FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2042923118> ?p ?o ?g. }

• W2042923118 endingPage "16918" @default.
• W2042923118 startingPage "16911" @default.
• W2042923118 abstract "Macrophage inhibitory cytokine-1 (MIC-1) is a divergent member of the transforming growth factor-β (TGF-β) superfamily. While it is synthesized in a pre-pro form, it is unique among superfamily members because it does not require its propeptide for correct folding or secretion of the mature peptide. To investigate factors that enable these propeptide independent events to occur, we constructed MIC-1/TGF-β1 chimeras, both with and without a propeptide. All chimeras without a propeptide secreted less efficiently compared with the corresponding constructs with propeptide. Folding and secretion were most affected after replacement of the predicted major α-helix in the mature protein, residues 56–68. Exchanging the human propeptide in this chimera with either the murine MIC-1 or TGF-β1 propeptide resulted in secretion of the unprocessed, monomeric chimera, suggesting a specific interaction between the human MIC-1 propeptide and mature peptide. Propeptide deletion mutants enabled identification of a region between residues 56 and 78, which is important for the interaction between the propeptide and the mature peptide. Cotransfection experiments demonstrated that the propeptide must be incis with the mature peptide for this phenomenon to occur. These results suggest a model for TGF-β superfamily protein folding. Macrophage inhibitory cytokine-1 (MIC-1) is a divergent member of the transforming growth factor-β (TGF-β) superfamily. While it is synthesized in a pre-pro form, it is unique among superfamily members because it does not require its propeptide for correct folding or secretion of the mature peptide. To investigate factors that enable these propeptide independent events to occur, we constructed MIC-1/TGF-β1 chimeras, both with and without a propeptide. All chimeras without a propeptide secreted less efficiently compared with the corresponding constructs with propeptide. Folding and secretion were most affected after replacement of the predicted major α-helix in the mature protein, residues 56–68. Exchanging the human propeptide in this chimera with either the murine MIC-1 or TGF-β1 propeptide resulted in secretion of the unprocessed, monomeric chimera, suggesting a specific interaction between the human MIC-1 propeptide and mature peptide. Propeptide deletion mutants enabled identification of a region between residues 56 and 78, which is important for the interaction between the propeptide and the mature peptide. Cotransfection experiments demonstrated that the propeptide must be incis with the mature peptide for this phenomenon to occur. These results suggest a model for TGF-β superfamily protein folding. macrophage inhibitory cytokine-1 transforming growth factor-β Chinese hamster ovary polyacrylamide gel electrophoresis Macrophage inhibitory cytokine-1 (MIC-1)1 is the first member of a divergent group within the transforming growth factor-β (TGF-β) superfamily (1Bootcov M.R. Bauskin A.R. Valenzuela S.M. Moore A.G. Bansal M. He X.Y. Zhang H.P. Donnellan M. Mahler S. Pryor K. Walsh B.J. Nicholson R.C. Fairlie W.D. Por S.B. Robbins J.M. Breit S.N. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 11514-11519Crossref PubMed Scopus (860) Google Scholar, 2Fairlie W.D. Moore A.G. Bauskin A.R. Russell P.K. Zhang H.P. Breit S.N. J. Leukocyte Biol. 1999; 65: 2-5Crossref PubMed Scopus (198) Google Scholar). It has also been reported as placental transforming growth factor-β (3Lawton L.N. Bonaldo M.F. Jelenc P.C. Qiu L. Baumes S.A. Marcelino R.A. de Jesus G.M. Wellington S. Knowles J.A. Warburton D. Brown S. Soares M.B. Gene ( Amst. ). 1997; 203: 17-26Crossref PubMed Scopus (150) Google Scholar), prostate-derived factor (4Paralkar V.M. Vail A.L. Grasser W.A. Brown T.A. Xu H. Vukicevic S. Ke H.Z. Qi H. Owen T.A. Thompson D.D. J. Biol. Chem. 1998; 273: 13760-13767Abstract Full Text Full Text PDF PubMed Scopus (249) Google Scholar), growth/differentiation factor 15/MIC-1 (5Bottner M. Suter-Crazzolara C. Schober A. Unsicker K. Cell Tissue Res. 1999; 297: 103-110Crossref PubMed Scopus (142) Google Scholar), and as a placental bone morphogenetic protein (6Hromas R. Hufford M. Sutton J. Xu D. Li Y. Lu L. Biochim. Biophys. Acta. 1997; 1354: 40-44Crossref PubMed Scopus (192) Google Scholar). The major function of the protein is still uncertain although it has been variously described as being able to inhibit tumor necrosis factor-α production from lipopolysaccharide-stimulated macrophages (1Bootcov M.R. Bauskin A.R. Valenzuela S.M. Moore A.G. Bansal M. He X.Y. Zhang H.P. Donnellan M. Mahler S. Pryor K. Walsh B.J. Nicholson R.C. Fairlie W.D. Por S.B. Robbins J.M. Breit S.N. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 11514-11519Crossref PubMed Scopus (860) Google Scholar), to induce cartilage formation and the early stages of endochonadal bone formation (4Paralkar V.M. Vail A.L. Grasser W.A. Brown T.A. Xu H. Vukicevic S. Ke H.Z. Qi H. Owen T.A. Thompson D.D. J. Biol. Chem. 1998; 273: 13760-13767Abstract Full Text Full Text PDF PubMed Scopus (249) Google Scholar), and to inhibit proliferation of primitive hemopoietic progenitors (6Hromas R. Hufford M. Sutton J. Xu D. Li Y. Lu L. Biochim. Biophys. Acta. 1997; 1354: 40-44Crossref PubMed Scopus (192) Google Scholar). The very high level of MIC-1 mRNA in the human placenta, relative to other tissues (2Fairlie W.D. Moore A.G. Bauskin A.R. Russell P.K. Zhang H.P. Breit S.N. J. Leukocyte Biol. 1999; 65: 2-5Crossref PubMed Scopus (198) Google Scholar, 4Paralkar V.M. Vail A.L. Grasser W.A. Brown T.A. Xu H. Vukicevic S. Ke H.Z. Qi H. Owen T.A. Thompson D.D. J. Biol. Chem. 1998; 273: 13760-13767Abstract Full Text Full Text PDF PubMed Scopus (249) Google Scholar, 6Hromas R. Hufford M. Sutton J. Xu D. Li Y. Lu L. Biochim. Biophys. Acta. 1997; 1354: 40-44Crossref PubMed Scopus (192) Google Scholar, 7Yokoyama-Kobayashi M. Saeki M. Sekine S. Kato S. J. Biochem. ( Tokyo ). 1997; 122: 622-626Crossref PubMed Scopus (95) Google Scholar, 8Moore A.G. Brown D.A. Fairlie W.D. Bauskin A.R. Brown P.K. Munier M.L.C. Russell P.K. Salmonsen L.A. Wallace E.M. Breit S.N. J. Clin. Endrinol. Metab. 2000; 85: 4781-4789Crossref PubMed Scopus (145) Google Scholar), also suggests a role in embryo implantation and placental function. Further, markedly elevated serum levels of MIC-1 occur during pregnancy, suggesting a more generalized function in this process (8Moore A.G. Brown D.A. Fairlie W.D. Bauskin A.R. Brown P.K. Munier M.L.C. Russell P.K. Salmonsen L.A. Wallace E.M. Breit S.N. J. Clin. Endrinol. Metab. 2000; 85: 4781-4789Crossref PubMed Scopus (145) Google Scholar). Finally, a number of recent reports have demonstrated that the MIC-1 promoter region is a target for the p53 tumor suppressor gene product (9Li P.-X. Wong J. Ayed A. Duc N. Brade A.M. Arrowsmith C. Austin R.C. Klamutt H.J. J. Biol. Chem. 2000; 275: 20127-20135Abstract Full Text Full Text PDF PubMed Scopus (232) Google Scholar, 10Tan M. Wang Y. Guan K. Sun Y. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 109-114Crossref PubMed Scopus (227) Google Scholar, 11Kannan K. Amariglio N. Rechavi G. Givol D. FEBS Lett. 2000; 470: 77-82Crossref PubMed Scopus (86) Google Scholar) and that recombinant MIC-1 can suppress tumor cell growth in a number of cell line lines including human breast cancer cells (9Li P.-X. Wong J. Ayed A. Duc N. Brade A.M. Arrowsmith C. Austin R.C. Klamutt H.J. J. Biol. Chem. 2000; 275: 20127-20135Abstract Full Text Full Text PDF PubMed Scopus (232) Google Scholar). This last effect was a result of induction by MIC-1 of both G1 cell cycle arrest and apoptosis in breast tumor cells. The MIC-1 protein is synthesized as a 308-amino acid polypeptide that encompasses a 29-amino acid signal peptide, a 167-amino acid propeptide, and a 112-amino acid mature region. The mature protein is secreted as a disulfide-linked homodimer of 112 amino acids which is released from the propeptide after intracellular cleavage at a typical RXXR furin-like cleavage site (1Bootcov M.R. Bauskin A.R. Valenzuela S.M. Moore A.G. Bansal M. He X.Y. Zhang H.P. Donnellan M. Mahler S. Pryor K. Walsh B.J. Nicholson R.C. Fairlie W.D. Por S.B. Robbins J.M. Breit S.N. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 11514-11519Crossref PubMed Scopus (860) Google Scholar). Importantly, unlike all other TGF-β superfamily members studied to date, the MIC-1 mature peptide can be correctly folded and secreted without a propeptide (12Bauskin A.R. Zhang H.-P. Fairlie W.D. Russell P.K. Moore A.G. Brown D.A. Stanley K.K. Breit S.N. EMBO J. 2000; 19: 2212-2220Crossref PubMed Scopus (96) Google Scholar,13Fairlie W.D. Zhang H.