FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2043076714> ?p ?o ?g. }

• W2043076714 endingPage "858" @default.
• W2043076714 startingPage "849" @default.
• W2043076714 abstract "The Saccharomyces cerevisiae Cdc42p GTPase is localized to the plasma membrane and involved in signal transduction mechanisms controlling cell polarity. The mechanisms of action of the dominant negative cdc42 D118Amutant and the lethal, gain of functioncdc42 G12V mutant were examined. Cdc42D118A,C188Sp and its guanine-nucleotide exchange factor Cdc24p displayed a temperature-dependent interaction in the two-hybrid system, which correlated with the temperature dependence of the cdc42 D118A phenotype and supported a Cdc24p sequestration model for the mechanism ofcdc42 D118A action. Five cdc42mutations were isolated that led to decreased interactions with Cdc24p. The isolation of one mutation (V44A) correlated with the observations that the T35A effector domain mutation could interfere with Cdc42D118A,C188Sp-Cdc24p interactions and could suppress the cdc42 D118A mutation, suggesting that Cdc24p may interact with Cdc42p through its effector domain. Thecdc42 G12V mutant phenotypes were suppressed by the intragenic T35A and K183–187Q mutations and in skm1Δ and cla4Δ cells but not ste20Δ cells, suggesting that the mechanism of cdc42 G12Vaction is through the Skm1p and Cla4p protein kinases at the plasma membrane. Two intragenic suppressors ofcdc42 G12V were also identified that displayed a dominant negative phenotype at 16 °C, which was not suppressed by overexpression of Cdc24p, suggesting an alternate mechanism of action for these dominant negative mutations. The Saccharomyces cerevisiae Cdc42p GTPase is localized to the plasma membrane and involved in signal transduction mechanisms controlling cell polarity. The mechanisms of action of the dominant negative cdc42 D118Amutant and the lethal, gain of functioncdc42 G12V mutant were examined. Cdc42D118A,C188Sp and its guanine-nucleotide exchange factor Cdc24p displayed a temperature-dependent interaction in the two-hybrid system, which correlated with the temperature dependence of the cdc42 D118A phenotype and supported a Cdc24p sequestration model for the mechanism ofcdc42 D118A action. Five cdc42mutations were isolated that led to decreased interactions with Cdc24p. The isolation of one mutation (V44A) correlated with the observations that the T35A effector domain mutation could interfere with Cdc42D118A,C188Sp-Cdc24p interactions and could suppress the cdc42 D118A mutation, suggesting that Cdc24p may interact with Cdc42p through its effector domain. Thecdc42 G12V mutant phenotypes were suppressed by the intragenic T35A and K183–187Q mutations and in skm1Δ and cla4Δ cells but not ste20Δ cells, suggesting that the mechanism of cdc42 G12Vaction is through the Skm1p and Cla4p protein kinases at the plasma membrane. Two intragenic suppressors ofcdc42 G12V were also identified that displayed a dominant negative phenotype at 16 °C, which was not suppressed by overexpression of Cdc24p, suggesting an alternate mechanism of action for these dominant negative mutations. The establishment of cell polarity is crucial for the control of many cellular and developmental processes, such as the generation of cell shape, the intracellular movement of organelles, and the secretion and deposition of new cell surface constituents (1Drubin D.G. Nelson W.J. Cell. 1996; 84: 335-344Abstract Full Text Full Text PDF PubMed Scopus (894) Google Scholar). Polarized growth in the yeast Saccharomyces cerevisiae occurs in response to both internal and external signals, resulting in different morphological structures (2Chant J. Trends Genet. 