FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2040835521> ?p ?o ?g. }

• W2040835521 endingPage "10209" @default.
• W2040835521 startingPage "10202" @default.
• W2040835521 abstract "In cystic fibrosis (CF) airways, abnormal epithelial ion transport likely initiates mucus stasis, resulting in persistent airway infections and chronic inflammation. Mucus clearance is regulated, in part, by activation of apical membrane receptors coupled to intracellular calcium (Ca2+i) mobilization. We have shown that Ca2+i signals resulting from apical purinoceptor (P2Y2-R) activation are increased in CF compared with normal human airway epithelia. The present study addressed the mechanism for the larger apical P2Y2-R-dependent Ca2+i signals in CF human airway epithelia. We show that the increased Ca2+i mobilization in CF was not specific to P2Y2-Rs because it was mimicked by apical bradykinin receptor activation, and it did not result from a greater number of P2Y2-R or a more efficient coupling between P2Y2-Rs and phospholipase C-generated inositol 1,4,5-trisphosphate. Rather, the larger apical P2Y2-R activation-promoted Ca2+i signals in CF epithelia resulted from an increased density and Ca2+ storage capacity of apically confined endoplasmic reticulum (ER) Ca2+ stores. To address whether the ER up-regulation resulted from ER retention of misfolded ΔF508 CFTR or was an acquired response to chronic luminal airway infection/inflammation, three approaches were used. First, ER density was studied in normal and CF sweat duct human epithelia expressing high levels of ΔF508 CFTR, and it was found to be the same in normal and CF epithelia. Second, apical ER density was morphometrically analyzed in airway epithelia from normal subjects, ΔF508 homozygous CF patients, and a disease control, primary ciliary dyskinesia; it was found to be greater in both CF and primary ciliary dyskinesia. Third, apical ER density and P2Y2-R activation-mobilized Ca2+i, which were investigated in airway epithelia in a long term culture in the absence of luminal infection, were similar in normal and CF epithelia. To directly test whether luminal infection/inflammation triggers an up-regulation of the apically confined ER Ca2+ stores, normal airway epithelia were chronically exposed to supernatant from mucopurulent material from CF airways. Supernatant treatment expanded the apically confined ER, resulting in larger apical P2Y2-R activation-dependent Ca2+i responses, which reproduced the increased Ca2+i signals observed in CF epithelia. In conclusion, the mechanism for the larger Ca2+i signals elicited by apical P2Y2-R activation in CF airway epithelia is an expansion of the apical ER Ca2+ stores triggered by chronic luminal airway infection/inflammation. Greater ER-derived Ca2+i signals may provide a compensatory mechanism to restore, at least acutely, mucus clearance in CF airways. In cystic fibrosis (CF) airways, abnormal epithelial ion transport likely initiates mucus stasis, resulting in persistent airway infections and chronic inflammation. Mucus clearance is regulated, in part, by activation of apical membrane receptors coupled to intracellular calcium (Ca2+i) mobilization. We have shown that Ca2+i signals resulting from apical purinoceptor (P2Y2-R) activation are increased in CF compared with normal human airway epithelia. The present study addressed the mechanism for the larger apical P2Y2-R-dependent Ca2+i signals in CF human airway epithelia. We show that the increased Ca2+i mobilization in CF was not specific to P2Y2-Rs because it was mimicked by apical bradykinin receptor activation, and it did not result from a greater number of P2Y2-R or a more efficient coupling between P2Y2-Rs and phospholipase C-generated inositol 1,4,5-trisphosphate. Rather, the larger apical P2Y2-R activation-promoted Ca2+i signals in CF epithelia resulted from an increased density and Ca2+ storage capacity of apically confined endoplasmic reticulum (ER) Ca2+ stores. To address whether the ER up-regulation resulted from ER retention of misfolded ΔF508 CFTR or was an acquired response to chronic luminal airway infection/inflammation, three approaches were used. First, ER density was studied in normal and CF sweat duct human epithelia expressing high levels of ΔF508 CFTR, and it was found to be the same in normal and CF epithelia. Second, apical ER density was