FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2040986655> ?p ?o ?g. }

• W2040986655 endingPage "38416" @default.
• W2040986655 startingPage "38410" @default.
• W2040986655 abstract "The extreme amino terminus and, in particular, residue Glu-3 in rat liver (L) carnitine palmitoyltransferase I (CPT I) have previously been shown to be essential for the sensitivity of the enzyme to inhibition by malonyl-CoA. Using the Pichia pastoris expression system, we now observe that, although mutants E3A (Glu-3 → Ala) or Δ(3–18) of L-CPT I have markedly lowered sensitivity to malonyl-CoA compared with the wild-type protein, the mutant Δ(1–82) generated an enzyme that had regained much of the sensitivity of wild-type CPT I. This suggests that a region antagonistic to malonyl-CoA sensitivity is present within residues 19–82 of the enzyme. This was confirmed in the construct Δ(19–30), which was found to be 50-fold more sensitive than wild-type L-CPT I. Indeed, this mutant was >4-fold more sensitive than even the native muscle (M)-CPT I isoform expressed and assayed under identical conditions. This behavior was dependent on the presence of Glu-3, with the mutant E3A-Δ(19–30) having kinetic characteristics similar to those of the E3A mutant. The increase in the sensitivity of the L-CPT I-Δ(19–30) mutant was not due to a change in the mechanism of inhibition with respect to palmitoyl-CoA, nor to any marked change of the K0.5 for this substrate. Conversely, for M-CPT I, a decrease in malonyl-CoA sensitivity was invariably observed with increasing deletions from Δ(3–18) to Δ(1–80). However, deletion of residues 3–18 from M-CPT I affected the Km for carnitine of this isoform, but not of L-CPT I. These observations (i) provide the first evidence for negative determinants of malonyl-CoA sensitivity within the amino-terminal segment of L-CPT I and (ii) suggest a mechanism for the inverse relationship between affinity for malonyl-CoA and for carnitine of the two isoforms of the enzyme. The extreme amino terminus and, in particular, residue Glu-3 in rat liver (L) carnitine palmitoyltransferase I (CPT I) have previously been shown to be essential for the sensitivity of the enzyme to inhibition by malonyl-CoA. Using the Pichia pastoris expression system, we now observe that, although mutants E3A (Glu-3 → Ala) or Δ(3–18) of L-CPT I have markedly lowered sensitivity to malonyl-CoA compared with the wild-type protein, the mutant Δ(1–82) generated an enzyme that had regained much of the sensitivity of wild-type CPT I. This suggests that a region antagonistic to malonyl-CoA sensitivity is present within residues 19–82 of the enzyme. This was confirmed in the construct Δ(19–30), which was found to be 50-fold more sensitive than wild-type L-CPT I. Indeed, this mutant was >4-fold more sensitive than even the native muscle (M)-CPT I isoform expressed and assayed under identical conditions. This behavior was dependent on the presence of Glu-3, with the mutant E3A-Δ(19–30) having kinetic characteristics similar to those of the E3A mutant. The increase in the sensitivity of the L-CPT I-Δ(19–30) mutant was not due to a change in the mechanism of inhibition with respect to palmitoyl-CoA, nor to any marked change of the K0.5 for this substrate. Conversely, for M-CPT I, a decrease in malonyl-CoA sensitivity was invariably observed with increasing deletions from Δ(3–18) to Δ(1–80). However, deletion of residues 3–18 from M-CPT I affected the Km for carnitine of this isoform, but not of L-CPT I. These observations (i) provide the first evidence for negative determinants of malonyl-CoA sensitivity within the amino-terminal segment of L-CPT I and (ii) suggest a mechanism for the inverse relationship between affinity for malonyl-CoA and for carnitine of the two isoforms of the enzyme. liver isoform of carnitine palmitoyltransferase muscle isoform transmembrane segment concentration of malonyl-CoA that gives 50% inhibition of CPT activity concentration of palmitoyl-CoA that gives half the maximal activity of CPT observed at the carnitine concentration used in the assay polymerase chain reaction Carnitine palmitoyltransferase I (CPT I,1 malonyl-CoA-sensitive) is an integral membrane protein first identified in the outer membrane and contact sites of mitochondria (1Murthy M.S.R. Pande S.V. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 378-382Crossref PubMed Scopus (195) Google Scholar, 2Fraser F. Zammit V.A. Biochem. J. 1998; 329: 225-229Crossref PubMed Scopus (58) Google Scholar). The enzyme catalyzes the formation of acylcarnitines from long-chain acyl-CoA esters, thus enabling the movement of acyl moieties across intracellular membranes. CPT I exists in two isoforms (Liver andMuscle), which have considerable sequence similarity but differ greatly, and inversely, in their malonyl-CoA sensitivity andKm for carnitine (3McGarry J.D. Mills S.E. Long C.S. Foster D.W. Biochem. J. 1983; 214: 21-28Crossref PubMed Scopus (466) Google Scholar, 4Saggerson E.D. Biochem. J. 1982; 202: 397-405Crossref PubMed Scopus (63) Google Scholar). It is a polytopic protein, with two transmembrane (TM) segments and amino and carboxyl segments (approximately 46 and 652 residues, respectively) that are both exposed on the cytosolic aspect of the membrane (5Fraser F. Corstorphine C.G. Zammit V.A. Biochem. J. 1997; 323: 711-718Crossref PubMed Scopus (122) Google Scholar). It has been shown that the extreme amino terminus of the nascent L-CPT I is retained in the mature protein (6Kolodziej M.P. Zammit V.A. FEBS Lett. 1993; 327: 294-296Crossref PubMed Scopus (32) Google Scholar) and, moreover, that it is essential for the expression of malonyl-CoA sensitivity (5Fraser F. Corstorphine C.G. Zammit V.A. Biochem. J. 1997; 323: 711-718Crossref PubMed Scopus (122) Google Scholar, 7Zammit V.A. Fraser F. Corstorphine C.G. Adv. Enzyme Regul. 1997; 37: 295-317Crossref PubMed Scopus (43) Google Scholar). Subsequent work with expressed CPT I constructs has confirmed these conclusions by showing that deletion of the amino-terminal highly conserved 6 amino acid residues of the L-isoform results in the loss of high affinity malonyl-CoA sensitivity (8Shi J. Zhu H. Arvidson D.N. Cregg J.M. Woldegiorgis G. Biochemistry. 1998; 37: 11033-11038Crossref PubMed Scopus (44) Google Scholar). Glu-3, and to a much lesser extent His-5, have been identified as residues within the extreme amino terminus that enable L-CPT I to bind malonyl-CoA with high affinity (9Shi J. Zhu H. Arvidson D.N. Woldegiorgis G. J. Biol. Chem. 1999; 274: 9421-9426Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar, 10Swanson S.T. Foster D.W. McGarry J.D. Brown N.F. Biochem. J. 1998; 335: 513-519Crossref PubMed Scopus (56) Google Scholar). Thus, the E3A (Glu-3 → Ala) mutant loses malonyl-CoA sensitivity, although it has not been ascertained whether this residue contributes directly to a malonyl-CoA binding site or is required to enable the amino-terminal segment to interact effectively with the much larger carboxyl-terminal segment and maintain it in a conformation that binds malonyl-CoA optimally. That interaction between the amino- and carboxyl-terminal segments is important for the expression of malonyl-CoA sensitivity in the L-isoform was demonstrated by work in which chimeras were constructed using combinations of three segments (amino-terminal plus TM1, loop plus TM2, and carboxyl-segment) from each of L- and M-CPT I (11Jackson V.N. Cameron J.M. Fraser F. Zammit V.A. Price N.T. J. Biol. Chem. 2000; 275: 19560-19566Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar). The precise amino-to-carboxyl pairings affected the sensitivity to malonyl-CoA and the Km for palmitoyl-CoA of the chimeric CPTs, whereas TM1-TM2 pairings affected the affinity for carnitine (11Jackson V.N. Cameron J.M. Fraser F. Zammit V.A. Price N.T. J. Biol. Chem. 2000; 275: 19560-19566Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar). These studies highlighted our long-standing observations on the importance of the interaction of CPT I with the membrane, of which it is an integral protein, for the expression of its kinetic characteristics (12Zammit V. Corstorphine C. Kolodziej M. Fraser F. Lipids. 