1994; 10: 328-333Abstract Full Text PDF PubMed Scopus (99) Google Scholar, 3Madden K. Costigan C. Snyder M. Trends Cell Biol. 1992; 2: 22-29Abstract Full Text PDF PubMed Scopus (53) Google Scholar, 4Herskowitz I. Park H.-O. Sanders S. Valtz N. Peter M. Cold Spring Harbor. Symp. Quant. Biol. 1995; 60: 717-727Crossref PubMed Scopus (34) Google Scholar, 5Pringle J.R. Bi E. Harkins H.A. Zahner J.E. De Virgilio C. Chant J. Corrado K. Fares H. Cold Spring Harbor Symp. Quant. Biol. 1995; 60: 729-744Crossref PubMed Scopus (153) Google Scholar). The mechanics of cell polarity initiation during the mitotic cell cycle can be divided into three sequential phases: (i) nonrandom bud site selection; (ii) organization of proteins at the bud site; and (iii) bud emergence and polarized growth. Genetic and biochemical studies have identified over 25 proteins, including several GTPases and components of the actin cytoskeleton, that are involved in the regulation of the cell polarity pathway in S. cerevisiae (1Drubin D.G. Nelson W.J. Cell. 1996; 84: 335-344Abstract Full Text Full Text PDF PubMed Scopus (894) Google Scholar, 6Chant J. Pringle J.R. Curr. Opin. Genet. Dev. 1991; 1: 342-350Crossref PubMed Scopus (65) Google Scholar, 7Drubin D.G. Cell. 1991; 65: 1093-1096Abstract Full Text PDF PubMed Scopus (180) Google Scholar). At least six members of the Ras superfamily of GTPases (Rsr1p/Bud1p, Cdc42p, Rho1p, Rho2p, Rho3p, and Rho4p) are involved in controlling cell polarity in S. cerevisiae. These proteins are active when in the GTP-bound state and inactive in the GDP-bound state (8Bourne H.R. Sanders D.A. McCormick F. Nature. 1991; 349: 117-127Crossref PubMed Scopus (2672) Google Scholar, 9Boguski M.S. McCormick F. Nature. 1993; 366: 643-654Crossref PubMed Scopus (1755) Google Scholar). The activity of these GTPases is controlled by regulatory proteins, such as guanine-nucleotide exchange factors, GTPase-activating proteins, and guanine-nucleotide dissociation inhibitors, as well as by the intracellular localization of the GTPase. Rsr1p/Bud1p is a member of the Ras subfamily and is responsible for bud site selection at one of the two cell poles, but it is not required for bud emergence or polarized cell growth (10Bender A. Pringle J.R. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 9976-9980Crossref PubMed Scopus (310) Google Scholar, 11Chant J. Herskowitz I. Cell. 1991; 65: 1203-1212Abstract Full Text PDF PubMed Scopus (312) Google Scholar, 12Ruggieri R. Bender A. Matsui Y. Powers S. Takai Y. Pringle J.R. Matsumoto K. Mol. Cell. Biol. 1992; 12: 758-766Crossref PubMed Scopus (72) Google Scholar). Cdc42p is a member of the Rho/Rac subfamily and is involved in bud site selection, bud emergence, polarized growth, and cytokinesis (13Johnson D.I. Pringle J.R. J. Cell Biol. 1990; 111: 143-152Crossref PubMed Scopus (403) Google Scholar, 14Johnson D.I. Lacal J.C. McCormick F. The ras Superfamily of GTPases. CRC Press, Inc., Boca Raton, FL1993: 297-312Google Scholar, 15Miller P.J. Johnson D.I. Yeast. 