morphometrically analyzed in airway epithelia from normal subjects, ΔF508 homozygous CF patients, and a disease control, primary ciliary dyskinesia; it was found to be greater in both CF and primary ciliary dyskinesia. Third, apical ER density and P2Y2-R activation-mobilized Ca2+i, which were investigated in airway epithelia in a long term culture in the absence of luminal infection, were similar in normal and CF epithelia. To directly test whether luminal infection/inflammation triggers an up-regulation of the apically confined ER Ca2+ stores, normal airway epithelia were chronically exposed to supernatant from mucopurulent material from CF airways. Supernatant treatment expanded the apically confined ER, resulting in larger apical P2Y2-R activation-dependent Ca2+i responses, which reproduced the increased Ca2+i signals observed in CF epithelia. In conclusion, the mechanism for the larger Ca2+i signals elicited by apical P2Y2-R activation in CF airway epithelia is an expansion of the apical ER Ca2+ stores triggered by chronic luminal airway infection/inflammation. Greater ER-derived Ca2+i signals may provide a compensatory mechanism to restore, at least acutely, mucus clearance in CF airways. Airway epithelia constitute the major interface between inspired air and the airway wall. These epithelia are highly polarized and exhibit a series of integrated functions that provide mechanical cleansing, i.e. mucus clearance, as a primary mode of lung defense. The individual airway epithelial functional components that mediate mucus clearance, including ion transport, mucin secretion, and ciliary beat frequency (1Wanner A. Salathe M. O'Riordan T.G. Am. J. Respir. Crit. Care Med. 1996; 154: 1868-1902Crossref PubMed Scopus (566) Google Scholar), are regulated in part by intracellular calcium (Ca2+i) (2Knowles M.R. Noone P.G. Bennett W.D. Boucher R.C. Baum G.L. Priel Z. Roth Y. Liron N. Ostfeld E. Cilia, Mucus, and Mucociliary Interactions. Marcel Dekker, Inc., New York1998: 307-315Google Scholar, 3Ribeiro C.M.P. Paradiso A.M. Lazarowski E. Boucher R.C. Salathe M. Cilia, Mucus and Mucociliary Interactions. Marcel Dekker, Inc., New York2001: 303-314Google Scholar). Airway epithelial Ca2+i mobilization can be elicited by selective autocrine and/or paracrine activation of apical or basolateral membrane heterotrimeric G protein-coupled receptors (GPCRs) 1The abbreviations used are: GPCR, G protein-coupled receptor; PLC, phospholipase C; IP3, inositol 1,4,5-trisphosphate; IP3R, IP3 receptor; ER, endoplasmic reticulum; P2Y2-R, purinoceptor; CF, cystic fibrosis; CFTR, cystic fibrosis transmembrane conductance regulator; PCD, primary ciliary dyskinesia; SMM, supernatant from mucopurulent material from CF airways; PBS, phosphate-buffered saline; RPA, ribonuclease protection assay; DIOC6(3), dihexaoxacarbocyanine; CaCC, Ca2+-activated Cl– channel; Ins, inositol.1The abbreviations used are: GPCR, G protein-coupled receptor; PLC, phospholipase C; IP3, inositol 1,4,5-trisphosphate; IP3R, IP3 receptor; ER, endoplasmic reticulum; P2Y2-R, purinoceptor; CF, cystic fibrosis; CFTR, cystic fibrosis transmembrane conductance regulator; PCD, primary ciliary dyskinesia; SMM, supernatant from mucopurulent material from CF airways; PBS, phosphate-buffered saline; RPA, ribonuclease protection assay; DIOC6(3), dihexaoxacarbocyanine; CaCC, Ca2+-activated Cl– channel; Ins, inositol. linked to phospholipase C (PLC) stimulation, which generates inositol 1,4,5-trisphosphate (IP3) and induces Ca2+ release from endoplasmic reticulum (ER) stores (3Ribeiro C.M.P. Paradiso A.M. Lazarowski E. Boucher R.C. Salathe M. Cilia, Mucus and Mucociliary Interactions. Marcel Dekker, Inc., New York2001: 303-314Google Scholar, 4Paradiso A.M. Ribeiro C.M.P. Boucher R.C. J. Gen. Physiol. 2001; 117: 53-68Crossref PubMed Scopus (96) Google Scholar). 