FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2040937769> ?p ?o ?g. }

• W2040937769 endingPage "30697" @default.
• W2040937769 startingPage "30686" @default.
• W2040937769 abstract "NatB Nα-terminal acetyltransferase of Saccharomyces cerevisiae acts cotranslationally on proteins with Met-Glu- or Met-Asp- termini and subclasses of proteins with Met-Asn- and Met-Met- termini. NatB is composed of the interacting Nat3p and Mdm20p subunits, both of which are required for acetyltransferase activity. The phenotypes of nat3-Δ and mdm20-Δ mutants are identical or nearly the same and include the following: diminished growth at elevated temperatures and on hyperosmotic and nonfermentable media; diminished mating; defective actin cables formation; abnormal mitochondrial and vacuolar inheritance; inhibition of growth by DNA-damaging agents such as methyl methanesulfonate, bleomycin, camptothecin, and hydroxyurea; and inhibition of growth by the antimitotic drugs benomyl and thiabendazole. The similarity of these phenotypes to the phenotypes of certain act1 and tpm1 mutants suggests that such multiple defects are caused by the lack of acetylation of actin and tropomyosins. However, the lack of acetylation of other unidentified proteins conceivably could cause the same phenotypes. Furthermore, unacetylated actin and certain N-terminally altered actins have comparable defective properties in vitro, particularly actin-activated ATPase activity and sliding velocity. NatB Nα-terminal acetyltransferase of Saccharomyces cerevisiae acts cotranslationally on proteins with Met-Glu- or Met-Asp- termini and subclasses of proteins with Met-Asn- and Met-Met- termini. NatB is composed of the interacting Nat3p and Mdm20p subunits, both of which are required for acetyltransferase activity. The phenotypes of nat3-Δ and mdm20-Δ mutants are identical or nearly the same and include the following: diminished growth at elevated temperatures and on hyperosmotic and nonfermentable media; diminished mating; defective actin cables formation; abnormal mitochondrial and vacuolar inheritance; inhibition of growth by DNA-damaging agents such as methyl methanesulfonate, bleomycin, camptothecin, and hydroxyurea; and inhibition of growth by the antimitotic drugs benomyl and thiabendazole. The similarity of these phenotypes to the phenotypes of certain act1 and tpm1 mutants suggests that such multiple defects are caused by the lack of acetylation of actin and tropomyosins. However, the lack of acetylation of other unidentified proteins conceivably could cause the same phenotypes. Furthermore, unacetylated actin and certain N-terminally altered actins have comparable defective properties in vitro, particularly actin-activated ATPase activity and sliding velocity. The two cotranslational processes, cleavage of N-terminal methionine residues and N-terminal acetylation, are by far the most common modifications, occurring on the vast majority of proteins. Eukaryotic cytosolic proteins initiate with methionine that is cleaved from nascent chains of most proteins. Subsequently, N-terminal acetylation occurs on certain of the proteins, either containing or lacking the methionine residue. This N-terminal acetylation occurs on over one-half of soluble eukaryotic proteins but seldom on prokaryotic proteins (1Driessen H.P.C. de Jong W.W. Tesser G.I. Bloemendal H. CRC Crit. Rev. Biochem. 1985; 18: 281-325Crossref PubMed Scopus (178) Google Scholar, 2Jörnvall H. J. Theor. Biol. 1975; 55: 1-12Crossref PubMed Scopus (133) Google Scholar, 3Lee F.J. Lin L.W. Smith J.A. FEBS Lett. 1989; 256: 139-142Crossref PubMed Scopus (26) Google Scholar).N-terminal acetylation of proteins is catalyzed by N-terminal acetyltransferases (NATs) 1The abbreviations used are: NAT(s), N-terminal acetyltransferase(s); iso-1, iso-1-cytochrome(s) c or iso-1-cytochromes c; TAP, tandem affinity purification; ts, temperature-sensitive or sensitivity; MMS, methyl methanesulfonate; EMS, ethyl methane-sulfonate; HU, hydroxyurea; Nif–, diminished or lack of growth on media containing nonfermentable carbon sources as the sole source of energy, such as glycerol or ethanol; CBP, calmodulin-binding peptide, MS, mass spectrometry; MALDI-TOF, matrix assisted laser desorption/ionization time-of-flight