1997; 13: 561-572Crossref PubMed Scopus (24) Google Scholar, 16Ziman M. O'Brien J.M. Ouellette L.A. Church W.R. Johnson D.I. Mol. Cell. Biol. 1991; 11: 3537-3544Crossref PubMed Scopus (165) Google Scholar). The Rho proteins have been implicated in bud formation, actin reorganization, polarized growth, and activation of β-glucan synthesis (17Yamochi I. Tanaka H. Nonaka H. Maeda A. Musha T. Takai Y. J. Cell Biol. 1994; 125: 1077-1093Crossref PubMed Scopus (209) Google Scholar, 18Matsui Y. Toh-e A. Mol. Cell. Biol. 1992; 12: 5690-5699Crossref PubMed Scopus (138) Google Scholar, 19Imai J. Toh-e A. Matsui Y. Genetics. 1996; 142: 359-369Crossref PubMed Google Scholar, 20Nonaka H. Tanaka K. Hirano H. Fujiwara T. Kohno H. Umikawa M. Mino A. Takai Y. EMBO J. 1995; 14: 5931-5938Crossref PubMed Scopus (304) Google Scholar, 21Qadota H. Python C.P. Inoue S.B. Arisawa M. Anraku Y. Zheng Y. Watanabe T. Levin D.E. Ohya Y. Science. 1996; 272: 279-281Crossref PubMed Scopus (392) Google Scholar, 22Mazur P. Baginsky W. J. Biol. Chem. 1996; 271: 14604-14609Abstract Full Text Full Text PDF PubMed Scopus (154) Google Scholar, 23Inoue S.B. Qadota H. Arisawa M. Watanabe T. Ohya Y. Cell Struct. Funct. 1996; 21: 395-402Crossref PubMed Scopus (29) Google Scholar). Highly conserved (80–85% identical) functional homologs of S. cerevisiae Cdc42p have been characterized inSchizosaccharomyces pombe (24Miller P. Johnson D.I. Mol. Cell. Biol. 1994; 14: 1075-1083Crossref PubMed Scopus (171) Google Scholar, 25Ottilie S. Miller P.J. Johnson D.I. Creasy C.L. Sells M.A. Bagrodia S. Forsburg S.L. Chernoff J. EMBO J. 1995; 14: 5908-5919Crossref PubMed Scopus (127) Google Scholar), Caenorhabditis elegans (26Chen W. Lim H.H. Lim L. J. Biol. Chem. 1993; 268: 13280-13285Abstract Full Text PDF PubMed Google Scholar), Drosophila melanogaster (27Luo L. Liao Y.J. Jan L.Y. Jan Y.N. Genes Dev. 1994; 8: 1787-1802Crossref PubMed Scopus (810) Google Scholar), andHomo sapiens (28Shinjo K. Koland J.G. Hart M.J. Narasimhan V. Johnson D.I. Evans T. Cerione R.A. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 9853-9857Crossref PubMed Scopus (173) Google Scholar, 29Munemitsu S. Innis M.A. Clark R. McCormick F. Ullrich A. Polakis P. Mol. Cell. Biol. 1990; 10: 5977-5982Crossref PubMed Scopus (133) Google Scholar), suggesting that Cdc42p may have conserved functions in these other eukaryotes. Analyses of the morphological phenotypes of dominant lethal S. cerevisiae cdc42 alleles indicated that Cdc42p functions in bud emergence and the subsequent polarized cell growth and cytokinesis (16Ziman M. O'Brien J.M. Ouellette L.A. Church W.R. Johnson D.I. Mol. Cell. Biol. 1991; 11: 3537-3544Crossref PubMed Scopus (165) Google Scholar). These data included the observation that the cdc42 G12Vmutation resulted in dominant lethality and large, multibudded cells, suggesting that the mutant protein was activated (GTP-bound) and constitutively interacting with downstream effectors of the pathway. These effectors may include Cla4p, Ste20p, and/or Skm1p, three S. cerevisiae members of the Pak family of protein kinases that interact with GTP-bound Cdc42p (25Ottilie S. Miller P.J. Johnson D.I. Creasy C.L. Sells M.A. Bagrodia S. Forsburg S.L. Chernoff J. EMBO J. 1995; 14: 5908-5919Crossref PubMed Scopus (127) Google Scholar, 30Cvrckova F. De Virgilio C. Manser E. Pringle J.R. Nasmyth K. Genes Dev. 1995; 9: 1817-1830Crossref PubMed Scopus (308) Google Scholar, 31Manser E. Leung T. Salihuddin H. Zhao Z. Lim L. Nature. 