5′ nucleotides (ATP/UTP), released by airway epithelial cells and sensed by apical membrane purinoceptors (P2Y2-Rs) (5Lazarowski E.R. Boucher R.C. News Physiol. Sci. 2000; 16: 1-5Google Scholar), may be the dominant autocrine regulators of Ca2+i mobilization in airway epithelia (3Ribeiro C.M.P. Paradiso A.M. Lazarowski E. Boucher R.C. Salathe M. Cilia, Mucus and Mucociliary Interactions. Marcel Dekker, Inc., New York2001: 303-314Google Scholar).In airway epithelia of patients with cystic fibrosis (CF), the functional absence of the cystic fibrosis transmembrane conductance regulator (CFTR) results in a diminished periciliary liquid layer depth (6Matsui H. Grubb B.R. Tarran R. Randell S.H. Gatzy J.T. Davis C.W. Boucher R.C. Cell. 1998; 95: 1005-1015Abstract Full Text Full Text PDF PubMed Scopus (925) Google Scholar) and a reduction in mucus clearance. Likewise, abnormal mucus clearance is found in patients with primary ciliary dyskinesia (PCD), a syndrome that results from defective airway epithelial ciliary proteins linked to a decreased ciliary activity (7Eliasson R. Mossberg B. Camner P. Afzelius B.A. N. Engl. J. Med. 1977; 297: 1-6Crossref PubMed Scopus (251) Google Scholar). In both diseases, persistent airways infection and inflammation are the predominant clinical phenotypic characteristics consequent to the impairment of mucus clearance (8Leigh M.W. Disorders of the Respiratory Tract of Children. W. B. Saunders Co., Philadelphia, PA1998Google Scholar).There are clues that airway epithelia may regulate the Ca2+i signaling pathway in response to airways disease. For example, in vivo studies established that the nasal transepithelial electrical potential difference responses to agents that activate P2Y2-Rs and promote Ca2+i mobilization (e.g. ATP/UTP) are greater in CF patients than in normal subjects (9Knowles M.R. Clarke L.L. Boucher R.C. N. Engl. J. Med. 1991; 325: 533-538Crossref PubMed Scopus (422) Google Scholar, 10Knowles M.R. Clarke L.L. Boucher R.C. Chest. 1992; 101: 60S-63SAbstract Full Text Full Text PDF PubMed Scopus (48) Google Scholar). In vitro studies also detected a larger apical Ca2+i-dependent Cl– conductance in CF airway epithelia (9Knowles M.R. Clarke L.L. Boucher R.C. N. Engl. J. Med. 1991; 325: 533-538Crossref PubMed Scopus (422) Google Scholar, 11Willumsen N.J. Boucher R.C. Am. J. Physiol. 1989; 256: C226-C233Crossref PubMed Google Scholar, 12Clarke L.L. Grubb B.R. Yankaskas J.R. Cotton C.U. McKenzie A. Boucher R.C. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 479-483Crossref PubMed Scopus (311) Google Scholar, 13Grubb B.R. Vick R.N. Boucher R.C. Am. J. Physiol. 1994; 266: C1478-C1483Crossref PubMed Google Scholar). In addition, we recently reported that apical P2Y2-R activation promotes greater Ca2+i mobilization in CF compared with normal human nasal epithelia (4Paradiso A.M. Ribeiro C.M.P. Boucher R.C. J. Gen. Physiol. 2001; 117: 53-68Crossref PubMed Scopus (96) Google Scholar). However, the underlying mechanism(s) responsible for the regulation of the increased Ca2+i responsiveness of CF airway epithelia and its functional consequences are unknown.Therefore, in the present study we investigated the mechanism for the augmented apical GPCR-derived Ca2+i signals in CF airway epithelia by probing the P2Y2-R/Ca2+ signaling system in functional, biochemical, and cell biological studies in normal and CF human airway epithelia. Further, we investigated whether the raised Ca2+i signals in CF are a manifestation of the molecular pathogenesis of mutant CFTR (ΔF508 CFTR) or are an acquired host response to chronic infection/inflammation in vivo. We compared ER density in non-infected human sweat duct epithelia from normal and ΔF508 CF individuals and in human airway epithelia from normal, ΔF508 CF, and PCD patients with chronic airway infection and inflammation. In addition, ER density and apical P2Y2-R activation-induced Ca2+i mobilization were studied in short term and long term cultures of normal and CF bronchial epithelia. Finally, to directly address whether chronic airway infection/inflammation, independently of defective CFTR, up-regulated apically confined ER Ca2+ stores, ER density and UTP-mobilized ER Ca2+ were investigated in normal airway epithelia chronically exposed to supernatant from CF airways mucopurulent material (SMM).EXPERIMENTAL PROCEDURESCell Culture and Freshly Excised Tissue—Tissues and cells were obtained under the auspices of protocols approved by the Institutional Committee on the Protection of the Rights of Human Subjects. Excess tissues from human donor lungs and excised recipient lungs were obtained at the time of lung transplantation from main stem or lobar bronchi. Tissues were either fixed in 4% paraformaldehyde and embedded in paraffin or used for cell isolation. Bronchial epithelial cells were provided by the University of North Carolina CF Center Tissue Core. Normal and CF (ΔF508 homozygous) cells were harvested and cultured as described previously (4Paradiso A.M. Ribeiro C.M.P. Boucher R.C. J. Gen. Physiol. 