FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2041829432> ?p ?o ?g. }

• W2041829432 endingPage "28606" @default.
• W2041829432 startingPage "28596" @default.
• W2041829432 abstract "Fifteen variants with ≥30-fold resistance toN-methyl-N-nitrosourea were isolated from the Burkitt's lymphoma Raji cell line. Eight had received a single treatment with a highly cytotoxic dose. The remainder, including the previously described RajiF12 cell line, arose following multiple exposures to initially moderate but escalating doses. Surprisingly, methylation resistance arose in three clones by reactivation of a previously silent O 6-methylguanine-DNA methyltransferase gene. Five clones, including RajiF12, displayed the microsatellite instability and increased spontaneous mutation rates at the hypoxanthine-guanine phosphoribosyltransferase locus, consistent with deficiencies in mismatch repair. Defects in either the hMutSα or hMutLα mismatch repair complexes were identified in extracts of these resistant clones by in vitro complementation using extracts from colorectal carcinoma cell lines. Defects in hMutLα were confirmed by Western blot analysis. Remarkably, five methylation-resistant clones in which mismatch repair defects were demonstrated by biochemical assays did not exhibit significant microsatellite instability. Fifteen variants with ≥30-fold resistance toN-methyl-N-nitrosourea were isolated from the Burkitt's lymphoma Raji cell line. Eight had received a single treatment with a highly cytotoxic dose. The remainder, including the previously described RajiF12 cell line, arose following multiple exposures to initially moderate but escalating doses. Surprisingly, methylation resistance arose in three clones by reactivation of a previously silent O 6-methylguanine-DNA methyltransferase gene. Five clones, including RajiF12, displayed the microsatellite instability and increased spontaneous mutation rates at the hypoxanthine-guanine phosphoribosyltransferase locus, consistent with deficiencies in mismatch repair. Defects in either the hMutSα or hMutLα mismatch repair complexes were identified in extracts of these resistant clones by in vitro complementation using extracts from colorectal carcinoma cell lines. Defects in hMutLα were confirmed by Western blot analysis. Remarkably, five methylation-resistant clones in which mismatch repair defects were demonstrated by biochemical assays did not exhibit significant microsatellite instability. The ability to remove altered bases from DNA is central to cellular protection against DNA damage by cytotoxic drugs. Removal can be effected by excision repair, which may involve the replacement of relatively long or short stretches of DNA or by direct reversal of the damage. An example of the former is provided by the excision of cisplatin-DNA adducts by the long-patch nucleotide excision repair pathway. Loss of the nucleotide excision repair pathway in the genetic disorder xeroderma pigmentosum is associated with sensitivity to cisplatin (for review see Ref. 1Chu G. J. Biol. Chem. 1994; 269: 787-790Abstract Full Text PDF PubMed Google Scholar). The in situ demethylation of DNA O 6-methylguanine (O 6-meGua) 1The abbreviations used are:O 6-meGua,O 6-methylguanine; MGMT,O 6-meGua-DNA methyltransferase; MNU,N-methyl-N-nitrosourea; PCR, polymerase chain reaction; (k)bp, (kilo)base pair(s); CMV, cytomegalovirus; TBS, Tris-buffered saline; HPRT, hypoxanthine-guanine phosphoribosyltransferase. by the O 6-meGua-DNA methyltransferase (MGMT) provides an example of the latter strategy, and loss of MGMT expression in the Mex− (or Mer−) phenotype confers sensitivity to methylating agents. This selective sensitivity of Mex− cells directly implicates persistent DNAO 6-meGua lesions in cell death following exposure to methylating agents (for review see Ref. 2Pegg A.E. Cancer Res. 1990; 50: 6119-6129PubMed Google Scholar). As an alternative to DNA lesion removal, tolerance mechanisms also provide escape from cytotoxic DNA damage. One known mechanism of DNA damage tolerance in human cells is loss of DNA mismatch repair. The DNA mismatch correction pathway normally corrects replication errors and prevents recombinational exchanges between nonidentical DNA sequences (for review see Ref. 3Modrich P. Lahue R. Annu. Rev. Biochem. 