-P. Brown P.K. Russell P.K. Bauskin A.R. Breit S.N. Gene ( Amst. ). 2000; 254: 67-76Crossref PubMed Scopus (29) Google Scholar). This unique property of MIC-1 makes it a particularly suitable molecule for the study of the factors that influence TGF-β superfamily protein folding. In the case of TGF-β1, activin A, Müllerian inhibitory substance, and bone morphogenetic protein-2, the propeptide region is known to be essential for the correct folding and secretion of the mature peptide (14Wilson C.A. di Clemente N. Ehrenfels C. Pepinsky R.B. Josso N. Vigier B. Cate R.L. Mol. Endocrinol. 1993; 7: 247-257Crossref PubMed Scopus (72) Google Scholar, 15Israel D.I. Nove J. Kerns K.M. Moutsatsos I.K. Kaufman R.J. Growth Factors. 1992; 7: 139-150Crossref PubMed Scopus (162) Google Scholar, 16Gray A.M. Mason A.J. Science. 1990; 247: 1328-1330Crossref PubMed Scopus (219) Google Scholar). For example, no TGF-β1 or activin A mature peptides were detected in the supernatants from cells transfected with constructs with an in-frame deletion of their propeptides, and analysis of the cell lysates indicated that the activin A had formed large intracellular disulfide-linked aggregates (16Gray A.M. Mason A.J. Science. 1990; 247: 1328-1330Crossref PubMed Scopus (219) Google Scholar). To date, most of the studies that have examined the folding of TGF-β superfamily proteins have concentrated on the role of the propeptide. Sha et al. (17Sha X. Yang L. Gentry L.E. J. Cell Biol. 1991; 114: 827-839Crossref PubMed Scopus (59) Google Scholar) used deletion and insertion mutagenesis to identify regions of the propeptide important for secretion of biologically active mature TGF-β1 and determined that amino acids between residues 50 and 80 interact with the mature peptide in the latent complex form of TGF-β1. Elimination of all glycosylation sites on the TGF-β1 and -β2 propeptide prevents secretion of any mature protein (18Brunner A.M. Lioubin M.N. Marquardt H. Malacko A.R. Wang W.C. Shapiro R.A. Neubauer M. Cook J. Madisen L. Purchio A.F. Mol. Endocrinol. 1992; 6: 1691-1700Crossref PubMed Scopus (50) Google Scholar, 19Lopez A.R. Cook J. Deininger P.L. Derynck R. Mol. Cell. Biol. 1992; 12: 1674-1679Crossref PubMed Google Scholar), and mutation of the TGF-β1 propeptide cysteine residues results in the secretion of differently assembled and processed forms (20Brunner A.M. Marquardt H. Malacko A.R. Lioubin M.N. Purchio A.F. J. Biol. Chem. 1989; 264: 13660-13664Abstract Full Text PDF PubMed Google Scholar). In addition, it has been shown that the Müllerian inhibitory substance propeptide helps to maintain the conformation of the Müllerian inhibitory substance mature peptide after secretion by preventing aggregation (14Wilson C.A. di Clemente N. Ehrenfels C. Pepinsky R.B. Josso N. Vigier B. Cate R.L. Mol. Endocrinol. 1993; 7: 247-257Crossref PubMed Scopus (72) Google Scholar). Only limited studies have focused on the mature peptide region, where the role of the cysteine residues has been examined for TGF-β1 and activin A, and all were found to be essential for the secretion of a fully bioactive mature protein (18Brunner A.M. Lioubin M.N. Marquardt H. Malacko A.R. Wang W.C. Shapiro R.A. Neubauer M. Cook J. Madisen L. Purchio A.F. Mol. Endocrinol. 1992; 6: 1691-1700Crossref PubMed Scopus (50) Google Scholar, 21Mason A.J. Mol. Endocrinol. 1994; 8: 325-332PubMed Google Scholar, 22Amatayakul-Chantler S. Qian S.W. Gakenheimer K. Bottinger E.P. Roberts A.B. Sporn M.B. J. Biol. Chem. 1994; 269: 27687-27691Abstract Full Text PDF PubMed Google Scholar). No detailed studies on MIC-1 folding have yet been published, although recently we reported that the propeptide has a role in the intracellular quality control of MIC-1 secretion by targeting monomeric precursor forms in the endoplasmic reticulum to the proteasome for degradation (12Bauskin A.R. Zhang H.-P. Fairlie W.D. Russell P.K. Moore A.G. Brown D.A. Stanley K.K. Breit S.N. EMBO J. 2000; 19: 2212-2220Crossref PubMed Scopus (96) Google Scholar). In the current paper we have addressed a number of aspects of folding and secretion of MIC-1. In particular we have determined sequence regions of the mature peptide which enable it to fold and be secreted in the absence of the propeptide. We have also identified a region of the MIC-1 propeptide which can assist in protein folding/secretion. Chinese hamster ovary cells (CHO-K1) were maintained as recommended by the American Type Culture Collection in Dulbecco's modified Eagle's medium/F-12 medium supplemented with 5% fetal bovine serum. For collection of conditioned medium for immunoprecipitation and Western blotting experiments, transfected cells were cultured in the absence of fetal bovine serum (see below). Anti-FLAG M2 antibody coupled to agarose used in immunoprecipitations was purchased from Sigma. Polyclonal antisera to MIC-1 (PAb 233) was raised by immunization of sheep with purified recombinant human MIC-1 mature protein (13Fairlie W.D. Zhang H.