2001; 117: 53-68Crossref PubMed Scopus (96) Google Scholar). Cultures were maintained at an air-liquid surface interface, and polarized primary cultures were studied at 6–11 days (short term monolayers) or 30–40 days later (long term well differentiated). Normal and CF cultures were apically washed with sterile PBS, and the serosal media were replenished every 2–4 days.Nasal scrapes obtained from normal (n = 4, ages 33–35), ΔF508 homozygous CF (n = 4, ages 25–46), or PCD (n = 3, ages 34–57) individuals and skin biopsies from normal (n = 4, ages 28–47) and ΔF508 homozygous CF (n = 5, ages 31–47) individuals were used for ER density studies.Ca2+iStudies—6–11- or 30–40-day-old cultures were loaded with fura-2/AM, and Ca2+i was measured under bilateral perfusion as reported previously (4Paradiso A.M. Ribeiro C.M.P. Boucher R.C. J. Gen. Physiol. 2001; 117: 53-68Crossref PubMed Scopus (96) Google Scholar). Ca2+i signals were calibrated as described previously (14Paradiso A.M. Cheng E.H. Boucher R.C. Am. J. Physiol. 1991; 261: L63-L69PubMed Google Scholar). There were no systematic differences between CF and normal epithelia as a result of differential fura-2 behavior, including dye loading. Baseline Ca2+i levels were the same in CF and normal epithelia, as reported previously (4Paradiso A.M. Ribeiro C.M.P. Boucher R.C. J. Gen. Physiol. 2001; 117: 53-68Crossref PubMed Scopus (96) Google Scholar), and no consistent differences were observed between CF and normal epithelia in the sustained phase of Ca2+i mobilization following activation of P2Y2-Rs.Ribonuclease Protection Assay (RPA)—A 398-base pair human P2Y2-R fragment was prepared by reverse transcriptase-PCR from human airway RNA and ligated into the pCRII vector (Invitrogen). P2Y2-R primer sequences were as follows: 253F, 5′AGACCTGGGCCCCTGGAATGACACCATC3′; and 651R, 5′AGACGCCCAGACACCGGTGCACGCTGATG3′.Individual clones were verified by automatic sequencing. Templates for RPAs were prepared by PCR from the P2Y2-R plasmid with the following primers for the PCRII vector: PCRII SP6, 5′ATGATTACGCCAAGCTATTTAGGTGACACT3′ and PCRII T7, 5′GACGGCCAGTGAATTGTAATACGACTCACT3′.50 ng of purified PCR fragment was transcribed, incorporating the [32P]UTP label with the Maxiscript kit (Ambion), and RPA was performed with the RPA III kit (Ambion). Protected fragments were quantified by phosphorimaging with ImageQuant software (Amersham Biosciences).Phospholipase C Activity—After 4 days in culture, monolayers of normal and CF bronchial epithelia were radiolabeled with [3H]inositol for 4–5 days (15Shears S.B. Shears S.B. Signalling by Inositides: A Practical Approach. Oxford University Press, Oxford1997Google Scholar). For 20 min prior to study, cultures were placed in serum-free media containing 10 mm lithium and [3H]inositol followed by 5 min 100 μm mucosal UTP-induced PLC activity measured as reported previously (15Shears S.B. Shears S.B. Signalling by Inositides: A Practical Approach. Oxford University Press, Oxford1997Google Scholar). The levels of 3H-labeled inositol phosphates were normalized to [3H]IP6 levels because IP6 levels are not affected by agonist stimulation (16Yang X. Rudolf M. Carew M.A. Yoshida M. Nerreter V. Riley A.M. Chung S.K. Bruzik K.S. Potter B.V. Schultz C. Shears S.B. J. Biol. Chem. 1999; 274: 18973-18980Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar). Assays were performed in duplicate.Immunostaining of Calreticulin and IP3 receptors (IP3Rs) and DIOC6(3) Staining—The immunostaining of calreticulin and IP3Rs in cultures and deparaffinized native bronchial epithelial or skin biopsy sections was performed according to a modification of our previous method (17Ribeiro C.M. Reece J. Putney Jr., J.W. J. Biol. Chem. 1997; 272: 26555-26561Abstract Full Text Full Text PDF PubMed Scopus (156) Google Scholar). For calreticulin and IP3Rs staining, samples were incubated with a rabbit anti-calreticulin antibody (1:100 dilution, Affinity Bioreagents) and a mouse anti-IP3R antibody that recognizes all IP3R isoforms (1:100 dilution, Calbiochem) for 60 min at 37 °C. This incubation was followed by three PBS washes and a 30-min incubation at 25 °C with a fluorescein-labeled goat anti-rabbit antibody (1:20 dilution