MS; oligo, oligonucleotide.1The abbreviations used are: NAT(s), N-terminal acetyltransferase(s); iso-1, iso-1-cytochrome(s) c or iso-1-cytochromes c; TAP, tandem affinity purification; ts, temperature-sensitive or sensitivity; MMS, methyl methanesulfonate; EMS, ethyl methane-sulfonate; HU, hydroxyurea; Nif–, diminished or lack of growth on media containing nonfermentable carbon sources as the sole source of energy, such as glycerol or ethanol; CBP, calmodulin-binding peptide, MS, mass spectrometry; MALDI-TOF, matrix assisted laser desorption/ionization time-of-flight MS; oligo, oligonucleotide. that transfer acetyl groups from acetyl-CoA to termini of α-amino groups. We have established that Saccharomyces cerevisiae contains three major NATs, NatA, NatB, and NatC, with catalytic subunits Ard1p, Nat3p, and Mak3p, respectively, and that each is required for acetylating different groups of proteins (4Polevoda B. Sherman F. J. Biol. Chem. 2000; 275: 36479-36482Abstract Full Text Full Text PDF PubMed Scopus (278) Google Scholar, 5Polevoda B. Sherman F. J. Mol. Biol. 2003; 325: 595-622Crossref PubMed Scopus (349) Google Scholar). As summarized previously (4Polevoda B. Sherman F. J. Biol. Chem. 2000; 275: 36479-36482Abstract Full Text Full Text PDF PubMed Scopus (278) Google Scholar, 5Polevoda B. Sherman F. J. Mol. Biol. 2003; 325: 595-622Crossref PubMed Scopus (349) Google Scholar), subclasses of proteins with Ser-, Ala-, Gly-, or Thrtermini are acetylated by NatA; proteins with Met-Glu- or Met-Asp- termini and subclasses of proteins with Met-Asn- and Met-Met- termini are acetylated by NatB; and subclasses of proteins with Met-Ile, Met-Leu-, Met-Trp-, or Met-Phe- termini are acetylated by NatC. In addition, a special subclass of NatA substrates with Ser-Glu-, Ser-Asp-, Ala-Glu-, or Gly-Glu- termini, designated NatA′, are only partially acetylated in nat3-Δ or mak3-Δ mutants (6Arnold R.J. Polevoda B. Reilly J.P. Sherman F. J. Biol. Chem. 1999; 274: 37035-37040Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar).In regard to the present study, special emphasis should be made of the NatB substrates, some of which were previously identified by using two-dimensional gel electrophoresis of proteins from normal and nat3-Δ strains, including the following: actin (Act1p); the small subunit of ribonucleotide reductase, Rnr4p (7Polevoda B. Norbeck J. Takakura H. Blomberg A. Sherman F. EMBO J. 1999; 18: 6155-6168Crossref PubMed Scopus (172) Google Scholar); the ribosomal proteins S21 and S28 (6Arnold R.J. Polevoda B. Reilly J.P. Sherman F. J. Biol. Chem. 1999; 274: 37035-37040Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar); the 20 S proteosomal subunit, Pre1p (8Kimura Y. Takaoka M. Tanaka S. Sassa H. Tanaka K. Polevoda B. Sherman F. Hirano H. J. Biol. Chem. 2000; 275: 4635-4639Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar); and the 19 S proteosomal subunits, Rpt3p and Rpn11p (9Kimura Y. Saeki Y. Yokosawa H. Polevoda B. Sherman F. Hirano H. Arch. Biochem. Biophys. 2003; 409: 341-348Crossref PubMed Scopus (72) Google Scholar). All of these proteins have Ac-Met-Asp- or Ac-Met-Glu-N-termini. Furthermore, all Met-Asp- or Met-Glu- eukaryotic proteins that have undergone N-terminal analysis were shown to be N-terminally acetylated (5Polevoda B. Sherman F. J. Mol. Biol. 2003; 325: 595-622Crossref PubMed Scopus (349) Google Scholar). Thus, it is reasonable to assume that all Met-Asp- or Met-Glu- yeast proteins are NatB substrates. The essential protein, tropomyosin, which contains a Met-Asp-Lys-Ile-Arg- terminus, was recently shown to be a NatB substrate. 2Singer, J. M., and Shaw, J. M. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 7644–7649.2Singer, J. M., and Shaw, J. M. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 7644–7649.NatA activity requires two subunits, Ard1p itself and Nat1p (10Mullen J.R. Kayne P.S. Moerschell R.P. Tsunasawa S. Gribskov M. Colavito-Shepanski M. Grunstein M. Sherman F. Sternglanz R. EMBO J. 1989; 8: 2067-2075Crossref PubMed Scopus (241) Google Scholar). The previously identified (10Mullen J.R. Kayne P.S. Moerschell R.P. Tsunasawa S. Gribskov M. Colavito-Shepanski M. Grunstein M. Sherman F. Sternglanz R. EMBO J. 1989; 8: 2067-2075Crossref PubMed Scopus (241) Google Scholar) ard1 mutant was suspected to be related to nat1 because of certain similar phenotypes. The nat1 and ard1 mutants were unable to N-terminally acetylate in vivo the same subset of 24 normally acetylated proteins, including those with Ala- and Ser- termini (7Polevoda B. Norbeck J. Takakura H. Blomberg A. Sherman F. EMBO J. 1999; 18: 6155-6168Crossref PubMed Scopus (172) Google Scholar). In addition to lacking NAT activity, both nat1-Δ and ard1-Δ mutants exhibited slower growth, derepression of the silent mating type gene HMLα, and failure to enter Go. Overexpression of both Ard1p and Nat1p subunits is required for increased NAT activity in vivo (10Mullen J.R. Kayne P.S. Moerschell R.P. Tsunasawa S. Gribskov M. Colavito-Shepanski M. Grunstein M. Sherman F. Sternglanz R. EMBO J. 1989; 8: 2067-2075Crossref PubMed Scopus (241) Google Scholar), and both interact with each other to form an active complex in vitro (11Park E.-C. Szostak J.W. EMBO J. 1992; 11: 2087-2093Crossref PubMed Scopus (136) Google Scholar). Recently another protein, Asc1p, was found to be associated with the complex when Nat1p was used as bait in a genome-wide screen by tandem affinity purification (TAP) protocol (12Gavin A.C. Bosche M. Krause R. Grandi P. Marzioch M. Bauer A. Schultz J. Rick J.M. Michon A.M. Cruciat C.M. Remor M. Hofert C. Schelder M. Brajenovic M. Ruffner H. Merino A. Klein K. Hudak M. Dickson D. Rudi T. Gnau V. Bauch A. Bastuck S. Huhse B. Leutwein C. Heurtier M.A. Copley R.R. Edelmann A. Querfurth E. Rybin V. Drewes G. Raida M. Bouwmeester T. Bork P. Seraphin B. Kuster B. Neubauer G. Superti-Furga G. Nature. 2002; 415: 141-147Crossref PubMed Scopus (3973) Google Scholar) (yeast.cellzone.com); however the requirement of Asc1p for NatA activity has not been tested. Furthermore, Asc1p, together with Eno1p, Mis1p, Myo1p, and YGR090w, was detected in the complex when Ard1p was tagged (yeast.cellzone.com).Tercero and Wickner (13Tercero J.C. Wickner R.B. J. Biol. Chem. 1992; 267: 20277-20281Abstract Full Text PDF PubMed Google Scholar) and Tercero et al. (14Tercero J.C. Dinman J.D. Wickner R.B. J. Bacteriol. 1993; 175: 3192-3194Crossref PubMed Scopus (51) Google Scholar) described the MAK3 gene that encodes a catalytic subunit of NatC, which is required for the N-terminal acetylation of the viral major coat protein, gag, with an Ac-Met-Leu-Arg-Phe- terminus. The copurification of Mak3p, Mak10p, and Mak31p suggests that these three subunits form a complex (15Rigaut G. Shevchenko A. Rutz B. Wilm M. Mann M. Séraphin B. Nat. Biotechnol. 1999; 17: 1030-1032Crossref PubMed Scopus (2275) Google Scholar). Moreover, protein-protein interactions between Mak3p and Mak10p as well as between Mak31p and Mak10 were detected in a two-hybrid screen (16Uetz P. Giot L. Cagney G. Mansfield T.A. Judson R.S. Knight J.R. Lockshon D. Narayan V. Srinivasan M. Pochart P. Qureshi-Emili A. Li Y. Godwin B. Conover D. Kalbfleisch T. Vijayadamodar G. Yang M. Johnston M. Fields S. Rothberg J.M. Nature. 1999; 403: 623-627Crossref Scopus (3896) Google Scholar). We demonstrated that each of the Mak3p, Mak10p, and Mak31p subunits are required for acetylation of the NatC-type N-terminal sequences in vivo (17Polevoda B. Sherman F. J. Biol. Chem. 2001; 276: 20154-20159Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar). By using matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry, we found that deletion of any of the corresponding genes leads to the lack of acetylation of NatC-type altered iso-1-cytochromes c but not to the lack of acetylation of NatA, NatB, or NatA′ substrates. In addition, all three deletion strains showed similar phenotypes, including slower growth on nonfermentable carbon sources at elevated temperature. Although biological functions of Mak31p and Mak10p are unknown, Séraphin (18Séraphin B. EMBO J. 1995; 14: 2089-2098Crossref PubMed Scopus (247) Google Scholar) pointed out the sequence similarity of Mak31p to Sm proteins.We identified previously (7Polevoda B. Norbeck J. Takakura H. Blomberg A. Sherman F. EMBO J. 1999; 18: 6155-6168Crossref PubMed Scopus (172) Google Scholar) the catalytic subunit of NatB acetyltransferase, Nat3p, and suggested that, similarly to NatA and NatC, it may require other proteins for activity. In the present study, we