1996; 65: 101-133Crossref PubMed Scopus (1337) Google Scholar). The usual substrates for mismatch correction are mispaired or unpaired normal DNA bases. There is increasing evidence that mismatch repair proteins play a significant part in processing diverse types of drug-induced DNA lesions (for review see Ref. 4Karran P. Bignami M. Chem. Biol. (Lond.). 1996; 3: 875-879Abstract Full Text PDF PubMed Scopus (40) Google Scholar). Mismatch repair interacts with DNA damage includingO 6-meGua, 6-thioguanine, and as yet undefined alterations introduced by cisplatin and doxorubicin. It contributes directly to the cytotoxicity of these lesions, and mismatch repair-competent cells may be sensitive to their lethal effects, although other mediators of cell death such as the p53 and p21 proteins are sometimes important for cytotoxic manifestations (5Anthoney D.A. McIlwrath A.J. Gallagher W.M. Edlin A.R.M. Brown R. Cancer Res. 1996; 56: 1374-1381PubMed Google Scholar). Cells that acquire resistance to prolonged drug exposure are found to have defects in mismatch repair functions (6Branch P. Aquilina G. Bignami M. Karran P. Nature. 1993; 362: 652-654Crossref PubMed Scopus (351) Google Scholar, 7Kat A. Thilly W.G. Fang W.H. Longley M.J. Li G.M. Modrich P. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 6424-6428Crossref PubMed Scopus (427) Google Scholar, 8Drummond J.T. Anthoney D.A. Brown R. Modrich P. J. Biol. Chem. 1996; 271: 19645-19648Abstract Full Text Full Text PDF PubMed Scopus (283) Google Scholar, 9Ceccotti S. Aquilina G. Macpherson P. Yamada M. Karran P. Bignami M. Curr. Biol. 1996; 6: 1528-1531Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar, 10Aebi S. Kurdi-Haidar B. Gordon R. Cenni B. Zeng H. Fink D. Christen R.D. Boland C.R. Koi M. Fishel R. Howell S.B. Cancer Res. 1996; 56: 3087-3090PubMed Google Scholar). The phenomenon of cellular resistance acquired through mismatch repair defects is known as tolerance because the DNA lesions persist but, in the absence of mismatch repair, they are not processed into lethal intermediates and are unable to exert their potential cytotoxic effects. Resistance to these kinds of drugs is a significant therapeutic problem, and DNA damage tolerance may be of clinical importance. The association of the human cancer syndrome Hereditary Non Polyposis Colorectal Cancer (HNPCC) with defective DNA mismatch repair has provided the genetic framework by which to define the human pathway (11Fishel R. Kolodner R.D. Curr. Opin. Genet. Dev. 1995; 5: 382-395Crossref PubMed Scopus (301) Google Scholar, 12Liu B. Parsons R. Papadopoulos N. Lynch H.T. Watson P. Jass J.R. Dunlop M. Wyllie A. Peltomäki P. de la Chapelle A. Hamilton S.R. Vogelstein B. Kinzler K.W. Nat. Med. 1996; 2: 169-174Crossref PubMed Scopus (856) Google Scholar). Complementary biochemical studies have implicated five mismatch repair proteins in the early steps of the correction process. These proteins are encoded by the hMSH2, hMLH1,hMSH6/GTBP, hPMS2, and hMSH3 (also known as DUP1 or MRP1 (13Fujii H. Shimada T. J. Biol. Chem. 1989; 264: 10057-10064Abstract Full Text PDF PubMed Google Scholar)) genes (14Fishel R. Lescoe M.K. Rao M.S.R. Copeland N.G. Jenkins N.A. Garber J. Kane M. Kolodner R. Cell. 1993; 75: 1027-1038Abstract Full Text PDF PubMed Scopus (2610) Google Scholar, 15Parsons R. Li G.-M. Longley M.J. Fang W.-h. Papadopoulos N. Jen J. de la Chapelle A. Kinzler K.W. Vogelstein B. Modrich P. Cell. 1993; 75: 1227-1236Abstract Full Text PDF PubMed Scopus (966) Google Scholar, 16Palombo F. Gallinari P. Iaccarino I. Lettieri T. Hughes M. D'Arrigo A. Truong O. Hsuan J.J. Jiricny J. Science. 1995; 268: 1912-1914Crossref PubMed Scopus (481) Google Scholar, 17Li G.-M. Modrich P. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 1950-1954Crossref PubMed Scopus (356) Google Scholar, 18Risinger J.I. Umar A. Barrett J.C. Kunkel T.A. J. Biol. Chem. 1995; 270: 18183-18186Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar, 19Risinger J.I. Umar A. Boyd J. Berchuck A. Kunkel T.A. Barrett J.C. Nat. Genet. 1996; 14: 102-105Crossref PubMed Scopus (160) Google Scholar). The initial correction steps involve the interactions of a number of heterodimers formed by these proteins. Thus, current models of mismatch correction suggest that the initial mismatch recognition is likely to be carried out by one of two complexes designated hMutSα and hMutSβ (16Palombo F. Gallinari P. Iaccarino I. Lettieri T. Hughes M. D'Arrigo A. Truong O. Hsuan J.J. Jiricny J. Science. 