1994; 367: 40-46Crossref PubMed Scopus (1297) Google Scholar, 32Martin H. Mendoza A. Rodriguez-Pachon J.M. Molina M. Nombela C. Mol. Microbiol. 1997; 23: 431-444Crossref PubMed Scopus (47) Google Scholar, 33Leberer E. Wu C. Leeuw T. Fourest-Lieuvin A. Segall J.E. Thomas D.Y. EMBO J. 1997; 16: 83-97Crossref PubMed Scopus (165) Google Scholar, 34Peter M. Neiman A.M. Park H.-O. Lohuizen M.V. Herskowitz I. EMBO J. 1996; 15: 7046-7059Crossref PubMed Scopus (190) Google Scholar). In contrast, thecdc42 D118A mutant exhibited a temperature-dependent, dominant negative phenotype, suggesting that Cdc42D118Ap was inactive (GDP-bound) but could bind and sequester a cellular factor necessary for the budding process (16Ziman M. O'Brien J.M. Ouellette L.A. Church W.R. Johnson D.I. Mol. Cell. Biol. 1991; 11: 3537-3544Crossref PubMed Scopus (165) Google Scholar, 35Ziman M. Johnson D.I. Yeast. 1994; 10: 463-474Crossref PubMed Scopus (36) Google Scholar). A candidate for this cellular factor was Cdc24p due to its ability to multicopy-suppress thecdc42 D118A mutation and because acdc24 ts cdc42 ts double mutant displayed synthetic lethality (35Ziman M. Johnson D.I. Yeast. 1994; 10: 463-474Crossref PubMed Scopus (36) Google Scholar). In addition, Cdc24p showed limited amino acid sequence similarity with the Dbl proto-oncoprotein, which acts as a guanine-nucleotide exchange factor for human Cdc42p (36Cerione R.A. Zheng Y. Curr. Opin. Cell Biol. 1996; 8: 216-222Crossref PubMed Scopus (466) Google Scholar), and biochemical evidence indicated that Cdc24p catalyzes guanine-nucleotide exchange on Cdc42p in vitro (37Zheng Y. Cerione R. Bender A. J. Biol. Chem. 1994; 269: 2369-2372Abstract Full Text PDF PubMed Google Scholar). In localization studies, S. cerevisiae Cdc42p was found to be targeted to the plasma membrane in the vicinity of secretory vesicles that are found at the site of bud emergence, to the tips and sides of enlarging buds, and to the tips of mating projections in α-factor arrested cells (38Ziman M. Preuss D. Mulholland J. O'Brien J.M. Botstein D. Johnson D.I. Mol. Biol. Cell. 1993; 4: 1307-1316Crossref PubMed Scopus (204) Google Scholar). Cdc42p contains the C-terminal Lys183-Lys-Ser-Lys-Lys-Cys-Thr-Ile-Leu sequence that is modified by geranylgeranylation at the Cys residue, which is necessary for its anchoring within the plasma membrane (38Ziman M. Preuss D. Mulholland J. O'Brien J.M. Botstein D. Johnson D.I. Mol. Biol. Cell. 1993; 4: 1307-1316Crossref PubMed Scopus (204) Google Scholar, 39Finegold A.A. Johnson D.I. Farnsworth C.C. Gelb M.H. Judd S.R. Glomset J.A. Tamanoi F. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 4448-4452Crossref PubMed Scopus (120) Google Scholar). This prenylation is deemed necessary because the cdc42 C188Smutation resulted in a nonfunctional protein that fractionated almost exclusively into soluble pools (16Ziman M. O'Brien J.M. Ouellette L.A. Church W.R. Johnson D.I. Mol. Cell. Biol. 1991; 11: 3537-3544Crossref PubMed Scopus (165) Google Scholar, 38Ziman M. Preuss D. Mulholland J. O'Brien J.M. Botstein D. Johnson D.I. Mol. Biol. Cell. 1993; 4: 1307-1316Crossref PubMed Scopus (204) Google Scholar) and because thecdc42 C188S mutation can suppress thecdc42 G12V, cdc42 Q61L, andcdc42 D118A lethal