have used the TAP protocol with Nat3p as the bait to identify Mdm20p as the other subunit of NatB, and to demonstrate that both proteins, Nat3p and Mdm20p, are required for acetylation of the NatB substrates. The corresponding deletion mutants showed similar if not identical phenotypes, including the following: slow growth; temperature and salt sensitivity; osmotic sensitivity; calcium and caffeine sensitivity; deficiency in utilization of nonfermentable carbon sources; reduced mating efficiency; sensitivity to the mitotic drugs thiabendazole and benomyl; and susceptibility to many DNA-damaging agents, including methyl methansulfonate, bleomycin, camptothecin, and hydroxyurea. Furthermore, the phenotypes of act1, tpm1, and rnr4 mutants altered in the N-terminal region indicate that the nat3-Δ and mdm20-Δ phenotypes are due primarily, if not entirely, to the lack of Act1p (actin), Tpm1p, and Tpm2p (tropomyosins) acetylation. We have also demonstrated that unacetylated actin and actin altered in the N-terminal region have similar defective properties in vitro.MATERIALS AND METHODSYeast Strains—The strains of S. cerevisiae used in this study are listed in Table I. The analysis of N-terminal acetylation was carried out with several isogenic series, which were derived from the following parental strains: B-7687 (CYC1-853 MAT a cyc7-67 ura3-52 lys5-10); B-13233 (MATα tub2-201::ACT1::HIS3 ade4 his3-Δ200 leu2-3,112 ura3-52); B-11679 (MATα ura3-52); B-14819 (MAT a his3-Δ200 leu2-3,112 lys2-801 trp1-1 ura3-52 Spo–); and B-14276 (MATα his3-Δ0 leu2-Δ0 lys2-Δ0 ura3-Δ0). The series used for producing altered iso-1 was described earlier (7Polevoda B. Norbeck J. Takakura H. Blomberg A. Sherman F. EMBO J. 1999; 18: 6155-6168Crossref PubMed Scopus (172) Google Scholar).Table IYeast strainsStrain no.GenotypeRef./SourceB-7687MAT a CYC1-853 cyc7-67 lys5-10 ura3-527Polevoda B. Norbeck J. Takakura H. Blomberg A. Sherman F. EMBO J. 1999; 18: 6155-6168Crossref PubMed Scopus (172) Google ScholarB-11863MAT a CYC1-853 cyc7-67 lys5-10 ura3-52 nat3-Δ::kanMX47Polevoda B. Norbeck J. Takakura H. Blomberg A. Sherman F. EMBO J. 1999; 18: 6155-6168Crossref PubMed Scopus (172) Google ScholarB-14069MAT a CYC1-853 cyc7-67 lys5-10 ura3-52 mdm20-Δ::kanMX4This studyB-13233MATα tub2-201:ACT1:HIS3 ade4 his3-Δ200 leu2-3,112 ura3-52T. DoyleB-13234MAT a tub2-201:act1:LEU2 leu2-3,112 lys2 ura3-52 p[CEN URA3 act1-DNEQ]T. DoyleB-13285MATα tub2-201:act1-136:HIS3 ade4 his3-Δ200 leu2-3,112 ura3-52This studyB-13382MATα tub2-201:ACT1:HIS3 ade4 his3-Δ200 leu2-3,112 ura3-52 nat3-Δ::kanMX4This studyB-14274MATαtub2-201:ACT1:HIS3 ade4 his3-Δ200 leu2-3,112 ura3-52 mdm20-Δ::kanMX4This studyB-10190MAT a his3-Δ200 leu2-3,112 lys2-801 trp1-1 ura3-52This studyB-13396MAT a his3-Δ200 leu2-3,112 lys2-801 trp1-1 ura3-52 NAT3::TRP1-TAPThis studyB-14443MATα his3-Δ200 leu2Δ1 ura3-52 ACT1-203J. ShawB-14444MATα his3-Δ200 leu2Δ1 ura3-52 TPM1-4J. ShawB-14445MAT a leu2-Δ1 ura3-52 TPM1-5J. ShawB-11679MAT a ura3-527Polevoda B. Norbeck J. Takakura H. Blomberg A. Sherman F. EMBO J. 1999; 18: 6155-6168Crossref PubMed Scopus (172) Google ScholarB-11852MAT a ura3-52 nat3-Δ::kanMX47Polevoda B. Norbeck J. Takakura H. Blomberg A. Sherman F. EMBO J. 1999; 18: 6155-6168Crossref PubMed Scopus (172) Google ScholarB-14464MAT a ura3-52 nat3-Δ::kanMX4 p[CEN URA3 TPM1-5]This studyB-14465MAT a ura3-52 nat3-Δ::kanMX4 p[CEN URA3 TPM1-4]This studyB-14466MAT a ura3-52 nat3-Δ::kanMX4 p[CEN URA3 ACT1-203]This studyB-15073MAT a ura3-52 nat3-Δ::kanMX4 p[CEN URA3]This studyB-14819MAT a his3-Δ200 leu2-3,112 lys2-801 trp1-1 ura3-52 Spo-D. PruyneB-14821MAT a his3-Δ200 leu2-3,112 lys2-801 trp1-1 ura3-52 trp1-1 tpm1-2::LEU2 tpm2::HIS3D. PruyneB-15078MAT a his3-Δ200 leu2-3,112 lys2-801 trp1-1 ura3-52 trp1-1 tpm1-2::LEU2 tpm2::HIS3 p[CEN URA3]This studyB-15074MAT a his3-Δ200 leu2-3,112 lys2-801 trp1-1 ura3-52 trp1-1 tpm1-2::LEU2 tpm2::HIS3 p[CEN URA3 TPM1]This studyB-15076MAT a his3-Δ200 leu2-3,112 lys2-801 trp1-1 ura3-52 trp1-1 tpm1-2::LEU2 tpm2::HIS3 p[CEN URA3 TPM1-4]This studyB-15075MAT a his3-Δ200 leu2-3,112 lys2-801 trp1-1 ura3-52 trp1-1 tpm1-2::LEU2 tpm2::HIS3 p[CEN URA3 TPM1-5]This studyB-15077MAT a his3-Δ200 leu2-3,112 lys2-801 trp1-1 ura3-52 trp1-1 tpm1-2::LEU2 tpm2::HIS3 p[CEN URA3 TPM1-101]This studyB-15080MAT