1995; 268: 1912-1914Crossref PubMed Scopus (481) Google Scholar, 20Drummond J.T. Li G.-M. Longley M.J. Modrich P. Science. 1995; 268: 1909-1912Crossref PubMed Scopus (538) Google Scholar, 21Palombo F. Iaccarino I. Nakajima E. Ikejima M. Shimada T. Jiricny J. Curr. Biol. 1996; 6: 1181-1184Abstract Full Text Full Text PDF PubMed Scopus (303) Google Scholar), which bind to the mismatched DNA segment. The hMutSα heterodimer is composed of hMSH2 and hMSH6/GTBP. In the hMutSβ complex, hMSH2 is partnered by hMSH3. The α and β recognition factors have different, but partly overlapping, specificities for mismatch binding that depend on the mismatch itself and perhaps also on the context in which it appears (21Palombo F. Iaccarino I. Nakajima E. Ikejima M. Shimada T. Jiricny J. Curr. Biol. 1996; 6: 1181-1184Abstract Full Text Full Text PDF PubMed Scopus (303) Google Scholar). hMutSα preferentially recognizes single-base mispairs (transition/transversion intermediates) and single-base loops (frameshift intermediates) that arise by DNA slippage during replication of tracts of repeated mononucleotides. The preferred substrates of hMutSβ are two to four base loops. Although this simple model is compatible with much of the experimental evidence, the properties of the only reported hMSH3-defective human cell line suggest that mismatch recognition by the α and β complexes may be governed by more complex factors than these simple numerical rules (19Risinger J.I. Umar A. Boyd J. Berchuck A. Kunkel T.A. Barrett J.C. Nat. Genet. 1996; 14: 102-105Crossref PubMed Scopus (160) Google Scholar). After recognition of the mismatch, a second heterodimer, hMutLα, is recruited (17Li G.-M. Modrich P. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 1950-1954Crossref PubMed Scopus (356) Google Scholar). This complex comprises the hMLH1 and hPMS2 proteins and probably serves to assemble the components necessary for the excision of the mismatched DNA segment. Deficiencies in the both the hMutSα and hMutLα complexes have been found in drug-resistant cells (reviewed in Ref. 22Karran P. Hampson R. Cancer Surv. 1996; 28: 69-85PubMed Google Scholar). To investigate the relative frequencies of defective hMutSα and hMutLα complexes in tolerance to a methylating agent, we isolated and characterized a number of N-methyl-N-nitrosourea (MNU)-resistant variants of the Raji cell line. We evaluated two different protocols that were designed to mimic different therapeutic regimes. In the first, cells were exposed to a single high dose of the methylating agent. The second involved chronic exposure to escalating MNU doses. Several methylation-tolerant clones were isolated using both treatment regimes. Three independent clones had acquired MNU resistance through reexpression of their silent MGMT gene. We examined several phenotypic characteristics and defined the mismatch repair defect in a number of the remaining methylation-tolerant clones. These defects included hMutLα but were predominantly in hMutSα, most likely hMSH6/GTBP. In several resistant clones, a demonstrable defect in mismatch repair was not accompanied by a detectable mutator phenotype. Chemicals were obtained from Sigma except where stated otherwise. Formamide (Fluka) was deionized with AG501-X8 resin (Bio-Rad). Recrystallized MNU was a gift from Dr. Peter Swann, Department of Biochemistry, University College London, UK. Antibodies against hMLH1 and hPMS2 were obtained from Pharmingen and against hMSH2 from Santa Cruz Biotechnologies. The TK−,Mex−Raji cell line is routinely maintained in our laboratory. At the start of this study, three cultures of Raji cells were expanded from a small inoculum (100 cells), and a single clone was isolated from each population by dilution and seeding into 96-well plates. These three clones were used to generate MNU-resistant derivatives. The LoVo, DLD-1 and HCT116 colorectal carcinoma cell lines were obtained from C. Dixon, Cancer Genetics Laboratory, Imperial Cancer Research Fund and cultured as described previously (23Branch P. Hampson R. Karran P. Cancer Res. 1995; 55: 2304-2309PubMed Google Scholar). Multiple cultures of exponentially growing cells, 106–107 cells in 10 ml RPMI medium supplemented with 10% fetal calf serum, were treated with 500 μm MNU. After a period of 28 days of culture to allow the outgrowth of survivors, surviving cells were cloned by single cell