-P. Brown P.K. Russell P.K. Bauskin A.R. Breit S.N. Gene ( Amst. ). 2000; 254: 67-76Crossref PubMed Scopus (29) Google Scholar). The preparation of the base FLAG-tagged, full-length “long” construct (i.e.MIC-1 leader + propeptide + MIC-1 mature peptide; see Fig.1, constructs A1–A3) and “short” mature peptide only construct (FSH leader sequence + MIC-1 mature peptide; Fig. 1, constructs F1–F3) has been described previously (1Bootcov M.R. Bauskin A.R. Valenzuela S.M. Moore A.G. Bansal M. He X.Y. Zhang H.P. Donnellan M. Mahler S. Pryor K. Walsh B.J. Nicholson R.C. Fairlie W.D. Por S.B. Robbins J.M. Breit S.N. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 11514-11519Crossref PubMed Scopus (860) Google Scholar). The FLAG epitope was engineered onto the amino terminus of the mature peptide of all constructs (i.e. inserted immediately after the furin-like cleavage sequence of propeptide region; see Fig. 1) to facilitate immumoprecipitation of the secreted proteins. The relevant constructs were cloned into the pOCUS-2 vector (Novagen) for the construction of the chimeras and other mutants, and the pIRES2-EGFP vector (CLONTECH) was used for transfection into CHO cells. Both the long and short constructs described previously were amplified by polymerase chain reaction and either Pfu DNA polymerase (Promega) or Vent DNA polymerase (New England Biolabs) with the oligonucleotide primers 1 and 2 (for all primer sequences, see TableI), which added an XhoI andSacII + BglII sites onto their 5′- and 3′-ends, respectively, for insertion into the pOCUS-2 vector (at theXhoI and BglII sites) or pIRES2-EGFP (at theXhoI and SacII sites). The various mutant/chimeric constructs were made using a whole plasmid polymerase chain reaction technique described previously (23Fairlie W.D. Russell P.K. Wu W.M. Moore A.G. Zhang H.-P. Brown P.K. Bauskin A.R. Breit S.N. Biochemistry. 2001; 40: 65-73Crossref PubMed Scopus (30) Google Scholar). The primers for the site 1, 2, and 3 chimeras have also been described previously (23Fairlie W.D. Russell P.K. Wu W.M. Moore A.G. Zhang H.-P. Brown P.K. Bauskin A.R. Breit S.N. Biochemistry. 2001; 40: 65-73Crossref PubMed Scopus (30) Google Scholar). For the propeptide deletion mutants (Fig. 1, constructs B–E), a single common reverse primer was used (primer 3) which corresponded to the 3′-end of the MIC-1 signal-peptide sequence, and the forward primers (primer 4, deletion 1–28; primer 5, deletion 1–78; primer 6, deletion 1–41; primer 7, deletion 1–55) were positioned so that the 5′-end started at the first base of the codon for the amino acid following the region of the propeptide to be deleted. The glycosylation mutant in which pro-Asn41 (asparagine residue 41 of the propeptide) was changed to a serine (Fig. 1, constructs I) mutant employed primers 8 and 9.Table IOligonucleotide sequences for primers used in polymerase chain reactions for the creation of the various constructsPrimer no.Primer sequence1AAT CTCGAGGATATCATGCCCGGGCAAGAACTCAG (F)2ACGAT AGATCTCCGCGGTCATATGCAGTGGCAGTC (R)3GGCGCCCCCATGCGGCAGCCACG (R)4AAACGCTACGAGGACCTGCTAACC (F)5GCCGCCCTTCCCGAGGGGCTC (F)6CAGAGCTGGGAAGATTCGAACACCG (F)7GCAGTCCGGATACTCACGCCAGAAGTGC (F)8GCCAGAGCTGGGAAGATTCGAACACCGAC (F)9TGGCCCGCAGCCTGGTTAGCAGGTCCTCG (R)10AATATA CTCGAGATGCCGCCCTCCGGGCTGCGGCTG (F)11ATAATA GAATTCTCGGCGGTGCCGGGAGCTTTGC (R)The (F) or (R) after each sequence indicates whether the primer used is a forward or reverse primer, respectively. Underlined bases indicate the restriction sites added as described under “Experimental Procedures.” Italicized letters represent additional sequences added to the primer ensure efficient restriction enzyme digestion. The bold lettering indicates bases encoding TGF-β1 sequences added in the construction of chimeras or the base pair change used in the construction of the glycosylation mutant. Open table