaluated by visual inspection of selective (SD) or nonselective (YPD) plates, on which cultures of freshly transformed clones were spotted. Strains UKY403 and MHY308 (a kind gift of Michael Grunstein (UCLA)) were employed to analyze the effects of nucleosome disruption onSCR1 transcription. Strain UKY403, in which the two histone H4 genes have been disrupted, survives with a unique, centromeric plasmid-borne histone H4 gene under the control of the GAL1promoter (28Kim U.J. Han M. Kayne P. Grunstein M. EMBO J. 1988; 7: 2211-2219Crossref PubMed Scopus (155) Google Scholar). MHY308 is isogenic to UKY403, except that its sole histone H4 gene is under the control of its own wild type promoter (29Han M. Grunstein M. Cell. 1988; 55: 1137-1145Abstract Full Text PDF PubMed Scopus (312) Google Scholar). Both strains were transformed with YEp352 constructs carrying WT and mutant (5′Δ-32 and Adown) SCR1 minigene variants, in which 120 bp at the 3′ terminus had been deleted by PCR using the SCR1_mini oligonucleotide (5′-AAAAAAAATGTGCTATCCCGGCCGCCTCC) as a reverse primer, either SCR1fw or 5′Δ-32 as forward primers, and WT or Adown SCR1 as PCR templates. The SCR1_mini oligonucleotide introduces an artificial terminator sequence at position +400 of theSCR1 sequence, so that transcription of the various minigene templates yields ∼400-nt-long transcripts that are easily distinguishable from the endogenous 522-nt-long SCR1 RNA. The glucose shift experiment was carried out as described previously (30Marsolier M.C. Tanaka S. Livingstone-Zatchej M. Grunstein M. Thoma F. Sentenac A. Genes Dev. 1995; 9: 410-422Crossref PubMed Scopus (45) Google Scholar). For RNA gel blot analysis, RNA samples (5 μg) were electrophoresed on 6% polyacrylamide, 7 m urea gels and transferred to Hybond-N membranes (Amersham Biosciences), which were then probed with the same 5′-labeled oligonucleotide utilized for primer extension analysis. Hybridization was carried out overnight at 28 °C in 5× SSC, 5× Denhardt's solution, 0.1 mg/ml denatured salmon sperm DNA, 0.5% (w/v) SDS, followed by three short washings in 2× SSC, 0.1% SDS. Hybridization products were visualized by autoradiography and quantified by phosphorimaging. Pol3scan, a program based on weight matrix analysis of tRNA gene promoters (20Pavesi A. Conterio F. Bolchi A. Dieci G. Ottonello S. Nucleic Acids Res. 1994; 22: 1247-1256Crossref PubMed Scopus (87) Google Scholar,31Percudani R. Pavesi A. Ottonello S. J. Mol. Biol. 1997; 268: 322-330Crossref PubMed Scopus (229) Google Scholar), was used to locate A- and B-blocks in the SCR1sequence. No such element was identified with the default cutoff score (−34.14) usually employed for the identification of tRNA gene promoters. With a more permissive cutoff (−38), however, putative A- and B-blocks, with a spacing almost perfectly matching that of mature tRNAs, were identified at positions +9 and +51, respectively (Fig.1 A). A search of the Signal Recognition Particle Database (32Gorodkin J. Knudsen B. Zwieb C. Samuelsson T. Nucleic Acids Res. 2001; 29: 169-170Crossref PubMed Scopus (50) Google Scholar), conducted with the same parameters, revealed the presence of A- and B-blocks above the −38 cutoff threshold only in the case of fungal 7SL RNA genes (Yarrowia lipolytica and S. pombe). In tRNA genes, these two promoter elements code for highly conserved structural modules of the tRNA (the D and TΨC arms, respectively); their sequence conservation is thus influenced by factors not necessarily related to promoter strength. As shown in Fig. 1 B, the A- and B-blocks ofSCR1 are embedded in a very distinct structural context, so that sequence variations may be expected because of the different structural constraints. Indeed, the putative promoter elements ofSCR1 display distinguishing features as compared with the consensus of the tDNA A- and B-blocks (Fig. 1 A). The most prominent of them is the substitution of the canonical B-block starting sequence GGTT (in which the invariant T at the fourth position corresponds to the precursor of the essential pseudouridine residue of the tRNA TΨC arm) with GGAA, a sequence that never occurs in tRNA gene promoters but is present in RPR1, another noncanonical yeast class III gene coding for the RNA subunit of RNase P (33Lee J.Y. Evans C.F. Engelke D.R. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 6986-6990Crossref PubMed Scopus (50) Google Scholar). Another sequence feature never occurring in tRNA genes, but found inSCR1, is TC at positions +16 and +17, corresponding to positions +14 and +15 of the consensus tRNA gene A-block (Fig.1 A; numbering starts from the first position of the mature tRNA), which are sites of important tertiary interactions in tRNA structure (34Dirheimer G. Keith G. Dumas P. Westhof E. Söll D. RajBhandary U.L. tRNA: Structure, Biosynthesis, and Function. American Society for Microbiology, Washington, D. C.1995: 93-126Google Scholar). Other, more evident features of SCR1 are a TATA element upstream of the transcription start site (position −31) and, as already noted (15Felici F. Cesareni G. Hughes J.M. Mol. Cell. Biol. 1989; 9: 3260-3268Crossref PubMed Scopus (83) Google Scholar), a typical T-rich terminator element at position +518. The coding region ofSCR1, plus 246 bp of 5′-flanking and 224 bp of 3′-flanking sequence, was PCR-amplified from S. cerevisiae genomic DNA and inserted into the pBlueScript KS vector. The resulting construct was then assayed in a Pol III-specific in vitrotranscription system containing balanced amounts of recombinant TATA-box-binding protein and BRF proteins, partially purified B“ and TFIIIC fractions, and highly purified RNA polymerase III (6Dieci G. Percudani R. Giuliodori S. Bottarelli L. Ottonello S. J. Mol. Biol. 2000; 299: 601-613Crossref PubMed Scopus (53) Google Scholar, 24Huet J. Manaud N. Dieci G. Peyroche G. Conesa C. Lefebvre O. Ruet A. Riva M. Sentenac A. Methods Enzymol. 1996; 273: 249-267Crossref PubMed Google Scholar). Transcription products were run on a polyacrylamide/urea gel (Fig.2 A, lane 4) in parallel with standard RNAs of known size produced by T7 RNA polymerase (Fig. 2 A, lanes 1–3). A single transcript, with a size very close to that of the natural scR1 RNA (519 nt for strain ATCC 25657 (15Felici F. Cesareni G. Hughes J.M. Mol. Cell. Biol. 1989; 9: 3260-3268Crossref PubMed Scopus (83) Google Scholar) and 522 nt for strain S288C; see “Materials and Methods”), was synthesized in the in vitro reconstituted Pol III system. A comparison between the in vitro and thein vivo synthesized scR1 RNA is presented in Fig.2 B, which shows the results of a primer extension analysis that was carried out to map the SCR1 transcription start site. Both in vitro (lane 1) andin vivo (lane 2) synthesized transcripts initiated at the same A residue corresponding to the first nucleotide of the scR1 RNA (15Felici F. Cesareni G. Hughes J.M. Mol. Cell. Biol. 1989; 9: 3260-3268Crossref PubMed Scopus (83) Google Scholar). Thus, the in vitroreconstituted Pol III system supports the efficient and faithful transcription of the SCR1 gene. The transcription factor requirements for scR1 RNA synthesis are reported in Fig. 2 C, which shows that both TFIIIC and the three components of yeast TFIIIB are essential for SCR1 transcription. Very low levels of TFIIIC-independent transcription were observed in some experiments. In accord with the presence of a TATA element at position −31 (6Dieci G. Percudani R. Giuliodori S. Bottarelli L. Ottonello S. J. Mol. Biol. 2000; 299: 601-613Crossref PubMed Scopus (53) Google Scholar), this background, TFIIIC-independent transcription was abolished by TATA-box inactivation (data not shown). When the natural B” fraction was replaced by recombinant yeast TFIIIB90 (35Rüth J. Conesa C. Dieci G. Lefebvre O. Düsterhoft A. Ottonello S. Sentenac A. EMBO J. 1996; 15: 1941-1949Crossref PubMed Scopus (77) Google Scholar), SCR1transcription was reduced by about 7-fold and was not significantly stimulated by the addition of the TFIIIE fraction (data not shown (36Dieci G. Duimio L. Coda-Zabetta F. Sprague K.U. Ottonello S. J. Biol. Chem. 1993; 268: 11199-11207Abstract Full Text PDF PubMed Google Scholar)). Mutations were next introduced into the different putative control elements previously identified by sequence analysis, and the resulting mutants were assayed for template activity both in vitro and in vivo. For the in vivo analysis, mutagenized SCR1derivatives were inserted into the multicopy plasmid YEp352 (22Hill J.E. Myers A.M. Koerner T.J. Tzagoloff A. Yeast. 1986; 2: 163-167Crossref PubMed Scopus (1076) Google Scholar) and transformed into the scr1::HIS null mutant strain YRA130 (19Hann B.C. Walter P. Cell. 1991; 67: 131-144Abstract Full Text PDF PubMed Scopus (25" @default.
• W2040600319 created "2016-06-24" @default.
• W2040600319 creator A5028942759 @default.
• W2040600319 creator A5062188264 @default.
• W2040600319 creator A5082752753 @default.
• W2040600319 creator A5087756146 @default.
• W2040600319 creator A5091907746 @default.
• W2040600319 date "2002-03-01" @default.
• W2040600319 modified "2023-10-10" @default.