plating in 96-well plates. Chronically treated cells received 0.01 mm MNU. When exponential growth resumed, they were treated with 0.02 mmMNU. The procedure was repeated using successive treatments with 0.03, 0.04, 0.05, 0.1, 0.32, and 0.5 mm MNU. Clones were isolated by single-cell plating. A single representative of each treated culture was chosen for further characterization. O 6-Methylguanine-DNA methyltransferase activity in cell extracts was measured using heat-depurinated [3H]MNU-treated DNA as described previously (23Branch P. Hampson R. Karran P. Cancer Res. 1995; 55: 2304-2309PubMed Google Scholar). Analysis was performed on subclones derived from each resistant clone. Colonies that had undergone approximately 20 cell doublings were lysed in situin 96-well plates, and aliquots were removed for PCR. Dinucleotide repeat microsatellites were amplified using fluorescent-labeled primers. Lengths were determined on an ABI automatic DNA sequencer as described previously (23Branch P. Hampson R. Karran P. Cancer Res. 1995; 55: 2304-2309PubMed Google Scholar). Four loci were analyzed: D10S197, D11S904, D13S175, and D17S941. Mononucleotide repeat microsatellites, Bat25, Bat26, and Bat40 were amplified, separated on sequencing gels, and analyzed by Southern blotting using one of the radiolabeled PCR primers as a probe. Cultures (25 for each clone tested) were initiated using small (100 cell) inocula and expanded to ∼106 cells, which were distributed in 96-well plates (approximately 104 cells/well) in medium supplemented with 5 μg/ml 6-thioguanine. After 28 days, the frequency of positive wells containing 6-thioguanine-resistant cells was determined. Mutation rates were calculated from the equation, M = −lnP o · C −1 · ln 2, where P o is the number of cultures without mutant clones, and C is the total number of cells placed in selection. In some cases, mutation frequencies were estimated by plating growing cultures in 96-well plates under the same selective conditions. Cell extracts were prepared as described (24Karran P. Macpherson P. Ceccotti S. Dogliotti E. Griffin S. Bignami M. J. Biol. Chem. 1993; 268: 15878-15886Abstract Full Text PDF PubMed Google Scholar). Plasmid pSVori methylated with 0.48 mm MNU for 30 min at 37 °C was incubated with extract in the presence of [α-32P]dATP, and incorporation of radioactivity into material adhering to DE81 paper (Whatman) was determined as described (24Karran P. Macpherson P. Ceccotti S. Dogliotti E. Griffin S. Bignami M. J. Biol. Chem. 1993; 268: 15878-15886Abstract Full Text PDF PubMed Google Scholar). The preparation of cell extracts and details of the bandshift assay for mismatch binding have been described previously (25Stephenson C. Karran P. J. Biol. Chem. 1989; 264: 21177-21182Abstract Full Text PDF PubMed Google Scholar). The substrates were 34-mer-duplex oligonucleotides containing a single GT mispair (25Stephenson C. Karran P. J. Biol. Chem. 1989; 264: 21177-21182Abstract Full Text PDF PubMed Google Scholar) or an unpaired CA dinucleotide (duplex C in Ref. 26Aquilina G. Hess P. Branch P. MacGeoch C. Casciano I. Karran P. Bignami M. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 8905-8909Crossref PubMed Scopus (84) Google Scholar). The substrate for in vitro mismatch correction was constructed from molecules derived by subcloning a 211-bp PvuI/PstI fragment of the previously described HK7 M13 (27Varlet I. Radman M. Brooks P. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 7883-7887Crossref PubMed Scopus (61) Google Scholar) into the pBK-CMV phagemid (Stratagene). The inserted region contained the heteroduplex cassette sequence that can be used to generate specific mismatches within restriction endonuclease sites that are diagnostic for strand-specific mismatch correction. For the experiments described in this paper, C-containing viral strands were purified by standard techniques (28Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York1989Google Scholar). Closed circular duplexes that contained T in the complementary position were purified by banding on CsCl gradients. After ethanol precipitation, duplex circular DNA was linearized by digestion with NdeI. After phenol extraction and ethanol precipitation, linear DNA (150–250 μg) was mixed with a 2-fold excess of single-stranded DNA, and the mixture was adjusted to 50% formamide, 10 mm EDTA, pH 8.0, in a total volume of 