in a new tab The (F) or (R) after each sequence indicates whether the primer used is a forward or reverse primer, respectively. Underlined bases indicate the restriction sites added as described under “Experimental Procedures.” Italicized letters represent additional sequences added to the primer ensure efficient restriction enzyme digestion. The bold lettering indicates bases encoding TGF-β1 sequences added in the construction of chimeras or the base pair change used in the construction of the glycosylation mutant. Plasmid DNA derived from individual colonies was sequenced bidirectionally to confirm whether the correct construct had been created. For all of the constructs involving changes to the mature peptide region, the BssHII/SacII fragment from the long, short, or both constructs in the pIRES2-EGFP vector was replaced with the same fragment from the mutated construct in the pOCUS-2 vector. For the propeptide deletion constructs, theXhoI/EcoRI fragment of the pIRES2-EGFP long construct was replaced with same fragment derived from the mutants in the pOCUS-2 vector. To create the constructs with the simian TGF-β1 propeptide fused to the MIC-1 mature (Fig. 1, construct H), the sim-TGF-β1 propeptide was amplified with primers 10 and 11, which added XhoI andEcoRI restriction enzyme sites to the 5′- and 3′-ends, respectively. The template for this construct was sim-TGF-β1 with the codons for Cys-223 and Cys-225 mutated to serine codons and was kindly provided by Ignacio Anegon (20Brunner A.M. Marquardt H. Malacko A.R. Lioubin M.N. Purchio A.F. J. Biol. Chem. 1989; 264: 13660-13664Abstract Full Text PDF PubMed Google Scholar). The XhoI/EcoRI fragments from the long pIRES2-EGFP construct as well as the site 2 chimera cloned into the pIRES2-EGFP vector were then replaced with the digested, amplified sim-TGF-β1 propeptide. The murine MIC-1 propeptide was added to the wild type or site 2 chimeric human MIC-1 following replacement of the Xho/EcoRI fragment with the corresponding fragment of the long murine construct (Fig. 1, construct G). Transient transfections were performed in CHO-K1 cells grown in six-well plates to 60–80% confluence. Plasmid DNA (1 μg), purified using a Qiaprep Spin purification kit (Qiagen), was mixed with 9 μl of LipofectAMINE (Life Technologies, Inc.) for 15–30 min at room temperature and then added to cells in a total volume of 1 ml of serum-free Dulbecco's modified Eagle's medium/F-12 medium. After overnight incubation at 37 °C, the cells were washed with Dulbecco's modified Eagle's medium/F-12 medium containing 5% fetal bovine serum and incubated for 6 h at 37 °C in the same medium. Cells were washed with serum-free medium then maintained in 1 ml of the same medium for a further 48 h before collection for immunoprecipitation and Western blot analysis. For the experiment to determine whether propeptide could act both incis and in trans, mutant and wild type constructs were transfected, as above, into a CHO-K1 cell line previously stably transfected with the human MIC-1 propeptide alone (12Bauskin A.R. Zhang H.-P. Fairlie W.D. Russell P.K. Moore A.G. Brown D.A. Stanley K.K. Breit S.N. EMBO J. 2000; 19: 2212-2220Crossref PubMed Scopus (96) Google Scholar). Transfection efficiency was monitored using a fluorescent microscope that could detect the enhanced green fluorescent protein, a product of the pIRES2-EGFP vector, and was routinely in the order of 60–80%. Comparison between supernatants was only made from wells in which the cells were transfected to approximately the same degree. Conditioned medium was collected, and the cells were washed with ice-cold phosphate-buffered saline and then lysed. To perform lysis, cells were scraped off the wells in the presence of 0.5 ml of 50 mm Hepes, pH 7.0, containing 1% Triton X-100, 1 mm EDTA, and a protease inhibitor mixture (Roche Molecular Biochemicals), and then incubated on ice for 30 min. The lysate was collected after centrifugation at 4 °C, then either immunoprecipitated with anti-FLAG coupled to agarose, as described below, or 50 μl was analyzed directly by SDS-PAGE, performed under reducing conditions, and Western blotting. Immunoprecipitation of the FLAG-tagged proteins in the conditioned medium or cell lysates was performed by adding 10 μl of anti-FLAG antibody coupled to agarose and then incubating overnight at 4 °C. The bound proteins were then washed three times with phosphate-buffered saline, or in the case of the lysates with the lysis buffer itself, and eluted by heating at 95 °C in SDS-PAGE (nonreducing or reducing) sample buffer. Western blot analysis was performed essentially as described previously (1Bootcov M.R. Bauskin A.R. Valenzuela S.M. Moore A.G. Bansal M. He X.Y. Zhang H.P. Donnellan M. Mahler S. Pryor K. Walsh B.J. Nicholson R.C. Fairlie W.D. Por S.B. Robbins J.M. Breit S.N. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 11514-11519Crossref PubMed Scopus (860) Google Scholar). Membranes were probed with either sheep anti-MIC-1 polyclonal antiserum 233 (diluted 1:7,000) or anti-FLAG monoclonal antibody followed by either biotinylated anti-sheep (1:1,000) (Sigma) or anti-mouse antiserum (1:1,000) (Amersham Pharmacia Biotech), respectively. Blots were then visualized on film after treatment with strepavidin-horseradish peroxidase conjugate (Amersham Pharmacia Biotech) and chemiluminescence reagents (PerkinElmer Life Sciences). The three-dimensional structures of the three mammalian TGF-β isoforms as well as bone morphogenetic proteins-2 and -7 and glial cell line-derived neurotrophic factor have all been solved (24Griffith D.L. Keck P.C. Sampath T.K. Rueger D.C. Carlson W.D. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 878-883Crossref PubMed Scopus (246) Google Scholar, 25Daopin S. Piez K.A. Ogawa Y. Davies D.R. Science. 1992; 257: 369-373Crossref PubMed Scopus (374) Google Scholar, 26Hinck A.P. Archer S.J. Qian S.W. Roberts A.B. Sporn M.B. Weatherbee J.A. Tsang M.L. Lucas R. Zhang B.L. Wenker J. Torchia D.A. Biochemistry. 1996; 35: 8517-8534Crossref PubMed Scopus (151) Google Scholar, 27Mittl P.R. Priestle J.P. Cox D.A. McMaster G. Cerletti N. Grutter M.G. Protein Sci. 1996; 5: 1261-1271Crossref PubMed Scopus (128) Google Scholar, 28Scheufler C. Sebald W. Hulsmeyer M. J. Mol. Biol. 1999; 287: 103-115Crossref PubMed Scopus (292) Google Scholar, 29Eigenbrot C. Gerber N. Nat. Struct. Biol. 1997; 4: 435-438Crossref PubMed Scopus (104) Google Scholar). Comparison of these structures indicates that they are very similar in the overall fold of the subunits for each family member despite low amino acid sequence homology between family groups (26% between human TGF-β1 and human bone morphogenetic protein-7 and 12% between human TGF-β1 and human glial cell line-derived neurotrophic factor). This similarity suggested that it may be possible to construct chimeric molecules in which sequence regions of one family member are exchanged with the corresponding region of another family member. A similar approach has been used for the identification of TGF-β1 and TGF-β2 receptor binding regions where chimeric molecules involving both isoforms proved to be useful (30Burmester J.K. Qian S.W. Ohlsen D. Phan S. Sporn M.B. Roberts A.B. Growth Factors. 1998; 15: 231-242Crossref PubMed Scopus (22) Google Scholar, 31Burmester J.K. Qian S.W. Roberts A.B. Huang A. Amatayakul-Chantler S. Suardet L. Odartchenko N. Madri J.A. Sporn M.B. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 8628-8632Crossref PubMed Scopus (37) Google Scholar). We therefore made a series of constructs in which three distinct sequence regions of the mature protein of MIC-1 were replaced with the corresponding regions of TGF-β1. The three regions of MIC-1 selected were: residues 24–37 (site 1) which corresponds to part of the extended loop region also referred to as “finger 1” in TGF-β1; residues 56–68 (site 2), corresponding to the major α-helix (also called the “heel” region) in TGF-β1; and residues 90–98 (site 3), which encompasses a type II′ β-turn and corresponds to the tip of “finger 2” of TGF-β1 (for the structural location each region see Fig.2 a; for sequences, see Fig.2 b). Additional constructs were also made in which the propeptide region was either deleted or replaced with the murine MIC-1 or sim-TGF-β1 propeptide. To determine whether each of the sequence substitutions described above would be tolerated and result in the secretion of a correctly processed dimeric molecule, the three MIC-1/TGF-β1 chimeric constructs with associated MIC-1 propeptide (see Fig. 1, constructs A1–A3) were transfected into CHO-K1 cells. Supernatants were collected and immunoprecipitated with anti-FLAG-coupled agarose and analyzed by Western blotting. Bands of the correct apparent molecular mass (30 kDa) for dimeric, FLAG-tagged MIC-1 were observed for each construct (Fig. 3, a–d,lanes 1), indicating that the mature protein was correctly assembled, processed, and secreted. Furthermore, the level of secretion of the chimeras was similar to that of the wild type mature peptide. No similar bands were observed in the immunoprecipitated supernatant from cells transfected with the vector only (Fig. 3 d, lane 3). Various additional higher molecular mass bands observed inlane 1 at ∼33, 40, and 50 kDa correspond to aberrantly or differentially processed forms of MIC-1 which have been characterized previously (12Bauskin A.R. Zhang H.