1998; 33: 371-376Crossref PubMed Scopus (47) Google Scholar, 13Kolodziej M.P. Zammit V.A. Biochem. J. 1990; 272: 421-425Crossref PubMed Scopus (75) Google Scholar) and which more recently have been confirmed by work on the reconstitution of the solubilized or purified recombinant protein in vesicles of different lipid molecular order (14Zhu H. Shi J. Cregg J.M. Woldegiorgis G. Biochem. Cell Biol. 1997; 239: 498-502Google Scholar, 15McGarry J.D. Brown N.F. Biochem. J. 2000; 349: 179-187Crossref PubMed Scopus (34) Google Scholar).Larger truncations extending into the protein sequence from the amino terminus of L-CPT I have, in general, shown that there is very little additional loss of either malonyl-CoA sensitivity or maximal activity compared with those already achieved in the Δ(2–6) or E3A mutants (9Shi J. Zhu H. Arvidson D.N. Woldegiorgis G. J. Biol. Chem. 1999; 274: 9421-9426Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar). However, the observations made by two groups independently on the Δ(1–82) mutant of rat L-CPT I (which is active and can be considered to be the catalytic core) are at variance with each other. Thus, whereas in work by Esser et al. (16Esser V. Britton C.H. Weis B.C. Foster D.W. McGarry J.D. J. Biol. Chem. 1993; 268: 5817-5822Abstract Full Text PDF PubMed Google Scholar) it was shown that this construct has considerable residual malonyl-CoA sensitivity, Shiet al. (8Shi J. Zhu H. Arvidson D.N. Cregg J.M. Woldegiorgis G. Biochemistry. 1998; 37: 11033-11038Crossref PubMed Scopus (44) Google Scholar) could not detect any malonyl-CoA binding to a mitochondrial fraction of yeast in which the mutant was expressed, and the IC50 for malonyl-CoA was much higher than that for the parental L-CPT I. Unfortunately, these two sets of studies were performed using different yeast expression systems (Saccharomyces cerevisiae in Esser et al. (16Esser V. Britton C.H. Weis B.C. Foster D.W. McGarry J.D. J. Biol. Chem. 1993; 268: 5817-5822Abstract Full Text PDF PubMed Google Scholar) and Pichia pastoris in Shi et al. (8Shi J. Zhu H. Arvidson D.N. Cregg J.M. Woldegiorgis G. Biochemistry. 1998; 37: 11033-11038Crossref PubMed Scopus (44) Google Scholar)) such that a strict comparison of the two sets of data is not possible. However, we made preliminary observations on the Δ(1–82) mutant expressed in P. pastoris, which suggested that, not only is the protein expressed by this construct sensitive to malonyl-CoA but it is highly significantly more so than the E3A mutant expressed in the same yeast expression system. This observation raised the prospect that the amino-terminal segment of L-CPT I may contain two types of elements: those that are positive for malonyl-CoA sensitivity (i.e. the extreme amino terminus) and those that are negative (i.e. sequences between the highly conserved amino terminus and residue 82). Therefore, we have generated internal deletions, within the 46-residue cytosolic amino-terminal segment, but with the retention of the fully conserved residues 1–18. We find that these internal deletions result in a 50-fold increase in the malonyl-CoA sensitivity of the relevant L-CPT I mutants, suggesting that, in addition to containing regions that are essential for malonyl-CoA sensitivity, the amino-terminal segment also contains other regions that strongly affect this parameter negatively. Of the many mutants of CPT I studied by various workers, these are the first to express a much more malonyl-CoA-sensitive enzyme.EXPERIMENTAL PROCEDURESAll materials were obtained as described previously (11Jackson V.N. Cameron J.M. Fraser F. Zammit V.A. Price N.T. J. Biol. Chem. 2000; 275: 19560-19566Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar, 17Jackson V.N. Cameron J.M. Zammit V.A. Price N.T. Biochem. J. 1999; 341: 483-489Crossref PubMed Google Scholar) except where detailed. L-Δ(1–82) was generated by digesting L-CPT I in pGAPZ with Csp45I and SphI. Following removal of the smaller restriction fragment, T4 DNA polymerase was used to convert the overhangs to blunt ends, and the plasmid was recircularized. The L-Δ(19–30) deletion mutant was generated by using two overlapping PCRs as described previously (11Jackson V.N. Cameron J.M. Fraser F. Zammit V.A. Price N.T. J. Biol. Chem. 2000; 275: 19560-19566Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar). Oligonucleotide pairs A and B, and C and D (see Table I) were used for the two half reactions, followed by A and D for the final PCR. The L-Δ(19–46) construct was generated in the same way using primer pairs A and E, and F and D, followed by A and D. In both cases, the PCR products were cleaved with Csp45I and AflII and used to replace the corresponding fragment of wild-type L-CPT I with an introduced silent AflII site (11Jackson V.N. Cameron J.M. Fraser F. Zammit V.A. Price N.T. J. Biol. Chem. 2000; 275: 