a his3-Δ200 leu2-3,112 lys2-801 trp1-1 ura3-52 trp1-1 tpm1-2::LEU2 tpm2::HIS3 p[CEN URA3 TPM1-102]This studyB-14276MATα his3-Δ leu2-Δ lys2-Δ ura3-ΔThis studyB-15084MATα his3-Δ leu2-Δ lys2-Δ ura3-Δ rnr4-Δ::kanMX4This studyB-15091MATα his3-Δ leu2-Δ lys2-Δ ura3-Δ rnr4-Δ::kanMX4 p[CEN URA3]This studyB-15088MATα his3-Δ leu2-Δ lys2-Δ ura3-Δ rnr4-Δ::kanMX4 p[CEN URA3 RNR4]This studyB-15089MATα his3-Δ leu2-Δ lys2-Δ ura3-Δ rnr4-Δ::kanMX4 p[CEN URA3 RNR4-101]This studyB-15090MATα his3-Δ leu2-Δ lys2-Δ ura3-Δ rnr4-Δ::kanMX4 p[CEN URA3 RNR4-102]This study Open table in a new tab Media—Standard media, YPD, YPG, YPDG, SD containing appropriate supplements, and sporulation media SP3 have been described (19Sherman F. Methods Enzymol. 2002; 350: 3-41Crossref PubMed Scopus (965) Google Scholar). Other media contains 1% Bacto-yeast extract, 2% Bacto-peptone, and either 2% ethanol (YPE) or 2% galactose (YPGal). Unless stated otherwise, yeast strains were grown at 30 °C. Certain phenotypes of the nat3-Δ and mdm20-Δ strains were determined with YPD medium containing the following amounts of different agents: 1 m sodium chloride (NaCl); 1 m potassium chloride (KCl); 0.3 m calcium chloride (CaCl2); 1.5 m sorbitol; 1.2 m mannitol; 15 and 30% glycerol; 6.0% ethylene glycol; 6.7% diethylene glycol; 0.05% EGTA; 0.15% caffeine; 50–75 μg/ml thiabendazole; 25–50 μg/ml benomyl; 0.02–0.1% methyl methanesulfonate (MMS); 0.02–0.1% ethyl methanesulfonate (EMS); 3 μg/ml bleomycin. Other phenotypes were determined with synthetic complete medium containing the following: 75 or 100 mm hydroxyurea (HU) and 4 or 10 μg/ml camptothecin in media containing 0.25% dimethyl sulfoxide (Me2SO).Mating Efficiencies—Quantitative matings were determined as described earlier (7Polevoda B. Norbeck J. Takakura H. Blomberg A. Sherman F. EMBO J. 1999; 18: 6155-6168Crossref PubMed Scopus (172) Google Scholar).The ρ+ → ρ– Mutation Rate—The method for estimating ρ+ → ρ– mutation rates was based on the method of Ogur et al. (20Ogur M. St. John R. Ogur S. Mark A.M. Genetics. 1959; 44: 484-496Crossref Google Scholar), in which the relative mutant frequency equals the mutation rate when the culture is grown in a medium that totally prevents growth of the mutant cells. The strains were grown in YPG medium, and the frequencies of ρ– cells were estimated from the number of small colonies on YPDG medium (19Sherman F. Methods Enzymol. 2002; 350: 3-41Crossref PubMed Scopus (965) Google Scholar).Construction of Deletion Mutants—Standard molecular biological procedures were performed as described (7Polevoda B. Norbeck J. Takakura H. Blomberg A. Sherman F. EMBO J. 1999; 18: 6155-6168Crossref PubMed Scopus (172) Google Scholar). The NAT3 and MDM20 genes were disrupted by replacing portions of the genes with the kanMX4 gene produced by PCR and then using the appropriate fragment for yeast transformation as described earlier (7Polevoda B. Norbeck J. Takakura H. Blomberg A. Sherman F. EMBO J. 1999; 18: 6155-6168Crossref PubMed Scopus (172) Google Scholar). For the nat3-Δ::kanMX4 disruption, primers Oligo1 and Oligo2 (Table II) were used to prepare the PCR fragment for transformation, and the correct disruption was identified by PCR, using the set of primers Oligo3 and Oligo4. Similarly, the fragment required for producing the mdm20-Δ::kanMX4 disruption was prepared with Oligo5 and Oligo6 and yeast genomic DNA made from a mdm20-Δ::kanMX4 deletion strain (Invitrogen) as template.Table IIOligonucleotides used in the construction and testing of the disrupted genesORFOligo.Sequence (5′ → 3′)NAT3Oligo1(-70) GCAAAAAACATAGCGGTGGGCGCACGTTGGTGGGCCTGG GAAGAACAGCTGAAGCTTCGNAT3Oligo2(+814) TGAATAGCACAGAGGTTCATTATTATGTTCTGAGTATG AGGACGAAGGCCACTAGTGGATCTGNAT3Oligo3(-142) TTCCAATGCGGTAGTGCTTAGCNAT3Oligo4(+906) TATATCATTCAGTATGTACATACMDM20Oligo5(-140) CAGTCACCTTTAACGAAAATCGMDM20Oligo6(+2554) CCTCAAAAATCATATACTACTTTTTCNAT3Oligo7(+705) CGGCCGGATGGAAGAAGCCATAAATGCTATAAATGCTA TCCACATGATGTAAGATTTTCCATGGAAAAGAGAAGATNAT3Oligo8(+863) ATAGTCCGCGCCTCTGGATAGTATTATTTTAGTGCGTAT CGCAAAATTAAGTTGGGTAAGGCCAGNAT3Oligo9(+908) AGTATATGATTCAGTATGTAGANAT3Oligo10(+667) GCTATGGCTAGGGACAGGAACANAT3Oligo11(+2310) GTTGGAATAT