-P. Fairlie W.D. Russell P.K. Moore A.G. Brown D.A. Stanley K.K. Breit S.N. EMBO J. 2000; 19: 2212-2220Crossref PubMed Scopus (96) Google Scholar). As indicated previously, MIC-1 is unique among the TGF-β superfamily members studied to date in that it can be secreted from a construct in which the propeptide is deleted. To identify sequence regions of the mature MIC-1 protein which enable it to fold correctly without association or interaction with its propeptide, the three chimeras were expressed using constructs in which the propeptide had been deleted (Fig. 1, constructs F1–F3). An FSH leader sequence was fused to these proteins to enable secretion. This adds three extra amino acids to each subunit resulting in slower migration of the expressed proteins on SDS-PAGE compared with those expressed from the full-length constructs. Bands corresponding to the molecular mass of dimeric MIC-1 were observed for both the wild type MIC-1 and the site 1 and site 3 replacements (Fig. 3, a, b, and d,lanes 2) following immunoprecipitation and immunoblotting of the supernatants from CHO cells transfected with these constructs. This indicates that these proteins were correctly assembled and secreted despite the deletion of the propeptide. However, the level of secretion of the site 1 and site 3 chimeras was consistently less than the corresponding constructs with a propeptide. In the case of the site 2 replacement, no measurable protein was secreted from the expressed construct without propeptide (Fig. 3 c, lane 2), demonstrating that this protein cannot be folded and/or secreted without the presence of the propeptide. Analysis of the cell lysates for all truncated constructs demonstrated that the mutant proteins were synthesized at approximately the same level (Fig. 3, lower panel), confirming that the markedly lower level of protein observed in the supernatant for the site 2 chimera in the absence of its propeptide is caused by its inefficient folding/secretion. These combined results therefore suggest that the MIC-1 propeptide, although not essential, can assist in folding/secretion. Furthermore, it appears that the site 2 (α-helix) sequence is one region of MIC-1 which enables it to be secreted in the absence of the propeptide. The carbohydrate moieties on the propeptide of the TGF-β1 and -β2 propeptides are important for the secretion of biologically active TGF-β mature peptides. Glycosylation of the MIC-1 propeptide occurs at a singleN-linked glycosylation site at residue pro-Asn41(residue asparagine 41 of the propeptide) (12Bauskin A.R. Zhang H.-P. Fairlie W.D. Russell P.K. Moore A.G. Brown D.A. Stanley K.K. Breit S.N. EMBO J. 2000; 19: 2212-2220Crossref PubMed Scopus (96) Google Scholar). Therefore, it was of interest to determine whether the carbohydrate moiety played a role in MIC-1 folding and secretion and in particular to determine whether it was essential for secretion of the site 2 MIC-1/TGF-β chimera. To achieve this, pro-Asn41 of the propeptide was mutated to a serine residue on constructs with both the wild type and site 2 chimeric mature pep" @default.
• W2042923118 created "2016-06-24" @default.
• W2042923118 creator A5004093180 @default.
• W2042923118 creator A5015141748 @default.
• W2042923118 creator A5024669876 @default.
• W2042923118 creator A5039971164 @default.
• W2042923118 creator A5070606019 @default.
• W2042923118 creator A5071699478 @default.
• W2042923118 creator A5072390223 @default.
• W2042923118 creator A5075108697 @default.
• W2042923118 date "2001-05-01" @default.
• W2042923118 modified "2023-10-12" @default.
• W2042923118 title "The Propeptide of the Transforming Growth Factor-β Superfamily Member, Macrophage Inhibitory Cytokine-1 (MIC-1), Is a Multifunctional Domain That Can Facilitate Protein Folding and Secretion" @default.