mutations (16Ziman M. O'Brien J.M. Ouellette L.A. Church W.R. Johnson D.I. Mol. Cell. Biol. 1991; 11: 3537-3544Crossref PubMed Scopus (165) Google Scholar). However, whether geranylgeranylation is necessary and sufficient for Cdc42p targeting to the sites of polarized growth is unknown. The polybasic domain of four lysine residues that is next to the prenylated Cys residue is another possible localization determinant. Similar domains in the K-Ras protein are important for membrane targeting; altering these Lys residues to Gln results in delocalized K-Ras proteins (40Hancock J.F. Cadwallader K. Paterson H. Marshall C.J. EMBO J. 1991; 10: 4033-4039Crossref PubMed Scopus (376) Google Scholar,41Hancock J.F. Paterson H. Marshall C.J. Cell. 1990; 63: 133-139Abstract Full Text PDF PubMed Scopus (841) Google Scholar). To determine the mechanisms of action of thecdc42 D118A and cdc42 G12Vmutations, the interactions between Cdc42D118Ap and Cdc24p were examined in the yeast two-hybrid protein system, and extragenic and intragenic suppressors of the cdc42 G12Vallele were characterized. The data support the hypothesis that thecdc42 D118A dominant negative phenotype is due to sequestration of Cdc24p away from endogenous Cdc42p and suggest that the nature of the cdc42 G12V growth and morphological phenotypes is due to improper interactions with the Skm1p and Cla4p protein kinases at the plasma membrane. Two Cdc42 effector domain mutations were also identified that either suppressed thecdc42 D118A phenotype or disrupted Cdc42D118Ap-Cdc24p two-hybrid interactions, suggesting that Cdc24p may interact with Cdc42p through its effector domain. Enzymes, dideoxy sequencing, and polymerase chain reaction kits and other reagents were obtained from standard commercial sources and used as specified by the suppliers. [α-32P]dCTP was obtained from NEN Life Science Products. 5-Fluoroorotic acid was obtained from American Biorganics, Inc. (Niagara Falls, NY). Oligonucleotide primers used in PCR 1The abbreviations used are: PCR, polymerase chain reaction; X-gal, 5-bromo-4-chloro-3-indolyl-β-d-galactoside. reactions and site-specific mutagenesis were obtained from Bio-Synthesis, Inc. (Lewisville, TX). Protein determinations were performed using the Bio-Rad protein assay kit using bovine serum albumin as the standard, and immunoblots were developed using either the Enhanced Chemiluminescence (ECL) system (Amersham Corp.) or Renaissance system (NEN Life Science Products). Horseradish peroxidase-conjugated goat anti-rabbit IgG, protease inhibitors (phenylmethylsulfonyl fluoride,N-tosyl-l-phenylalanine chloromethyl ketone, aprotinin, leupeptin, and pepstatin), and glass beads (425–600 μm) were obtained from Sigma. Cdc42p-specific antibodies were isolated and purified as described previously (16Ziman M. O'Brien J.M. Ouellette L.A. Church W.R. Johnson D.I. Mol. Cell. Biol. 1991; 11: 3537-3544Crossref PubMed Scopus (165) Google Scholar). Conditions for the growth and maintenance of bacterial and yeast strains have been described (42Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar, 43Sherman F. Fink G.R. Hicks J.B. Methods in Yeast Genetics: Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1986Google Scholar). The S. cerevisiaestrains used are listed in Table I. TheS. cerevisiae strain HF7c (Ref. 44Feilotter H.E. Hannon G.J. Ruddell C.J. Beach