for calreticulin, Kirkegaard & Perry Laboratories) and with a Texas Red-labeled goat anti-mouse antibody (1:200 dilution for IP3Rs, Jackson Immunoresearch Laboratories). As controls, the primary antibodies were omitted or substituted with rabbit and mouse γ-globulins (Jackson Immunoresearch Laboratories). For antibody-independent ER staining, sections of native bronchial epithelia were labeled with the fluorescent dihexaoxacarbocyanine dye DIOC6(3) by incubation with 250 ng/ml DIOC6(3) for 1 min at room temperature in PBS followed by three washes with PBS as we have reported previously (17Ribeiro C.M. Reece J. Putney Jr., J.W. J. Biol. Chem. 1997; 272: 26555-26561Abstract Full Text Full Text PDF PubMed Scopus (156) Google Scholar). The Ca2+ store markers and the DIOC6(3) signals were studied by laser confocal microscopy (Leica, model TCS 4D, PL APO 63x/1.20 mm water lens) in the XZ or XY scanning mode.To quantify the fluorescence intensity of labeled calreticulin and IP3Rs and DIOC6(3), multiple scans were obtained from each sample, and regions of interest were designated in the apical domains with the MetaMorph software. The same acquisition parameters (e.g. laser power, contrast, brightness, and pinhole value) were employed for each channel to acquire the images from normal and CF cultures or native tissue in experiments performed on the same day. The fluorescence intensity values from the regions of interest were averaged from paired normal and CF cultures, native bronchial epithelia, skin biopsies, or normal cultures treated with PBS or supernatant from CF airways mucopurulent material (SMM, see “Studies with Infectious/Inflammatory Material from CF Airways”).Calreticulin Western Blot Analysis—Monolayers of normal and CF bronchial epithelia were lysed and blotted as reported previously (18Sarkadi B. Bauzon D. Huckle W.R. Earp H.S. Berry A. Suchindran H. Price E.M. Olsen J.C. Boucher R.C. Scarborough G.A. J. Biol. Chem. 1992; 267: 2087-2095Abstract Full Text PDF PubMed Google Scholar). The calreticulin antibody was a rabbit polyclonal (1:5000 dilution, Affinity Bioreagents), and the secondary antibody was an anti-rabbit horseradish peroxidase (1:10,000 dilution, Amersham Biosciences). Blots were developed with enhanced chemiluminescence.Electron Microscopy—Nasal scrapes from normal, ΔF508 homozygous CF, and PCD individuals were fixed in 2% glutaraldehyde plus 2% paraformaldehyde plus 0.25% tannic acid, post-fixed in 1% OsO4, and processed for electron microscopy (19Robinson G. Gray T. Bancroft J.D. Stevens A. Theory and Practice of Histological Techniques. Churchill Livingstone, Inc., New York1996Google Scholar). Apical ER morphometric scoring was performed double blind. Only ciliated cells were analyzed, and repairing cells with migrating basal bodies (procentrioles) and micrographs with tangential cuts were excluded. The apical domain was defined as the region 1–3.4 μm (to exclude basal bodies) from the apical plasma membrane. The criteria for identifying ER were: parallel membranes in elongated or oval strands, containing an amorphous center without cristae (to exclude mitochondria), or electron-dense particles (to exclude rough ER, because it is increased in repairing cells), and not stacked (to exclude Golgi). Data are expressed as number of ER strands/μm2.Studies with Infectious/Inflammatory Material from CF Airways— Mucopurulent material was harvested from the airway lumens of excised human CF lungs infected with Pseudomonas aeruginosa and S. aureus at the time of transplant and provided by the University of North Carolina CF Center Tissue Core. This material was centrifuged at 100,000 rpm (60 min, 4 °C), and the supernatant was filtered through a 0.2-μm filter and frozen at –80 °C. Preliminary studies revealed that treatment of airway epithelia with SMM from individual CF lungs infected with P. aeruginosa and Staphyloccocus aureus induced epithelial hyperinflammation. Because of the small volume of SMM/patient, SMMs from nine CF lungs (five males and four females, age 17–48 years, four ΔF508 homozygous and five unknown genotypes) were pooled to assure homogeneous stimulus throughout experiments.To address the effect of SMM on ER size and Ca2+ storage, PBS or SMM (40 μl) was applied to the mucosal surfaces of well differentiated cultures of normal bronchial epithelia for 48 h, and then either ER