• W2042923118 cites W1520988136 @default.
• W2042923118 cites W1660181653 @default.
• W2042923118 cites W1966630310 @default.
• W2042923118 cites W1975171278 @default.
• W2042923118 cites W1977476182 @default.
• W2042923118 cites W1989468717 @default.
• W2042923118 cites W1996115734 @default.
• W2042923118 cites W1999375905 @default.
• W2042923118 cites W2001183029 @default.
• W2042923118 cites W2014629059 @default.
• W2042923118 cites W2026974388 @default.
• W2042923118 cites W2034248800 @default.
• W2042923118 cites W2044440492 @default.
• W2042923118 cites W2053042661 @default.
• W2042923118 cites W2060165686 @default.
• W2042923118 cites W2061851918 @default.
• W2042923118 cites W2065858724 @default.
• W2042923118 cites W2071997480 @default.
• W2042923118 cites W2081945273 @default.
• W2042923118 cites W2094285441 @default.
• W2042923118 cites W2101829206 @default.
• W2042923118 cites W2109560931 @default.
• W2042923118 cites W2126527070 @default.
• W2042923118 cites W2131323259 @default.
• W2042923118 cites W2141647862 @default.
• W2042923118 cites W2145871150 @default.
• W2042923118 cites W2158156603 @default.
• W2042923118 cites W4296276306 @default.
• W2042923118 doi "https://doi.org/10.1074/jbc.m010000200" @default.
• W2042923118 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11278594" @default.
• W2042923118 hasPublicationYear "2001" @default.
• W2042923118 type Work @default.
• W2042923118 sameAs 2042923118 @default.
• W2042923118 citedByCount "40" @default.
• W2042923118 countsByYear W20429231182013 @default.
• W2042923118 countsByYear W20429231182014 @default.
• W2042923118 countsByYear W20429231182015 @default.
• W2042923118 countsByYear W20429231182017 @default.
• W2042923118 countsByYear W20429231182018 @default.
• W2042923118 countsByYear W20429231182019 @default.
• W2042923118 countsByYear W20429231182020 @default.
• W2042923118 countsByYear W20429231182021 @default.
• W2042923118 countsByYear W20429231182022 @default.
• W2042923118 countsByYear W20429231182023 @default.
• W2042923118 crossrefType "journal-article" @default.
• W2042923118 hasAuthorship W2042923118A5004093180 @default.
• W2042923118 hasAuthorship W2042923118A5015141748 @default.
• W2042923118 hasAuthorship W2042923118A5024669876 @default.
• W2042923118 hasAuthorship W2042923118A5039971164 @default.
• W2042923118 hasAuthorship W2042923118A5070606019 @default.
• W2042923118 hasAuthorship W2042923118A5071699478 @default.
• W2042923118 hasAuthorship W2042923118A5072390223 @default.
• W2042923118 hasAuthorship W2042923118A5075108697 @default.
• W2042923118 hasBestOaLocation W20429231181 @default.
• W2042923118 hasConcept C104177226 @default.
• W2042923118 hasConcept C104317684 @default.
• W2042923118 hasConcept C118131993 @default.
• W2042923118 hasConcept C119599485 @default.
• W2042923118 hasConcept C127413603 @default.
• W2042923118 hasConcept C134306372 @default.
• W2042923118 hasConcept C169760540 @default.
• W2042923118 hasConcept C17077164 @default.
• W2042923118 hasConcept C185592680 @default.
• W2042923118 hasConcept C202751555 @default.
• W2042923118 hasConcept C203014093 @default.
• W2042923118 hasConcept C204328495 @default.
• W2042923118 hasConcept C2776545253 @default.
• W2042923118 hasConcept C2778690821 @default.
• W2042923118 hasConcept C2779244956 @default.
• W2042923118 hasConcept C33923547 @default.
• W2042923118 hasConcept C36503486 @default.
• W2042923118 hasConcept C49039625 @default.
• W2042923118 hasConcept C55493867 @default.
• W2042923118 hasConcept C7860815 @default.
• W2042923118 hasConcept C86803240 @default.
• W2042923118 hasConcept C95444343 @default.
• W2042923118 hasConceptScore W2042923118C104177226 @default.
• W2042923118 hasConceptScore W2042923118C104317684 @default.
• W2042923118 hasConceptScore W2042923118C118131993 @default.
• W2042923118 hasConceptScore W2042923118C119599485 @default.
• W2042923118 hasConceptScore W2042923118C127413603 @default.
• W2042923118 hasConceptScore W2042923118C134306372 @default.
• W2042923118 hasConceptScore W2042923118C169760540 @default.
• W2042923118 hasConceptScore W2042923118C17077164 @default.
• W2042923118 hasConceptScore W2042923118C185592680 @default.

• next