2–3 ml. The mixture was dialyzed sequentially against 95% formamide, 10 mm EDTA, pH 8.0, for 2 h; 50% formamide, 200 mm Tris-HCl, 10 mm EDTA, pH 8.0, for 2 h; 100 mm Tris-HCl, pH 7.5, 100 mm NaCl, 10 mm EDTA for 2 h; and finally against 10 mmTris-HCl, 1 mm EDTA, pH 7.5, for 2 h. Nicked circular molecules were purified by agarose gel electrophoresis and electroelution. The purified 4470-bp molecules contain a unique CT mispair that inactivates an MluI restriction site. The mispaired T is 580-bp 5′ of a single nick (see Fig. 1). Small amounts of reannealed matched linear molecules were present in all preparations. These and their MluI digestion products could be easily resolved from the diagnostic products and did not detectably affect the correction assay. Cell extracts were prepared from 1–5 × 109 cells as described previously (24Karran P. Macpherson P. Ceccotti S. Dogliotti E. Griffin S. Bignami M. J. Biol. Chem. 1993; 268: 15878-15886Abstract Full Text PDF PubMed Google Scholar). Mismatch correction was assayed in 25 μl of 30 mmHepes-KOH, pH 8.0, 7 mm MgCl2, 0.5 mm dithiothreitol, 0.1 mm each dNTP, 4 mm ATP, 40 mm phosphocreatine, 1 μg of creatine phosphokinase (rabbit muscle-type I), 90 ng of DNA substrate, and up to 200 μg of cell extract. Mixtures were incubated for 60 min, and the reaction was terminated by the addition of 10 mmEDTA, 0.5% SDS. Samples were freed of protein by proteinase K digestion (1 mg/ml, 15 min) followed by phenol extraction. DNA was ethanol-precipitated, dissolved in buffer, and digested withMluI, which is diagnostic for removal of the mismatch. Digestion products were separated on 0.8% agarose gels in 40 mm Tris-acetate, pH 8.0, 1 mm EDTA buffer containing ethidium bromide and visualized under short wavelength ultraviolet light. The mismatched substrate is shown schematically in Fig. 1. An MluI site is located at position 463, and digestion of the uncorrected substrate generated unit-length linear 4470-bp molecules. Digestion of molecules that have undergone nick-directed correction (TC to GC) to generate the second MluI site produces two fragments of 3.9 kbp and 567 bp (see Fig. 4, fragments A and D). Digestion of the small amount of contaminating matched linear molecules generated during the annealing reaction produces traces of fragments of 3.3 and 1.17 kbp (see Fig. 4, fragments B and C) that are resolved from the products of mismatch correction. Thus, digestion withMluI of DNA recovered after incubation with repair-proficient cell extracts generated a mixture of unit-length linear molecules and fragments A–D. The smaller fragments (C and D) were not generally visible. In the products recovered from repair-defective extracts, only unit-length linear DNA was visible together with a small amount of fragmentB from contaminating linear molecules. Thus, the presence of fragment A (3.9 kbp) that is resolved from unit-length 4.47-kbp molecules, is diagnostic for mismatch correction. Cytoplasmic RNA was extracted from parental Raji cells and RajiF12 variant and used to generate hMSH2 cDNA using Moloney murine leukemia virus reverse transcriptase (New England Biolabs, Schwalbach/Taunus, Germany). PCR was used to amplify the hMSH2 cDNA in five overlapping fragments. The following primers, designed to introduce BamHI andEcoRI recognition sequences, were used: fragment 1, CGGGATCCCAACCAGGAGGTGAGGAGG and CGGAATTCCTGGCCATCAACTGCGGACAT; fragment 2, CGGGATCCAGATCTTCTTCTGGTTCGTC and CGGAATTCGCCAACAATAATTTCTGTG; fragment 3, CGGGATCCTGGATAAGAACAGAATAGAGG and CGGGATCCCCACAATGGACACTTCTGC; fragment 4, CGGGATCCCACCTGTTCCATATGTACG and CGGAATTCAAAATGGGTTGCAAACATGC; fragment 5, CGGGATCCGTGATAGTACTCATGGCCC and CGGAATTCGACAATAGCTTATCAATATTACC. The sequences of the primers used to amplify fragments 2, 3, 4, and 5 were taken from Ref. 29Leach F.S. Nicolaides N.C. Papadopoulos N. Liu B. Jen J. Parsons R. Peltomäki P. Sistonen P. Aaltonen L.A. Nyström-Lahti M. Guan X.-Y. Zhang J. Meltzer P.S. Yu J.-W. Kao F.-T. Chen D.J. Cerosaletti K.M. Fournier R.E.K. Todd S. Lewis T. Leach R.J. Naylor S.L. Weissenbach J. Mecklin J.-P. Järvinen H. Petersen G.M. Hamilton S.R. Green J. Jass J. Watson P. Lynch H.T. Trent J.M. de la Chapelle A. Kinzler K.W. Vogelstein B. Cell. 1993; 75: 1215-1225Abstract Full Text PDF PubMed Scopus (2105) Google Scholar. The PCR reactions were carried out in 100 μl of 10 mm Tris-HCl, pH 8.3, 50 mm KCl, 3 mm MgCl2, 250 μm each dNTP, 0.15 μm each primer, and 10 units/μl AmpliTaq DNA polymerase (Perkin-Elmer). 