volume was studied by calreticulin immunostaining as described above or peak Ca2+i responses to 100 μm mucosal UTP were measured, respectively.Statistics—Data represent the mean ± S.E. from at least three experiments from three individual donors and were analyzed by unpaired t test or two-way analysis of variance. Statistical significance was defined with p < 0.05.RESULTSLarger Apical GPCR-modulated Ca2+iResponses Are a Generalized Feature of CF Airway Epithelia—We have shown previously that CF human nasal epithelia exhibit larger rises in Ca2+i in response to apical P2Y2-R activation than normal nasal epithelia (4Paradiso A.M. Ribeiro C.M.P. Boucher R.C. J. Gen. Physiol. 2001; 117: 53-68Crossref PubMed Scopus (96) Google Scholar). To investigate whether this difference was generalized to lower airways, we studied the effect of a maximal dose (100 μm) UTP applied to the apical surface of 6–11-day-old monolayers of normal and CF human bronchial epithelial cultures on Ca2+i mobilization (4Paradiso A.M. Ribeiro C.M.P. Boucher R.C. J. Gen. Physiol. 2001; 117: 53-68Crossref PubMed Scopus (96) Google Scholar). UTP addition to normal bronchial epithelium induced an initial Ca2+i peak, resulting from IP3-dependent ER Ca2+ store release, and a sustained rise in Ca2+i, resulting from activation of capacitative Ca2+ entry (3Ribeiro C.M.P. Paradiso A.M. Lazarowski E. Boucher R.C. Salathe M. Cilia, Mucus and Mucociliary Interactions. Marcel Dekker, Inc., New York2001: 303-314Google Scholar) (Fig. 1A). P2Y2-R activation in CF epithelium (Fig. 1B) resulted in a markedly higher Ca2+i mobilization peak than in normal epithelium, in agreement with our findings in nasal epithelia (4Paradiso A.M. Ribeiro C.M.P. Boucher R.C. J. Gen. Physiol. 2001; 117: 53-68Crossref PubMed Scopus (96) Google Scholar). Fig. 1C illustrates the summary ΔCa2+i data (peak-baseline Ca2+i values) from these studies.We next addressed whether the larger Ca2+i mobilization in CF was a specific property of P2Y2-R activation or was generalized to other GPCRs linked to PLC at the apical membrane. Fig. 1, D and E, shows representative Ca2+i tracings from 6–11-day-old monolayers of normal and CF bronchial epithelial cultures, respectively, following apical addition of a maximal dose (5 μm) of bradykinin. Fig. 1F depicts the summary ΔCa2+i data from these experiments, illustrating that apical bradykinin receptor activation in CF also resulted in an increased ΔCa2+i mobilization. Because the greater bradykinin-induced Ca2+i signal in CF mimicked that elicited by P2Y2-R activation, the larger ΔCa2+i signal in CF does not depend on a specific class of GPCRs.P2Y2-R Number and P2Y2-R-dependent PLC Activation Are the Same in Normal and CF Airway Epithelia—We tested whether P2Y2-R expression was increased in CF. Because no antibodies or radioligands were available for P2Y2-R quantification, we used an RPA to assess P2Y2-R steady-state mRNA levels in 6–11-day-old primary culture monolayers of normal and CF bronchial airway epithelia. No difference was found in P2Y2-R mRNA levels from normal compared with CF human airway epithelia (Fig. 2, A and B).Fig. 2P2Y2-R expression and P2Y2-R-PLC coupling efficiency are similar in normal and CF bronchial epithelial cultures.A, P2Y2-R steady-state mRNA levels from three different samples from short term primary culture monolayers of normal and CF human bronchial epithelia. B, P2Y2-R mRNA expression levels (corrected for actin mRNA levels) from the data shown in A (n = 3 for both groups). C, UTP-dependent PLC activity (the sum of IP3 metabolites (Ins-1-P, Ins-2-P, Ins(1,3,4)P3, Ins(1,4,5)P3, Ins(1,3,4,5)P4, and Ins(1,3,4,6)P4) in short term culture monolayers of normal and CF human primary bronchial epithelia. Inositol phosphate levels were normalized to IP6 and expressed as -fold increase over the inositol phosphate values in the absence of UTP. Data are expressed as mean ± S.E. (n = 3 for both groups). CF and normal airway epithelial cells also showed similar levels of IP3, as well as Ins(3,4,5,6)P4, an inhibitor of Ca2+-activated Cl– channels (20Carew M.A. Yang X. Schultz C. Shears S.B. J. Biol. Chem. 2000; 275: 26906-66913Abstract Full Text Full Text PDF PubMed Google Scholar) (data not shown).View Large Image Figure ViewerDownload Hi-res image Download (PPT)We next investigated whether the larger Ca2+i mobilization in CF