• W2040600319 title "Intragenic Promoter Adaptation and Facilitated RNA Polymerase III Recycling in the Transcription of SCR1, the 7SL RNA Gene ofSaccharomyces cerevisiae" @default.
• W2040600319 cites W1547123197 @default.
• W2040600319 cites W1559116353 @default.
• W2040600319 cites W1566363113 @default.
• W2040600319 cites W1662064273 @default.
• W2040600319 cites W1750256253 @default.
• W2040600319 cites W1876905084 @default.
• W2040600319 cites W1880398223 @default.
• W2040600319 cites W1965700324 @default.
• W2040600319 cites W1969924980 @default.
• W2040600319 cites W1973782344 @default.
• W2040600319 cites W1977889868 @default.
• W2040600319 cites W1981398735 @default.
• W2040600319 cites W1984783168 @default.
• W2040600319 cites W1991398089 @default.
• W2040600319 cites W2014836146 @default.
• W2040600319 cites W2018924496 @default.
• W2040600319 cites W2027978880 @default.
• W2040600319 cites W2032563124 @default.
• W2040600319 cites W2034458377 @default.
• W2040600319 cites W2035926239 @default.
• W2040600319 cites W2037301644 @default.
• W2040600319 cites W2040232267 @default.
• W2040600319 cites W2040731511 @default.
• W2040600319 cites W2041451554 @default.
• W2040600319 cites W2046236649 @default.
• W2040600319 cites W2049883153 @default.
• W2040600319 cites W2052586760 @default.
• W2040600319 cites W2053652297 @default.
• W2040600319 cites W2062710228 @default.
• W2040600319 cites W2068397766 @default.
• W2040600319 cites W2068525614 @default.
• W2040600319 cites W2072714273 @default.
• W2040600319 cites W2075341922 @default.
• W2040600319 cites W2082395806 @default.
• W2040600319 cites W2086605270 @default.
• W2040600319 cites W2090706358 @default.
• W2040600319 cites W2115073295 @default.
• W2040600319 cites W2145385008 @default.
• W2040600319 cites W2161718046 @default.
• W2040600319 cites W2165304085 @default.
• W2040600319 cites W2168470864 @default.
• W2040600319 cites W2259195410 @default.
• W2040600319 cites W2296824236 @default.
• W2040600319 cites W4246308822 @default.
• W2040600319 doi "https://doi.org/10.1074/jbc.m105036200" @default.
• W2040600319 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11741971" @default.
• W2040600319 hasPublicationYear "2002" @default.
• W2040600319 type Work @default.
• W2040600319 sameAs 2040600319 @default.
• W2040600319 citedByCount "47" @default.
• W2040600319 countsByYear W20406003192012 @default.
• W2040600319 countsByYear W20406003192013 @default.
• W2040600319 countsByYear W20406003192014 @default.
• W2040600319 countsByYear W20406003192016 @default.
• W2040600319 countsByYear W20406003192017 @default.
• W2040600319 countsByYear W20406003192018 @default.
• W2040600319 countsByYear W20406003192020 @default.
• W2040600319 countsByYear W20406003192021 @default.
• W2040600319 countsByYear W20406003192022 @default.
• W2040600319 countsByYear W20406003192023 @default.
• W2040600319 crossrefType "journal-article" @default.
• W2040600319 hasAuthorship W2040600319A5028942759 @default.
• W2040600319 hasAuthorship W2040600319A5062188264 @default.
• W2040600319 hasAuthorship W2040600319A5082752753 @default.
• W2040600319 hasAuthorship W2040600319A5087756146 @default.
• W2040600319 hasAuthorship W2040600319A5091907746 @default.
• W2040600319 hasBestOaLocation W20406003191 @default.
• W2040600319 hasConcept C101762097 @default.
• W2040600319 hasConcept C104317684 @default.
• W2040600319 hasConcept C138885662 @default.
• W2040600319 hasConcept C150194340 @default.
• W2040600319 hasConcept C172768829 @default.
• W2040600319 hasConcept C179926584 @default.
• W2040600319 hasConcept C196117886 @default.
• W2040600319 hasConcept C25281209 @default.
• W2040600319 hasConcept C2776449523 @default.
• W2040600319 hasConcept C36457064 @default.
• W2040600319 hasConcept C41258723 @default.
• W2040600319 hasConcept C41895202 @default.
• W2040600319 hasConcept C54355233 @default.
• W2040600319 hasConcept C64350747 @default.
• W2040600319 hasConcept C67705224 @default.
• W2040600319 hasConcept C70916841 @default.
• W2040600319 hasConcept C82381507 @default.
• W2040600319 hasConcept C86803240 @default.
• W2040600319 hasConceptScore W2040600319C101762097 @default.
• W2040600319 hasConceptScore W2040600319C104317684 @default.
• W2040600319 hasConceptScore W2040600319C138885662 @default.

• next