30 cycles of 93 °C for 1 min, 60 °C for 2 min, 72 °C for 3 min, followed by 1 cycle of 72 °C for 10 min were performed. Fragments were purified from agarose gels and ligated into M13mp18 or M13mp19 vectors (Life Technologies, Inc., Paisley, UK). After bacterial transformation, individual clones were sequenced using M13 sequencing primer. Exons 4, 7, 9, 11, and 14 were individually amplified by a two-step PCR procedure using nested primers (30Kolodner R.D. Hall N.R. Lipford J. Kane M.F. Rao M.R.S. Morrison P. Wirth L. Finan P.J. Burn J. Chapman P. Earabino C. Merchant E. Bishop D.T. Genomics. 1994; 24: 516-526Crossref PubMed Scopus (272) Google Scholar). First step amplifications were performed in 25 μl containing 75 ng of genomic DNA under the conditions described above. Two μl of the PCR products were used as templates in further rounds of amplification in 100-μl reaction volumes using biotinylated primers. In this case, the annealing step was carried out at 65 °C. Biotin-labeled single-stranded DNA was recovered by binding to magnetic beads (Dynabeads, Dynal A. S., Oslo, Norway) and sequenced. The cell extracts (50 μg) that were used in mismatch correction assays and prestained low molecular weight markers (Bio-Rad) were denatured and separated on 8% SDS-polyacrylamide gels. Proteins were transferred to nylon membranes (Zeta-Probe, Bio-Rad) using a semi-dry electrophoretic transfer apparatus (Trans-Blot, Bio-Rad) at room temperature. The membrane was blocked by immersion at room temperature for 1 h in TBS-Tween (10 mm Tris-HCl, pH 7.5, 150 mm NaCl, 0.05% Tween 80) containing 5% skimmed powdered milk. The blocked filter was incubated with purified mouse anti-hPMS2 (1 μg/ml), anti-hMLH1 (1 μg/ml), or hMSH2 (0.1 μg/ml) in TBS/Tween plus 3% bovine serum albumin for 1 h at room temperature. After washing several times with TBS-Tween, the appropriate horseradish peroxidase-conjugated secondary antibody diluted in TBS-Tween plus 3% bovine serum albumin was added for 30 min. After several washes with TBS-Tween, the filter was developed using the ECL detection kit (Amersham International). Membranes were stripped for reprobing by immersion in 2% SDS, 100 mm β-mercaptoethanol, 62.5 mm Tris-HCl, pH 6.8, for 30 min at 50 °C. Eighteen individual cultures of the Mex− Burkitt's lymphoma cell line Raji were treated with MNU. Nine cultures received a single treatment with 0.5 mmMNU that resulted in an estimated survival of 10−7. The remainder were treated with an initial dose of 0.01 mm; surviving cells were allowed to recover and were retreated with 0.02 mm MNU. This regime of repeated treatments was continued with escalating doses up to a maximum of 0.5 mm. Individual colonies were isolated from each treated culture by cloning in 96-well plates. To ensure independence, only one MNU-resistant clone from each culture was characterized. Fifteen clones were analyzed further. Fourteen clones exhibited an increase in MNU resistance of at least 30-fold as measured by the drug concentration required to arrest cell growth. Proliferation of the parental Raji cells was inhibited by treatment with 0.01 mm MNU (Fig.2). Following treatment, these sensitive cells underwent one cell division during the first 24 h, but thereafter there was no further increase in cell number. In contrast, clones isolated after acute or chronic MNU treatment withstood exposure to ≥0.3 mm MNU and continued to proliferate at rates closely similar to that of the untreated cells. Two examples are shown in Fig. 2. The extent of MNU resistance in the isolated clones was comparable to that previously reported for the methylation-tolerant RajiF12 cells (6Branch P. Aquilina G. Bignami M. Karran P. Nature. 1993; 362: 652-654Crossref PubMed Scopus (351) Google Scholar). The effect of higher MNU concentrations was not systematically evaluated for all of the clones, but some, for example Raji10, were resistant up to at least 1 mm MNU. In all, 14 of 15 clones, 8 from acute exposure and 6 from chronic exposure to escalating drug doses, exhibited resistance to 0.3 mm MNU. The clones isolated after acute treatment were given a single number designation: Raji 3, Raji 7, etc. Those derived by chronic exposure were numbered Raji 101, Raji 102, etc. One clone, Raji 107, was not significantly more resistant to MNU than Raji and was not characterized in detail, although it served as a control in some experiments. The RajiF12 cell line, isolated following chronic MNU treatment, has been described previously (6Branch P. Aquilina G. Bignami M. Karran P. Nature. 