CATAATCACT1Oligo12(-200) ATTCATTTATATCACGCTCTCACT1Oligo13(+1938) CAGTTTTGATTTGGTTCCCAGTPM1Oligo14(-170) TCAGCACACCATAGCACGATCTPM1Oligo15(+748) ATACAGATGTATAGTCTAAGCTPM1Oligo16(-11) P-TTTGTGTGTATGGGGTGTGAGTPM1Oligo17(-10) AAAGGCAACAATGCACAAAATCAGAGAAATPM1Oligo18(-11) AAAGGCAACAATGTCCAAAATCAGAGAAAARNR4Oligo19(-122) GCCTTGTCTCGAAACAGAAAGRNR4Oligo20(+1121) GTTTAGTTATACTGTACCTAGGRNR4Oligo21(-11) TTAGTTATTACAATGCATGAAGCACATAACCAATTTRNR4Oligo22(+21) AAATTGGTTATGTGCTTCATGCATTGTAATAACTAARNR4Oligo23(-11) TTAGTTATTACAATGTCTGAAGCACATAACCAATTTRNR4Oligo24(+21) AAATTGGTTATGTGCTTCAGACATTGTAATAACTAA Open table in a new tab Gene Cloning and Mutagenesis—Cloning of the wild type ACT1 and TPM1 genes as well as cloning of the ACT1-203, TPM1-4 and TPM1-5 alleles was performed using PCR with oligonucleotides Oligo12 and Oligo13 for ACT1, Oligo14 and Oligo15 for both TPM1 alleles, and genomic DNAs prepared from the corresponding strains B-11679, B-14443, B-14444, and B-14445, respectively. The resulting PCR products were inserted in a TA TOPO pCR2.1 vector (Invitrogen), and the appropriate fragments were subsequently inserted in the yeast CEN URA3 vector pAA625 (pRS316). The yeast strain B-11852 (Table I) was transformed with the resulting plasmids to produce strains B-14464, B-14465, and B-14466 as well as control strain B-15073 (vector only) which were used to test the suppressor phenotypes.Oligo16, Oligo17, Oligo18, and the ExSite™ PCR-based Site-directed Mutagenesis kit (Stratagene, La Jolla, CA) were used for making site-directed mutations in TPM1 gene. The resulting TPM1 alleles were sequenced with Oligo14 to confirm the correct nucleotide replacements. Subsequently, strain B-14821 was transformed with the TPM1-101 (D2H), TPM1-101 (D2S), and TPM1 plasmids and vector alone, and the phenotypes of the resulting strains (Table I) were analyzed by 1/10 serial dilutions on different media.Similarly, wild type RNR4 was cloned by PCR using normal yeast genomic DNA, Oligo19, Oligo20, and the TA TOPO vector; the appropriate fragment was subsequently transferred to the pAA625 yeast vector. The RNR4-101 (D2H) and RNR4-101 (D2S) alleles were produced with the QuickChange® Site-directed Mutagenesis kit (Stratagene), using Oligo21 and Oligo22 for the D2H replacement and Oligo23 and Oligo24 for the D2S replacement. The rnr4-Δ deletion strain, B-15086 (Table I), was transformed with the resulting plasmids.Purification of Iso-1 and the Analysis of Its Acetylation Status by Mass Spectrometry—Iso-1 proteins were purified as described previously (7Polevoda B. Norbeck J. Takakura H. Blomberg A. Sherman F. EMBO J. 1999; 18: 6155-6168Crossref PubMed Scopus (172) Google Scholar) by using two subsequent rounds of weak cation-exchange BioRex70 column chromatography, 100–200 mesh and 200–400 mesh (Bio-Rad), respectively, in potassium phosphate buffer, pH 7.0, with a 0–1.0 m potassium chloride linear gradient. MS analysis was carried out with iso-1 proteins dialyzed against H2O. MALDI-TOF MS samples were prepared and analyzed in Voyager-DE STR linear time-of-flight mass spectrometer (PE Biosystems, Framingham, MA) at the MicroChemical Protein/Peptide Core Facility, University of Rochester, as described (7Polevoda B. Norbeck J. Takakura H. Blomberg A. Sherman F. EMBO J. 1999; 18: 6155-6168Crossref PubMed Scopus (172) Google Scholar).Purification and Characterization of the Yeast Nat3p Complex—The Nat3p protein complex was purified by TAP method (15Rigaut G. Shevchenko A. Rutz B. Wilm M. Mann M. Séraphin B. Nat. Biotechnol. 1999; 17: 1030-1032Crossref PubMed Scopus (2275) Google Scholar). NAT3 was fused to the TAP tag by PCR-based tagging, using plasmid pAB2629 (originally designated pBS1479 and obtained from B. Séraphin, EMBL, Heidelberg, Germany) as template with Oligo7 and Oligo8 (Table II). Neither of the tags, ProtA and CBP, impaired protein function. The eluted complex was concentrated with the Centricon-3 (Millipore, Bradford, MA), and the subunits were separated by electrophoresis in a 4–20% gradient Tris-glycine SDS-PAGE gel, and the protein bands were visualized by silver staining (Bio-Rad).In Situ Gel Tryptic Digests and Peptide MS Analysis—The protein bands after staining were excised from the gel, washed, reduced, alkylated, and then incubated with trypsin essentially as described (15Rigaut G. Shevchenko A. Rutz B. Wilm M. Mann M. Séraphin B. Nat. Biotechnol. 