19560-19566Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar) cloned into the vector pGAPZ A. The E3A variants of full-length L-CPT I and the two deletion mutants were generated by PCR using primers G and H, with the appropriate clone as template in each case. Again the PCR products were inserted into CPT I asCsp45I-AflII fragments. L- Δ(3–18) was generated using self-annealing overlapping oligonucleotides I and J. The oligonucleotides were annealed and extended using T4 DNA polymerase. The product was cleaved with NotI and BglII and cloned into CPT I in pGAPZ.Table IOligonucleotides used to generate site-directed mutantsATCTGTTCGAAGATGGCAGAGGCTCACCBCGACAGGCAGATGCCATCGGGGGCACCCCCGATGGCATCTGCCTGTCGGGGDAGATCTTGGTGCTGCGGCTCATTTTGCCGTGTTCTGETGATGCCATTCTTGCCATCGGGGGTGACGGFCCCGATGGCAAGAATGGCATCATCACTGGGTCTGTTCGAAGATGGCTGCTGCTCACCAAGCTGTGHCTGCGGCTCATTTTGCCGTGTTCTGCAAACATICACGCGGCCGCAAGATGGCTATCGATTTACGJGACAGATCTGCTTCAATGCTTCATGGCTCAGGCGTAAATCGKGGGTATTCGAACAAGATGGGGCTGGTCCLGACAAGGGCCGCACAGAATCCAMTGATACTAGTATGGCTGTTGACTTCCGGCTTAGTCGGGNGATCTTGGTGGCATGGCTGGTCTTOACACTAGTATGGCGGAAGCACACCAGGCAPTCCAGACAGGTAGATACCATCTGGGGTCACAQTGTGACCCCAGATGGTATCTACCTGTCTGGA Open table in a new tab The M-Δ(1–80) mutant was constructed by using the existing codon for methionine at position 81 in rat M-CPT I as the start codon. For deletion of the first 18 amino acids, codons for amino acids one and two were retained to maintain identical initiation codon context to the wild-type construct. M-Δ(1–80) was generated by replacing theCsp45I-HindIII fragment of M-CPT I in pGAPZ (11Jackson V.N. Cameron J.M. Fraser F. Zammit V.A. Price N.T. J. Biol. Chem. 2000; 275: 19560-19566Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar) with a cleaved PCR product generated with primers K and L. M-Δ(3–18) was made by replacing the SpeI-AflII fragment of wild-type M-CPT I with a cleaved PCR product generated with primers M and N. M-Δ(19–30) was generated by the same means as its liver counterpart using primer pairs O and P, and Q and N. The final PCR product (primers O and N) was cloned in as aSpeI-AflII fragment as for M-Δ(3–18).Transformation of P. pastoris strain X-33, CPT I expression, and preparation of cell-free extracts was as described previously (11Jackson V.N. Cameron J.M. Fraser F. Zammit V.A. Price N.T. J. Biol. Chem. 2000; 275: 19560-19566Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar, 17Jackson V.N. Cameron J.M. Zammit V.A. Price N.T. Biochem. J. 1999; 341: 483-489Crossref PubMed Google Scholar). L-CPT I and M-CPT I-derived mutants were selected with 0.1 and 0.5 mg of zeocin/ml, respectively, except for L-CPT I-Δ(1–82) for which use of 0.5 mg of zeocin/ml was required to obtain levels of CPT activity sufficient for assay. The lower expression levels of this mutant may be due to the fact that, although the other L-CPT I constructs had the same initiation codon context, with alanine as the second amino acid (ATGG), in Δ(1–82) the presence of isoleucine as residue two defines the less optimal start codon context ATGA (18Kozak M. Gene. 1999; 234: 187-208Crossref PubMed Scopus (1121) Google Scholar).Secondary structure predictions for the CPT I amino-terminal regions were performed using various methods, including a consensus prediction method on the Network Protein Sequence @nalysis server on the Web. These methods predict that the amino-terminal 46 amino acids of L- and M-CPT I adopt similar structures.CPT I activity was measured using cell-free yeast extracts as described previously (11Jackson V.N. Cameron J.M. Fraser F. Zammit V.A. Price N.T. J. Biol. Chem. 2000; 275: 19560-19566Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar, 17Jackson V.N. Cameron J.M. Zammit V.A. Price N.T. Biochem. J. 1999; 341: 483-489Crossref PubMed Google Scholar). Briefly, for determination of theKm for carnitine, palmitoyl-CoA concentration was fixed at 135 μm. For determination ofK0.5 for palmitoyl-CoA, carnitine concentration was fixed at 500 μm. For practical reasons this was the highest concentration of carnitine of sufficiently high specific activity that was feasible, but it was not always a saturating concentration. Therefore, the apparent K0.5 for palmitoyl-CoA, or the concentration of substrate that gives half the maximum activity obtained under the assay conditions, is given. The IC50 malonyl-CoA (i.e. the concentration of inhibitor