D. Nucleic Acids Res. 1994; 22: 1502-1503Crossref PubMed Scopus (224) Google Scholar; provided by David Beach, Cold Spring Harbor Laboratories) was used in two-hybrid screens. Yeast transformations were performed as described (43Sherman F. Fink G.R. Hicks J.B. Methods in Yeast Genetics: Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1986Google Scholar), and transformants were selected on synthetic complete drop-out media lacking the appropriate amino acid(s) and containing 2% glucose as a carbon source (i.e. SC-Leu). Transformants were transferred to solid or liquid media containing 2% glucose or 2% raffinose plus 2% galactose (for induction of the GAL promoter) for growth analysis and photomicroscopy.Table IYeast strains used in this studyStrainGenotypeSource1-aHD2 was generated by mating W303–1A with Y763. HD2–1 was generated by integrating the skm1::HIS3fragment into HD2. TRY2 was generated by mating RAK63 with HD2–1-6D. TRY1 was generated by integrating the cla4::TRP1fragment into TRY2. HD2–1-2B and HD2–1-6D are congenic strains derived from HD2–1.DJTD2–16AMAT a cdc42–1 his4 leu2 trpl ura3Ref. 13Johnson D.I. Pringle J.R. J. Cell Biol. 1990; 111: 143-152Crossref PubMed Scopus (403) Google ScholarDJD6–11MATa/MATα cdc42Δ::TRP1/+ his3Δ200/+ his4/+ leu2/+ can1/+ lys2–801/lys2–801 trp1-Δ1/trp1-Δ101 ade2-101/+ ura3–52/ura3–52Ref. 15Miller P.J. Johnson D.I. Yeast. 1997; 13: 561-572Crossref PubMed Scopus (24) Google ScholarW303–1AMATa his3–11,5 leu2–3,112 trp1-Δ1 ade2–101 ura3–1 can1–100J. KurjanY763MATα ade2 his3 lys2 trp1 ura3M. SnyderHF7cMATa ura3–52 his3–200 ade2–101 lys2–801 trp1–901 leu2–3,112 gal4–542 gal80–538 LYS2::GAL1UAS-GAL1TATA-HIS3 URA3::GAL417mers(×3)CYC1TATA-lacZD. BeachRAK63MAT a ade2 ste20::ADE2–3 his3–11,5 leu2–3,112 trp1-Δ1 ura3–1 can1J. KurjanHD2MATa/α ade2/ade2 his3/his3 leu2/leu2 lys2/+ trp1/trp1-Δ1 ura3/ura3 can1/+This studyHD2–1MATa/α ade2/ade2 his3/his3 leu2/leu2 lys2/+ trp1/trp1-Δ1 ura3/ura3 can1/+ skml::HIS3/+This studyHD2–1-2BMATa ade2 leu2 trpl ura3 skm1::HIS3This studyHD2–1-6DMATα ade2 leu2 ura3 skm1::HIS3This studyTRYlMATa/α ade2/ade2 his3/his3 leu2/leu2 lys2/+ trp1/trp1-Δ1 ura3/ura3 can1/can1 skm1::HIS3/+ ste20::ADE2/+ cla4::TRP1/+This studyTRY1–1AMATa ade2 leu2 his3 trp1 ura3 can1 skm1::HIS3 cla4::TRP1This studyTRY1–6BMATa ade2 leu2 his3 trp1 ura3 can1 cla4::TRP1This studyTRY2MATa/α ade2/ade2 his3/his3 leu2/leu2 lys2/+ ura3/ura3 skml::HIS3/+ ste20::ADE2/+This studyTRY2–13BMATα ade2 his3 leu2 skm1::HIS3 ste20::ADE2This study1-a HD2 was generated by mating W303–1A with Y763. HD2–1 was generated by integrating the skm1::HIS3fragment into HD2. TRY2 was generated by mating RAK63 with HD2–1-6D. TRY1 was generated by integrating the cla4::TRP1fragment into TRY2. HD2–1-2B and HD2–1-6D are congenic strains derived from HD2–1. Open table in a new tab Standard procedures were used for recombinant DNA manipulations (42Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar) and plasmid isolation fromEscherichia coli (45Birnboim H.C. Doly J. Nucleic Acids Res. 1979; 7: 1513-1523Crossref PubMed Scopus (9886) Google Scholar). Sequencing was either by the dideoxy chain termination method (46Sanger F. Nicklen S. Coulson A.R. Proc. Natl. Acad. Sci. U. S. A. 1977; 74: 5463-5467Crossref PubMed Scopus (52495) Google Scholar) with the U.S. Biochemical Corp. Sequenase sequencing kit or through automated sequencing at the Vermont Cancer Center DNA Sequencing Facility. Site-directed mutagenesis was performed with the MUTAGENE kit (Bio-Rad). Plasmids pBM272 (47Johnston M. Davis R.W. Mol. Cell. Biol. 1984; 4: 1440-1448Crossref PubMed Scopus (632) Google Scholar), pRS306 and pRS315 (48Sikorski R.S. Hieter P. Genetics. 