1993; 362: 652-654Crossref PubMed Scopus (351) Google Scholar). Resistance to the unrelated DNA cross-linking agent, mitomycin C, was not significantly increased (<2-fold) in any of the the MNU-resistant clones (data not shown). This indicates that the loss of MNU sensitivity in these cells is not a consequence of a generalized resistance to DNA damaging agents arising, for example, through loss of a common apoptosis pathway. We investigated MGMT expression, microsatellite stability, and spontaneous mutation at the HPRT locus in the resistant clones. These properties together with mismatch binding by cell extracts, were used to assign the resistant clones to five different but overlapping phenotypes. The ability to carry out mismatch correction and to process DNA O 6-meGua in vitro were also analyzed. The findings are summarized in TableI. Complementation with extracts prepared from colorectal carcinoma cells and Western blot analysis was used to define defective mismatch repair functions in the resistant clones.Table ISummary of properties of MNU-resistant clonesPhenotype12345Mex statusMex+ 1-aSignificant changes in phenotype are shown in bold type.Mex−Mex−Mex−Mex−(A) n repeatsStableUnstableUnstableStableStable(CA) n repeatsStableUnstableStableStableStableRelative HPRT mutation rate1-bHPRT mutation rates in Raji 10, Raji 102, Raji 103, RajiF12, and the parental Raji cell line were determined by fluctuation analysis. The remaining values are estimates based on mutation frequencies of populations maintained in continuous culture.×1×4×3–4×1×1Mismatch bindingProficientProficientProficient/DeficientDeficientProficientMismatch repairProficientDeficientDeficientDeficientProficient/DeficientRepresentative clonesRaji 101Raji 8Raji 3Raji 105Raji 10Raji 9Raji 103Raji 7Raji 106Raji 19Raji 102Raji 12RajiF12Raji 17Raji 1041-a Significant changes in phenotype are shown in bold type.1-b HPRT mutation rates in Raji 10, Raji 102, Raji 103, RajiF12, and the parental Raji cell line were determined by fluctuation analysis. The remaining values are estimates based on mutation frequencies of populations maintained in continuous culture. Open table in a new tab The TK−variant Raji cells are Mex− and cell extracts containing undetectable levels of MGMT (<0.05 units/mg of protein). In contrast, extracts of three of the resistant cell lines, Raji 101, Raji 105, and Raji 106, contained approximately 0.3 units of MGMT/mg of protein. The colorectal carcinoma cell line LoVo included for comparison was also Mex+ and expressed 0.7 units of MGMT/mg of protein. These values lie in the normal range for Mex+ cell lines, including the Mex+ Raji variant (TableII). The remaining clones isolated by the escalating dose regime and all of the clones derived by acute treatment did not contain detectable MGMT activity (Table II and data not shown). Raji 101 and Raji 106 did not exhibit microsatellite instability at either (A)n or (CA)n repeats (TableIII). The HPRT− mutation frequency in cultures of these three clones was comparable to that of the parental Raji cells, consistent with the absence of a mutator phenotype. Bandshift assays with cell extracts indicated that all were proficient in the recognition of a GT mismatch and a two-base loop in the standard substrates (Table I, data not shown; see Fig. 6). Extracts of Ra" @default.
• W2041829432 created "2016-06-24" @default.
• W2041829432 creator A5005929378 @default.
• W2041829432 creator A5024594871 @default.
• W2041829432 creator A5035270156 @default.
• W2041829432 creator A5060063715 @default.
• W2041829432 creator A5071649707 @default.
• W2041829432 date "1997-11-01" @default.
• W2041829432 modified "2023-09-29" @default.
• W2041829432 title "Mismatch Repair Defects andO 6-Methylguanine-DNA Methyltransferase Expression in Acquired Resistance to Methylating Agents in Human Cells" @default.
• W2041829432 cites W1482306189 @default.
• W2041829432 cites W1496112877 @default.
• W2041829432 cites W1589402586 @default.
• W2041829432 cites W1636514590 @default.
• W2041829432 cites W1966427133 @default.
• W2041829432 cites W1968348266 @default.
• W2041829432 cites W1970153568 @default.