that inhibits the CPT activity by 50%) was determined using 35 μm palmitoyl-CoA and 500 μm carnitine. Data were fitted to the Michaelis-Menten equation for palmitoyl-CoA or carnitine as variable substrates and to an equation for simple competitive inhibition with respect to palmitoyl-CoA to obtain IC50 values for malonyl-CoA. The mechanism of inhibition by malonyl-CoA was studied by performing assays at different palmitoyl-CoA concentrations in the absence and presence of two different malonyl-CoA concentrations. Malonyl-CoA concentration dependence of activity at three different concentrations of palmitoyl-CoA (20, 35, and 70 μm) was used to construct Dixon plots and to obtainKi values.Curve fitting was carried out using Sigma-Plot software with non-linear regression analysis and Excel software using linear regression analysis. Statistical analysis was calculated using two-tailed Student's t tests.RESULTSComparison of the Properties of Native L-CPT I with Those of Δ(1–82), E3A, and Δ(3–18) MutantsMalonyl-CoA SensitivityThe most marked kinetic difference between the Δ(1–82) protein and the E3A and Δ(3–18) mutants was in the IC50 values for malonyl-CoA inhibition (Table II). That of the Δ(1–82) mutant (68 ± 1 μm) was much more similar to that of the parental protein (only 1.8-fold higher) than were those of the other mutants (5-fold higher than for native L-CPT I). This was in disagreement with previous observations of other authors (8Shi J. Zhu H. Arvidson D.N. Cregg J.M. Woldegiorgis G. Biochemistry. 1998; 37: 11033-11038Crossref PubMed Scopus (44) Google Scholar, 9Shi J. Zhu H. Arvidson D.N. Woldegiorgis G. J. Biol. Chem. 1999; 274: 9421-9426Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar) who have reported that the IC50 was raised to the same levels by both Δ(1–82) and E3A mutations.Table IIComparison of activities and kinetic parameters for wild-type and mutant forms of L- and M-CPT I expressed in P. pastorisConstructActivityIC50malonyl-CoAKimalonyl-CoAK0.5palmitoyl-CoAKm carnitinenmol/min/mg yeast proteinμmLiver CPT I wild-type6.4 ± 0.338 ± 231.0, 41.346.0 ± 5.1153 ± 11 E3A12.3 ± 1.3 2-ap < 0.05,199 ± 8 2-bp < 0.001.38.1, 42.178.6 ± 7.2 2-ap < 0.05,211 ± 10 2-ap < 0.05, Δ(3–18)13.9 ± 1.0 2-ap < 0.05,176 ± 16 2-bp < 0.001.ND 2-cND, not determined.81.5 ± 10.0 2-ap < 0.05,227 ± 17 2-ap < 0.05, Δ(1–82)3.0 ± 0.5 2-ap < 0.05,69 ± 1 2-ap < 0.05,25.0, 35.135.2 ± 0.3483 ± 39 2-bp < 0.001. Δ(19–30)7.5 ± 1.01.1 ± 0.1 2-bp < 0.001.0.3, 0.574.2 ± 3.9 2-ap < 0.05,259 ± 20 2-ap < 0.05, Δ(19–46)10.9 ± 1.2 2-ap < 0.05,3.0 ± 0.3 2-bp < 0.001.ND99.2 ± 1.0 2-bp < 0.001.232 ± 7 2-ap < 0.05, E3A-Δ(19–30)9.0 ± 0.4 2-ap < 0.05,130 ± 12 2-ap < 0.05,ND57.7 ± 2.4232 ± 21 2-ap < 0.05, E3A-Δ(19–46)13.7 ± 1.1 2-ap < 0.05,180 ± 7 2-bp < 0.001.ND86.9 ± 5.2 2-ap < 0.05,215 ± 10 2-ap < 0.05,Muscle CPT I wild-type1.4 ± 0.23.3 ± 0.2ND57.4 ± 5.5779 ± 80 Δ(3–18)0.8 ± 0.034.5 ± 0.2 2-ap < 0.05,ND41.2 ± 6.31710 ± 267 2-ap < 0.05, Δ(1–80)1.1 ± 0.111.1 ± 0.7 2-bp < 0.001.ND100.2 ± 11.8 2-ap < 0.05,641 ± 52Native and mutant CPT I constructs were expressed in P. pastoris, and enzyme activity was measured in cell-free extracts as described under “Experimental Procedures.” Data for wild-type L- and M-CPT I are taken from Jackson et al. (11Jackson V.N. Cameron J.M. Fraser F. Zammit V.A. Price N.T. J. Biol. Chem. 2000; 275: 19560-19566Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar). For all parameters, values are means (±S.D.) for three independent preparations, except for Ki determination (n = 2).Values that are statistically significantly different from the parental construct are indicated:2-a p < 0.05,2-b p < 0.001.2-c ND, not determined. Open table in a new tab Affinities for Carnitine and Palmitoyl-CoAConstruct Δ(1–82) also had distinctive characteristics with respect to the affinities for the reaction substrates. The Km for carnitine was 300% higher, at 484 ± 39 μm, than that of the wild-type protein (p = 0.001), whereas itsK0.5 for palmitoyl-CoA was 25% lower (TableII). By contrast, the kinetic characteristics of the Δ(3–18) mutant were similar to those of E3A for all kinetic parameters, including >1.5-fold higher values (relative to the wild-type) for palmitoyl-CoA and carnitine.Mechanism of Malonyl-CoA InhibitionThe kinetic basis for the large loss in malonyl-CoA sensitivity of the E3A mutant was