was driven by an enhanced PLC response to P2Y2-R activation. P2Y2-R-regulated PLC activity was assayed by measuring IP3 and the accumulation of its downstream metabolites in the presence of lithium to prevent recycling of inositol phosphates back to inositol (20Carew M.A. Yang X. Schultz C. Shears S.B. J. Biol. Chem. 2000; 275: 26906-66913Abstract Full Text Full Text PDF PubMed Google Scholar). We found that PLC activation in response to a 5-min treatment with 100 μm apical UTP was not elevated in 6–11-day-old primary culture monolayers of CF (Fig. 2C). These findings indicate that the larger ΔCa2+i in CF does not reflect increased P2Y2-R number or increased efficiency of P2Y2-R coupling to PLC.Apical ER Ca2+ Stores Are Functionally Increased in CF Airway Epithelia—We next addressed whether 6–11-day old monolayers of CF cultures exhibited an increased quantity of ER Ca2+ that could be mobilized in response to IP3 generation resulting from GPCR activation. To measure the Ca2+ storage capacity of the apical ER, a protocol was developed based on findings that ER Ca2+ stores are functionally confined to the plasma membrane domain ipsilateral to P2Y2-R activation (21Paradiso A.M. Mason S.J. Lazarowski E.R. Boucher R.C. Nature. 1995; 377: 643-646Crossref PubMed Scopus (96) Google Scholar). 6–11-Day-old normal and CF monolayers, bathed in bilateral nominally Ca2+-free buffer, were exposed to 100 μm basolateral UTP to deplete P2Y2-R-sensitive basolateral Ca2+ stores. Basolateral UTP increased Ca2+i to the same extent in both cultures (Fig. 3A), suggesting that basolateral ER Ca2+ store capacity was the same in normal and CF epithelia. Apical ER Ca2+ store capacity was then measured with perfusion with 0.6 mm bilateral La3+ to block plasma membrane Ca2+-AT-Pases and Ca2+ influx channels (22Paradiso A.M. Brown H.A. Ye H. Harden T.K. Boucher R.C. Exp. Lung Res. 1999; 25: 277-290Crossref PubMed Scopus (4) Google Scholar) followed by 1 μm apical thapsigargin (an ER Ca2+-ATPase inhibitor) to release Ca2+ from apical ER stores (23Ribeiro C.M.P. Putney Jr., J.W. J. Biol. Chem. 1996; 271: 21522-21528Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). Ca2+i rose and was sustained because of inhibition of the plasma membrane and ER Ca2+-ATPases by La3+ and thapsigargin, respectively (Fig. 3A). The greater rise in Ca2+i in CF (Fig. 3A) indicated that the quantity of Ca2+ sequestered in the apical ER was functionally greater in CF compared with normal bronchial epithelial cultures. Fig. 3B illustrates the summary ΔCa2+i data from these experiments. These results led us to speculate that the density of apical ER Ca2+ stores is increased in short term 6–11-day-old cultures of CF airway epithelia.Fig. 3The increased Ca2+i mobilization triggered by apical purinergic receptor activation in CF airway epithelia reflects larger apically confined functional ER Ca2+ stores.A, representative Ca2+i tracings depicting the Ca2+i responses to sequential exposure of basolateral UTP (to assess the capacity of UTP-releasable basolateral ER Ca2+ stores), bilateral (BL) La3+, and apical thapsigargin (TG) (to assess the capacity of apically confined ER Ca2+ stores) in short term primary culture monolayers of normal and CF human bronchial epithelia. Cultures were bilaterally perfused with a nominally Ca2+-free buffer throughout the entire experiment. B, compiled ΔCa2+i values (steady state-baseline Ca2+i) from the experiments shown in A (n = 4). Data are expressed as mean ± S.E.; *, p < 0.05, CF versus normal cultures.View Large Image" @default.
• W2040835521 created "2016-06-24" @default.
• W2040835521 creator A5001166056 @default.
• W2040835521 creator A5013107971 @default.
• W2040835521 creator A5020996376 @default.
• W2040835521 creator A5077284554 @default.
• W2040835521 creator A5082125945 @default.
• W2040835521 date "2005-03-01" @default.
• W2040835521 modified "2023-09-27" @default.
• W2040835521 title "Cystic Fibrosis Airway Epithelial Ca2+ Signaling" @default.
• W2040835521 cites W1537652082 @default.
• W2040835521 cites W1904668215 @default.
• W2040835521 cites W1964385294 @default.
• W2040835521 cites W1977188111 @default.
• W2040835521 cites W2012280093 @default.
• W2040835521 cites W2014319545 @default.
• W2040835521 cites W2022634662 @default.
• W2040835521 cites W2045817586 @default.
• W2040835521 cites W2068015921 @default.