• W2041829432 cites W1977284533 @default.
• W2041829432 cites W1977492313 @default.
• W2041829432 cites W1982640212 @default.
• W2041829432 cites W1983146922 @default.
• W2041829432 cites W1983811214 @default.
• W2041829432 cites W1984468061 @default.
• W2041829432 cites W1988786478 @default.
• W2041829432 cites W2001258296 @default.
• W2041829432 cites W2012867725 @default.
• W2041829432 cites W2019322535 @default.
• W2041829432 cites W2036182319 @default.
• W2041829432 cites W2048036054 @default.
• W2041829432 cites W2056493599 @default.
• W2041829432 cites W2064700784 @default.
• W2041829432 cites W2068285061 @default.
• W2041829432 cites W2080028600 @default.
• W2041829432 cites W2085315842 @default.
• W2041829432 cites W2085843470 @default.
• W2041829432 cites W2085896453 @default.
• W2041829432 cites W2086395211 @default.
• W2041829432 cites W2088703187 @default.
• W2041829432 cites W2092107251 @default.
• W2041829432 cites W2137075269 @default.
• W2041829432 cites W2139964075 @default.
• W2041829432 cites W2141798197 @default.
• W2041829432 cites W2147555368 @default.
• W2041829432 cites W2154181923 @default.
• W2041829432 cites W2412198229 @default.
• W2041829432 doi "https://doi.org/10.1074/jbc.272.45.28596" @default.
• W2041829432 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9353325" @default.
• W2041829432 hasPublicationYear "1997" @default.
• W2041829432 type Work @default.
• W2041829432 sameAs 2041829432 @default.
• W2041829432 citedByCount "63" @default.
• W2041829432 countsByYear W20418294322012 @default.
• W2041829432 countsByYear W20418294322013 @default.
• W2041829432 countsByYear W20418294322018 @default.
• W2041829432 countsByYear W20418294322020 @default.
• W2041829432 countsByYear W20418294322021 @default.
• W2041829432 countsByYear W20418294322022 @default.
• W2041829432 crossrefType "journal-article" @default.
• W2041829432 hasAuthorship W2041829432A5005929378 @default.
• W2041829432 hasAuthorship W2041829432A5024594871 @default.
• W2041829432 hasAuthorship W2041829432A5035270156 @default.
• W2041829432 hasAuthorship W2041829432A5060063715 @default.
• W2041829432 hasAuthorship W2041829432A5071649707 @default.
• W2041829432 hasBestOaLocation W20418294321 @default.
• W2041829432 hasConcept C134935766 @default.
• W2041829432 hasConcept C153911025 @default.
• W2041829432 hasConcept C185592680 @default.
• W2041829432 hasConcept C2779527866 @default.
• W2041829432 hasConcept C2779979206 @default.
• W2041829432 hasConcept C33288867 @default.
• W2041829432 hasConcept C54355233 @default.
• W2041829432 hasConcept C552990157 @default.
• W2041829432 hasConcept C60748783 @default.
• W2041829432 hasConcept C86803240 @default.
• W2041829432 hasConcept C91965660 @default.
• W2041829432 hasConceptScore W2041829432C134935766 @default.
• W2041829432 hasConceptScore W2041829432C153911025 @default.
• W2041829432 hasConceptScore W2041829432C185592680 @default.
• W2041829432 hasConceptScore W2041829432C2779527866 @default.
• W2041829432 hasConceptScore W2041829432C2779979206 @default.
• W2041829432 hasConceptScore W2041829432C33288867 @default.
• W2041829432 hasConceptScore W2041829432C54355233 @default.
• W2041829432 hasConceptScore W2041829432C552990157 @default.
• W2041829432 hasConceptScore W2041829432C60748783 @default.
• W2041829432 hasConceptScore W2041829432C86803240 @default.
• W2041829432 hasConceptScore W2041829432C91965660 @default.
• W2041829432 hasIssue "45" @default.
• W2041829432 hasLocation W20418294321 @default.
• W2041829432 hasOpenAccess W2041829432 @default.
• W2041829432 hasPrimaryLocation W20418294321 @default.
• W2041829432 hasRelatedWork W1518953191 @default.
• W2041829432 hasRelatedWork W1977554742 @default.
• W2041829432 hasRelatedWork W1981078074 @default.
• W2041829432 hasRelatedWork W2007399975 @default.
• W2041829432 hasRelatedWork W2041829432 @default.
• W2041829432 hasRelatedWork W2071191831 @default.
• W2041829432 hasRelatedWork W2142264345 @default.
• W2041829432 hasRelatedWork W2154212874 @default.

• next