studied. Calculation of the Ki values for malonyl-CoA for the three constructs (native, E3A, and Δ(1–82); see Fig. 1 and Table II) showed that malonyl-CoA increased the K0.5 for palmitoyl-CoA in all three mutants, with very similar Ki values despite the 5-fold range in IC50 values (Table II). This was in contrast to the parallel increase in Ki and IC50 reported for mutants E3A and Δ(1–82) previously (9Shi J. Zhu H. Arvidson D.N. Woldegiorgis G. J. Biol. Chem. 1999; 274: 9421-9426Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar). For all three constructs, the pattern of inhibition was competitive (Fig. 2). However, although for native L-CPT I the effect of malonyl-CoA was limited to raising theK0.5 for palmitoyl-CoA (Fig. 2, a andb) for mutants E3A and Δ(1–82), there was, in addition, a reproducible increase in the Vmax (Fig. 2,c and d). This type of behavior (hyperbolic inhibition) is rare for native enzymes but has been discussed in detail previously (19Cornish-Bowden A. Fundamentals of Enzyme Kinetics. 2nd Ed. Portland Press, London1995: 115-116Google Scholar).Figure 2Lineweaver-Burke plots for the inhibition of activity by malonyl-CoA in extracts of P. pastorisexpressing native and mutant L-CPT I proteins. Constructs were expressed in P. pastoris and CPT activity measured as described under “Experimental Procedures.” The malonyl-CoA concentrations used were selected according to the IC50determined previously (Table II) and were: a, L-CPT I measured at 0, 20, and 40 μm malonyl-CoA; b,L-CPT I-Δ(19–30) measured at 0, 0.5, and 1.0 μm malonyl-CoA; c, L-CPT I-E3A measured at 0, 100, and 175 μm malonyl-CoA; and d, L-CPT I Δ(1–82) measured at 0, 35, and 70 μm malonyl-CoA. Plots representative of two separate preparations are shown.View Large Image Figure ViewerDownload (PPT)Properties of L-CPT I Mutants Bearing Internal Deletions within the Cytosolic Amino-segment: Δ(19–30) and Δ(19–46)The above data indicated that, apart from the extreme amino terminus, elements within the cytosolic amino-segment may influence malonyl-CoA sensitivity such that their deletion, as in Δ(1–82), has a rescuing effect on this parameter. The existence of such a negative element in L- but not M-CPT I could potentially provide the basis for the 50- to 100-fold difference in the IC50 for malonyl-CoA displayed by the two isoforms. Therefore, we wanted to determine which features of the cytosolic amino-terminal segment could be responsible. Algorithms for prediction of transmembrane regions, suggest that residue 46 of L-CPT I defines the limit of the extra-membranous cytosolic amino-segment before the start of the hydrophobic TM1 segment. Because residues 1–18 are fully conserved between L- and M-CPT I, we concentrated on residues 19–46. All secondary structure prediction methods based on single or multiply aligned sequences agree that residues 15–19 (TPDG) constitute a random coil or β-turn. The region between this proposed turn and the membrane-embedded sequence is predicted to form an α-helix, broken by a random coil for residues 35–38, based on the consensus of nine different prediction methods. Therefore, two mutants of L-CPT I were constructed in which residues up to, and including, the turn region (amino acids 1–18) were retained. Deletions were made between residues (19–30 or 19–46) such that in these mutants the extreme amino terminus, including Glu-3, is predicted to be physically closer to the aqueous-phase/membrane interface.Malonyl-CoA SensitivityThe most striking property of the L-CPT I-Δ(19–30) and -Δ(19–46) mutants was that they had IC50 values for malonyl-CoA inhibition that were manyfoldlower that that for the parental protein (Table II). This was especially evident for the Δ(19–30) protein, which had an IC50 value that was almost 50-fold lower than that of L-CPT I (0.8 μm versus 38 μmmalonyl-CoA; see Fig. 3).Figure 3Effects of increasing the concentration of malonyl-CoA on the activities of wild-type L-CPT I- and the L-CPT I-Δ(19–30) mutant. Cell-free extracts ofP. pastoris were prepared, and CPT activity was measured for (●) wild-type and (○) Δ(19–30) constructs. Aliquots (25 μl) of extract were assayed in a final volume of 1 ml for 4 min at 30 °C, using 35 μm palmitoyl-CoA and 0.5 mmcarnitine. Values are means of three separate determinations (±S.D.). Where error bars are not visible, they lie