• W2040835521 cites W2078436454 @default.
• W2040835521 cites W2078663076 @default.
• W2040835521 cites W2090160768 @default.
• W2040835521 cites W2103113170 @default.
• W2040835521 cites W2114465292 @default.
• W2040835521 cites W2114996039 @default.
• W2040835521 cites W2120158093 @default.
• W2040835521 cites W2121159616 @default.
• W2040835521 cites W2129655099 @default.
• W2040835521 cites W2142474063 @default.
• W2040835521 cites W2277417740 @default.
• W2040835521 cites W2319668614 @default.
• W2040835521 cites W2338243080 @default.
• W2040835521 cites W2410214285 @default.
• W2040835521 cites W4247861136 @default.
• W2040835521 cites W4300457050 @default.
• W2040835521 doi "https://doi.org/10.1074/jbc.m410617200" @default.
• W2040835521 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15647273" @default.
• W2040835521 hasPublicationYear "2005" @default.
• W2040835521 type Work @default.
• W2040835521 sameAs 2040835521 @default.
• W2040835521 citedByCount "105" @default.
• W2040835521 countsByYear W20408355212012 @default.
• W2040835521 countsByYear W20408355212013 @default.
• W2040835521 countsByYear W20408355212014 @default.
• W2040835521 countsByYear W20408355212015 @default.
• W2040835521 countsByYear W20408355212016 @default.
• W2040835521 countsByYear W20408355212017 @default.
• W2040835521 countsByYear W20408355212018 @default.
• W2040835521 countsByYear W20408355212019 @default.
• W2040835521 countsByYear W20408355212020 @default.
• W2040835521 countsByYear W20408355212021 @default.
• W2040835521 countsByYear W20408355212022 @default.
• W2040835521 countsByYear W20408355212023 @default.
• W2040835521 crossrefType "journal-article" @default.
• W2040835521 hasAuthorship W2040835521A5001166056 @default.
• W2040835521 hasAuthorship W2040835521A5013107971 @default.
• W2040835521 hasAuthorship W2040835521A5020996376 @default.
• W2040835521 hasAuthorship W2040835521A5077284554 @default.
• W2040835521 hasAuthorship W2040835521A5082125945 @default.
• W2040835521 hasBestOaLocation W20408355211 @default.
• W2040835521 hasConcept C105922876 @default.
• W2040835521 hasConcept C126322002 @default.
• W2040835521 hasConcept C141071460 @default.
• W2040835521 hasConcept C142724271 @default.
• W2040835521 hasConcept C185592680 @default.
• W2040835521 hasConcept C2776938444 @default.
• W2040835521 hasConcept C2780559512 @default.
• W2040835521 hasConcept C529295009 @default.
• W2040835521 hasConcept C62478195 @default.
• W2040835521 hasConcept C71924100 @default.
• W2040835521 hasConcept C86803240 @default.
• W2040835521 hasConcept C95444343 @default.
• W2040835521 hasConceptScore W2040835521C105922876 @default.
• W2040835521 hasConceptScore W2040835521C126322002 @default.
• W2040835521 hasConceptScore W2040835521C141071460 @default.
• W2040835521 hasConceptScore W2040835521C142724271 @default.
• W2040835521 hasConceptScore W2040835521C185592680 @default.
• W2040835521 hasConceptScore W2040835521C2776938444 @default.
• W2040835521 hasConceptScore W2040835521C2780559512 @default.
• W2040835521 hasConceptScore W2040835521C529295009 @default.
• W2040835521 hasConceptScore W2040835521C62478195 @default.
• W2040835521 hasConceptScore W2040835521C71924100 @default.
• W2040835521 hasConceptScore W2040835521C86803240 @default.
• W2040835521 hasConceptScore W2040835521C95444343 @default.
• W2040835521 hasIssue "11" @default.
• W2040835521 hasLocation W20408355211 @default.
• W2040835521 hasOpenAccess W2040835521 @default.
• W2040835521 hasPrimaryLocation W20408355211 @default.
• W2040835521 hasRelatedWork W2029324148 @default.
• W2040835521 hasRelatedWork W2038845616 @default.
• W2040835521 hasRelatedWork W2418502454 @default.
• W2040835521 hasRelatedWork W2748952813 @default.
• W2040835521 hasRelatedWork W2899084033 @default.
• W2040835521 hasRelatedWork W3165906020 @default.
• W2040835521 hasRelatedWork W4238599390 @default.
• W2040835521 hasRelatedWork W4293177234 @default.
• W2040835521 hasRelatedWork W435173201 @default.
• W2040835521 hasRelatedWork W1505276211 @default.

• next