1999; 17: 1030-1032Crossref PubMed Scopus (2275) Google Scholar). The peptides were purified by Zip-tip (Millipore) before MALDI-TOF MS analysis in Voyager-DE STR mass spectrometer at the MicroChemical Protein/Peptide Core Facility, University of Rochester. Proteins were identified by searching a comprehensive non-redundant yeast protein data base using the program MS-Fit/Prospector (University of California, San Francisco, ucsf.edu/ucsfhtml4.0/msfit.htm).Actin-activated S1 ATPase Assay—Yeast actin was isolated from each strain by DNase I affinity chromatography as described before (21Cook R.K. Root D. Miller C. Reisler E. Rubenstein P.A. J. Biol. Chem. 1993; 268: 2410-2415Abstract Full Text PDF PubMed Google Scholar). Myosin was prepared from rabbit skeletal muscle according to the method of Godfrey and Harrington (22Godfrey J.E. Harrington W.F. Biochemistry. 1970; 9: 894-908Crossref PubMed Scopus (110) Google Scholar). Myosin sub-fragment S1 was prepared according to Weeds and Pope (23Weeds A.G. Pope B. J. Mol. Biol. 1997; 111: 129-157Crossref Scopus (609) Google Scholar). The actin-activated ATPase assays were performed according to Miller et al. (24Miller C.J. Wong W.W. Bobkova E. Rubenstein P.A. Reisler E. Biochemistry. 1996; 35: 16557-16565Crossref PubMed Scopus (64) Google Scholar).In Vitro Actin Motility Assays—The actin motility assays were performed as described by Doyle et al. (25Doyle T.C. Hansen J.E. Reisler E. Biophys. J. 2001; 80: 427-434Abstract Full Text Full Text PDF PubMed Scopus (27) Google Scholar). Heavy meromyosin was prepared according to Kron et al. (26Kron S.J. Toyoshima Y.Y. Uyeda T.Q. Spudich J.A. Methods Enzymol. 1991; 196: 399-416Crossref PubMed Scopus (341) Google Scholar). Quantitation of the sliding velocities was performed with an ExpertVision System (Motion Analysis, Santa Rosa, CA).Indirect Immunofluorescence Microscopy—Live or fixed cells were examined with a Eclipse E-600 fluorescence microscope (Nikon). Cells were grown to early log phase and fixed in 3.7% formaldehyde, then washed, resuspended at a concentration of 2 × 108 cells/ml, and incubated with 20 units/ml rhodamine-phalloidin (this and other reagents for microscopy were obtained from Molecular Probes, Eugene, OR) to allow visualization of the F-actin. Vacuoles were visualized by staining live cells with N-(triethylammonium propyl)-4-(p-diethylaminophenylhexatrienyl) pyridium dibromide. Mitochondrial staining of live cells was performed with 3,3′-dihexyloxacarbocyanine.RESULTSPurification of the NatB Complex—The yeast NatB complex was purified by the tandem affinity purification (TAP) method (15Rigaut G. Shevchenko A. Rutz B. Wilm M. Mann M. Séraphin B. Nat. Biotechnol. 1999; 17: 1030-1032Crossref PubMed Scopus (2275) Google Scholar), which has the advantage of using strains with normal expression of proteins. A NAT3 fusion gene was constructed by the PCR-based tagging procedure using the pBS1479 plasmid as a template and oligonucleotides complementary to the regions corresponding to the C-terminal end of the NAT3 coding region and to the 3′ end of TAP tag-marker cassette (Table I). Both primers contained the appropriate regions of homology with the yeast genome to allow in-frame fusion of the TAP tag downstream of the NAT3 gene. Neither ProtA nor CBP tags impaired protein function as was judged by phenotype analysis of the transformants (data not presented). The resulting yeast strain, B-13396 (Table I), had normal growth rates on YPD and YPG at both 30 and 37 °C, in contrast to nat3-Δ mutants, which had slow growth phenotypes and were ts-sensitive (7Polevoda B. Norbeck J. Takakura H. Blomberg A. Sherman F. EMBO J. 1999; 18: 6155-6168Crossref PubMed Scopus (172) Google Scholar). The expression of the Nat3p fusion protein in strain B-13396 was verified by Western blotting; yeast cell extract was probed with peroxidase anti-peroxidase antibody (Sigma) and a positive signal corresponding to 33-kDa band, and the molecular mass of Nat3p-ProtA-CBP was detected (data not shown).The Nat3p fusion protein and associated components were recovered from yeast cell extracts by TAP affinity chromatography on IgG-agarose beads and by subsequent tobacco etch virus protease cleavage and purification with calmodulin-co" @default.