within the symbol.View Large Image Figure ViewerDownload (PPT)Affinities for Carnitine and Palmitoyl-CoAThere were modest, but statistically significant, increases in theK0.5 for palmitoyl-CoA and Kmfor carnitine with respect to the wild-type protein (up to 2-fold; see Table II). Therefore, mutations Δ(19–30) and Δ(19–46) had effects similar to E3A and Δ(3–18) on the increases in the values for both the reaction substrates, but markedly opposite effects on the Ki for malonyl-CoA (above).Mechanism of Malonyl-CoA InhibitionTo ascertain that the observed 50-fold decrease in IC50 for malonyl-CoA for the Δ(19–30) mutant did not result from the change in theK0.5 for palmitoyl-CoA, we performed kinetic analyses of the dependence of the activities of the mutants and of the parental protein, with respect to palmitoyl-CoA and malonyl-CoA concentrations. The Ki value for the Δ(19–30) mutant was almost two orders of magnitude lower than that for native L-CPT I (Table II). The data in Fig. 2(a and b) show that this decrease inKi was not accompanied by any change in the kinetic mechanism of malonyl-CoA inhibition of the enzyme activity of Δ(19–30) compared with the parental protein (both competitive). A similar result was obtained for the Δ(19–46) mutant (not shown). Thus, the decrease in Ki for malonyl-CoA could account entirely for the decreased IC50 of these internal deletion mutants (Table II).Interaction between the Effects of the E3A Mutation and Deletions Internal to the Cytosolic Amino-segment of L-CPT IIn view of the opposing effects on malonyl-CoA sensitivity of the E3A and of the Δ(19–30) and, to a lesser extent, the Δ(19–46) mutations, we investigated whether the enhanced malonyl-CoA sensitivity demonstrated by the deletion mutants was conditional on the presence of Glu-3. Therefore, two mutants, E3A-Δ(19–30) and E3A-Δ(19–46) were constructed. The data in Table II show that the E3A-Δ(19–30) mutant was two orders of magnitude less sensitive to malonyl-CoA than the Δ(19–30) mutant, indicating that the lowered IC50induced by the internal deletion does not obviate the requirement for the presence of Glu-3. However, despite its increase, the IC50 value was still significantly lower (by 25%) than that of the E3A mutant (p = 0.008). By contrast, the effect of deletion of residues 19–46 on malonyl-CoA sensitivity was fully reversed by simultaneous mutation of Glu-3. Both the E3A derivatives of the internal deletion mutants showed very similar kinetic parameters for palmitoyl-CoA and carnitine to those displayed by the proteins expressed from mutants with the parental deletions and the E3A mutant itself (Table II) indicating that the effects of the combined mutations were not additive.Comparison of the Properties of Native M-CPT I to Those of the Δ(1–80) and Δ(3–18) Mutants Derived from ItPrevious work (20Shi J. Zhu H. Arvidson D.N. Woldegiorgis G. Biochemistry. 2000; 39: 712-717Crossref PubMed Scopus (46) Google Scholar) has shown that deletion of the amino-terminal first 18 residues of human M-CPT I causes only a relatively minor increase in IC50 for malonyl-CoA, whereas further amino-terminal truncation of the protein by 28, 39, 51, or 72 residues gives a 10-fold greater loss in sensitivity. (It is to be noted, however, that the IC50 is still lower than that of full-length L-CPT I.) Therefore, in human M-CPT I any effect of the sequence between residues 19–30 on malonyl-CoA sensitivity would be expected to be positive, rather than negative. Therefore, we decided to test this possibility to ascertain whether the 19–3" @default.
• W2040986655 created "2016-06-24" @default.
• W2040986655 creator A5007392346 @default.
• W2040986655 creator A5078710921 @default.
• W2040986655 creator A5087808895 @default.
• W2040986655 date "2000-12-01" @default.
• W2040986655 modified "2023-10-17" @default.
• W2040986655 title "Identification of Positive and Negative Determinants of Malonyl-CoA Sensitivity and Carnitine Affinity within the Amino Termini of Rat Liver- and Muscle-type Carnitine Palmitoyltransferase I" @default.
• W2040986655 cites W140649346 @default.
• W2040986655 cites W1577348758 @default.
• W2040986655 cites W1598643430 @default.
• W2040986655 cites W1633034930 @default.
• W2040986655 cites W1963817811 @default.
• W2040986655 cites W1970223493 @default.
• W2040986655 cites W1971333394 @default.
• W2040986655 cites W1971481102 @default.
• W2040986655 cites W1988762815 @default.
• W2040986655 cites W1988767514 @default.
• W2040986655 cites W2016255597 @default.
• W2040986655 cites W2025179752 @default.
• W2040986655 cites W2046083316 @default.
• W2040986655 cites W2057816478 @default.
• W2040986655 cites W2058426472 @default.
• W2040986655 cites W2062644914 @default.
• W2040986655 cites W207208947 @default.
• W2040986655 cites W2084194858 @default.
• W2040986655 cites W2084837757 @default.
• W2040986655 cites W2234437887 @default.
• W2040986655 cites W2234558981 @default.
• W2040986655 cites W2246259692 @default.
• W2040986655 cites W2256351467 @default.
• W2040986655 cites W2345746585 @default.
• W2040986655 cites W2400176138 @default.
• W2040986655 cites W2414237866 @default.
• W2040986655 cites W3025295781 @default.
• W2040986655 cites W4255409261 @default.
• W2040986655 doi "https://doi.org/10.1074/jbc.m007722200" @default.
• W2040986655 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10969089" @default.
• W2040986655 hasPublicationYear "2000" @default.
• W2040986655 type Work @default.
• W2040986655 sameAs 2040986655 @default.
• W2040986655 citedByCount "42" @default.
• W2040986655 countsByYear W20409866552013 @default.
• W2040986655 countsByYear W20409866552014 @default.
• W2040986655 countsByYear W20409866552016 @default.
• W2040986655 countsByYear W20409866552020 @default.
• W2040986655 crossrefType "journal-article" @default.
• W2040986655 hasAuthorship W2040986655A5007392346 @default.
• W2040986655 hasAuthorship W2040986655A5078710921 @default.
• W2040986655 hasAuthorship W2040986655A5087808895 @default.
• W2040986655 hasConcept C116834253 @default.
• W2040986655 hasConcept C127413603 @default.
• W2040986655 hasConcept C181199279 @default.
• W2040986655 hasConcept C185592680 @default.
• W2040986655 hasConcept C21200559 @default.
• W2040986655 hasConcept C24326235 @default.
• W2040986655 hasConcept C2776423169 @default.
• W2040986655 hasConcept C2776614356 @default.
• W2040986655 hasConcept C2778435403 @default.
• W2040986655 hasConcept C2779364145 @default.
• W2040986655 hasConcept C55493867 @default.
• W2040986655 hasConcept C59822182 @default.
• W2040986655 hasConcept C82714985 @default.
• W2040986655 hasConcept C86803240 @default.
• W2040986655 hasConceptScore W2040986655C116834253 @default.
• W2040986655 hasConceptScore W2040986655C127413603 @default.
• W2040986655 hasConceptScore W2040986655C181199279 @default.
• W2040986655 hasConceptScore W2040986655C185592680 @default.
• W2040986655 hasConceptScore W2040986655C21200559 @default.
• W2040986655 hasConceptScore W2040986655C24326235 @default.
• W2040986655 hasConceptScore W2040986655C2776423169 @default.
• W2040986655 hasConceptScore W2040986655C2776614356 @default.
• W2040986655 hasConceptScore W2040986655C2778435403 @default.
• W2040986655 hasConceptScore W2040986655C2779364145 @default.
• W2040986655 hasConceptScore W2040986655C55493867 @default.
• W2040986655 hasConceptScore W2040986655C59822182 @default.
• W2040986655 hasConceptScore W2040986655C82714985 @default.
• W2040986655 hasConceptScore W2040986655C86803240 @default.
• W2040986655 hasIssue "49" @default.
• W2040986655 hasLocation W20409866551 @default.
• W2040986655 hasOpenAccess W2040986655 @default.
• W2040986655 hasPrimaryLocation W20409866551 @default.
• W2040986655 hasRelatedWork W129823155 @default.
• W2040986655 hasRelatedWork W133763281 @default.
• W2040986655 hasRelatedWork W1495212988 @default.
• W2040986655 hasRelatedWork W1577348758 @default.
• W2040986655 hasRelatedWork W2008080431 @default.
• W2040986655 hasRelatedWork W2084916337 @default.
• W2040986655 hasRelatedWork W2114425856 @default.
• W2040986655 hasRelatedWork W2149416112 @default.
• W2040986655 hasRelatedWork W2152461518 @default.
• W2040986655 hasRelatedWork W3177013369 @default.
• W2040986655 hasVolume "275" @default.
• W2040986655 isParatext "false" @default.
• W2040986655 isRetracted "false" @default.
• W2040986655 magId "2040986655" @default.
• W2040986655 workType "article" @default.