• W2040937769 created "2016-06-24" @default.
• W2040937769 creator A5024646275 @default.
• W2040937769 creator A5037035326 @default.
• W2040937769 creator A5052783018 @default.
• W2040937769 creator A5064153223 @default.
• W2040937769 creator A5078623413 @default.
• W2040937769 date "2003-08-01" @default.
• W2040937769 modified "2023-10-16" @default.
• W2040937769 title "Nat3p and Mdm20p Are Required for Function of Yeast NatB Nα-terminal Acetyltransferase and of Actin and Tropomyosin" @default.
• W2040937769 cites W105392238 @default.
• W2040937769 cites W145004674 @default.
• W2040937769 cites W1481821763 @default.
• W2040937769 cites W1484681199 @default.
• W2040937769 cites W1495517293 @default.
• W2040937769 cites W1497947649 @default.
• W2040937769 cites W1507477972 @default.
• W2040937769 cites W1518124859 @default.
• W2040937769 cites W1521831608 @default.
• W2040937769 cites W1563817153 @default.
• W2040937769 cites W1575542444 @default.
• W2040937769 cites W158285355 @default.
• W2040937769 cites W1819499229 @default.
• W2040937769 cites W1875421809 @default.
• W2040937769 cites W1905489680 @default.
• W2040937769 cites W1958827907 @default.
• W2040937769 cites W1965584061 @default.
• W2040937769 cites W1967716439 @default.
• W2040937769 cites W1968430387 @default.
• W2040937769 cites W1968488837 @default.
• W2040937769 cites W1970678426 @default.
• W2040937769 cites W1971579210 @default.
• W2040937769 cites W1972106355 @default.
• W2040937769 cites W1978683697 @default.
• W2040937769 cites W1983007539 @default.
• W2040937769 cites W1987045539 @default.
• W2040937769 cites W1989635591 @default.
• W2040937769 cites W2024095351 @default.
• W2040937769 cites W2025636361 @default.
• W2040937769 cites W2031778076 @default.
• W2040937769 cites W2034767282 @default.
• W2040937769 cites W2038253226 @default.
• W2040937769 cites W2038379218 @default.
• W2040937769 cites W2040304693 @default.
• W2040937769 cites W2045913132 @default.
• W2040937769 cites W2053050204 @default.
• W2040937769 cites W2054400465 @default.
• W2040937769 cites W2065304353 @default.
• W2040937769 cites W2067514010 @default.
• W2040937769 cites W2070432099 @default.
• W2040937769 cites W2072927245 @default.
• W2040937769 cites W2080599058 @default.
• W2040937769 cites W2082071854 @default.
• W2040937769 cites W2084619201 @default.
• W2040937769 cites W2085651853 @default.
• W2040937769 cites W2093931104 @default.
• W2040937769 cites W2109449816 @default.
• W2040937769 cites W2111204900 @default.
• W2040937769 cites W2141665440 @default.
• W2040937769 cites W2143472729 @default.
• W2040937769 cites W2143526876 @default.
• W2040937769 cites W2184468343 @default.
• W2040937769 cites W2288293234 @default.
• W2040937769 doi "https://doi.org/10.1074/jbc.m304690200" @default.
• W2040937769 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12783868" @default.
• W2040937769 hasPublicationYear "2003" @default.
• W2040937769 type Work @default.
• W2040937769 sameAs 2040937769 @default.
• W2040937769 citedByCount "120" @default.
• W2040937769 countsByYear W20409377692012 @default.
• W2040937769 countsByYear W20409377692013 @default.
• W2040937769 countsByYear W20409377692014 @default.
• W2040937769 countsByYear W20409377692015 @default.
• W2040937769 countsByYear W20409377692016 @default.
• W2040937769 countsByYear W20409377692017 @default.
• W2040937769 countsByYear W20409377692018 @default.
• W2040937769 countsByYear W20409377692019 @default.
• W2040937769 countsByYear W20409377692020 @default.
• W2040937769 countsByYear W20409377692021 @default.
• W2040937769 countsByYear W20409377692022 @default.
• W2040937769 countsByYear W20409377692023 @default.
• W2040937769 crossrefType "journal-article" @default.
• W2040937769 hasAuthorship W2040937769A5024646275 @default.
• W2040937769 hasAuthorship W2040937769A5037035326 @default.
• W2040937769 hasAuthorship W2040937769A5052783018 @default.
• W2040937769 hasAuthorship W2040937769A5064153223 @default.
• W2040937769 hasAuthorship W2040937769A5078623413 @default.
• W2040937769 hasBestOaLocation W20409377691 @default.
• W2040937769 hasConcept C104317684 @default.
• W2040937769 hasConcept C119157956 @default.
• W2040937769 hasConcept C125705527 @default.
• W2040937769 hasConcept C14036430 @default.
• W2040937769 hasConcept C185592680 @default.
• W2040937769 hasConcept C205875245 @default.
• W2040937769 hasConcept C2779222958 @default.
• W2040937769 hasConcept C2779649592 @default.
• W2040937769 hasConcept C2779664074 @default.
• W2040937769 hasConcept C41008148 @default.

• next