1989; 122: 19-27Crossref PubMed Google Scholar), pRS425 (49Christianson T.W. Sikorski R.S. Dante M. Shero J.H. Hieter P. Gene (Amst.). 1992; 110: 119-122Crossref PubMed Scopus (1429) Google Scholar), pJJ215 (50Jones J.S. Prakash L. Yeast. 1990; 6: 363-366Crossref PubMed Scopus (327) Google Scholar), pPGK (51Kang Y.S. Kane J. Kurjan J. Stadel J.M. Tipper D.J. Mol. Cell. Biol. 1990; 10: 2582-2590Crossref PubMed Google Scholar), pAS1-CYH2 (52Durfee T. Becherer K. Chen P.-L. Yeh S.-H. Yang Y. Kilburn A.E. Lee W.-H. Elledge S.J. Genes Dev. 1993; 7: 555-569Crossref PubMed Scopus (1297) Google Scholar), pGAD2F (53Chien C.-T. Bartel P.L. Sternglanz R. Fields S. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 9578-9582Crossref PubMed Scopus (1222) Google Scholar), pRS315(CDC24-B) (35Ziman M. Johnson D.I. Yeast. 1994; 10: 463-474Crossref PubMed Scopus (36) Google Scholar), and YEp351(CDC42), pGAL-CDC42, pRS315(CDC42), pRS315(cdc42 G12V), pRS315(cdc42 D118A), pRS315(cdc42 D118A,C188S), pGAL-cdc42 G12V, and pGAL-cdc42 D118A (16Ziman M. O'Brien J.M. Ouellette L.A. Church W.R. Johnson D.I. Mol. Cell. Biol. 1991; 11: 3537-3544Crossref PubMed Scopus (165) Google Scholar) have been previously described. Plasmid pRS315(GAL1/10) was constructed by blunt-ending the 685-base pair EcoRI-HindIII fragment from pBM272 containing the divergent GAL1/10promoters with the Klenow fragment of DNA polymerase I and inserting it into the unique SmaI site of pRS315. Plasmid pPGK2 was constructed by inserting the PGK promoter from plasmid pPGK on a XhoI plus SalI fragment into the unique SalI site of a derivative of pRS425, which had the BamHI to HindIII fragment from its multiple cloning site removed. 2P. Miller and D. I. Johnson, unpublished results. Plasmid pPGK2E, which has the unique EagI site of pPGK2 removed, was constructed by cleaving pPGK2 with EagI, blunt-ending with S1 nuclease, and religating with T4 DNA ligase. Plasmids pPGK2-CDC42 and pPGK2E-CDC42 were constructed by inserting a PCR-generated CDC42 gene contained on a BamHI plus HindIII fragment into either pPGK2 or pPGK2E that had been digested with BamHI plus HindIII. pGAD2F-CDC24 was constructed by inserting the ∼4-kilobase pair BamHI plusHindIII fragment from pRS315(CDC24-B), which was blunt-ended with the Klenow fragment of DNA polymerase, into pGAD2F that had been digested with BamHI and blunt-ended with the Klenow fragment of DNA polymerase. SKM1 (Ref. 32Martin H. Mendoza A. Rodriguez-Pachon J.M. Molina M. Nombela C. Mol. Microbiol. 1997; 23: 431-444Crossref PubMed Scopus (47) Google Scholar; GenBankTM accession numberX69322) was isolated from W303–1A genomic DNA by PCR using the 5′-primer TCCCCCGGGCATATGAAGGGCGTAAAAAAG (underlined sequence is a NdeI site and contains theSKM1 start codon; double underlined sequence is aSmaI site) and the 3′-primer GCTCTAGACTCGAGACATAACGCGAAGCAAACG (underlined sequence is a XhoI site; double underlined sequence is a XbaI site; nonunderlined sequence is the reverse complement of +144 to +163 downstream of the SKM1stop codon). The resulting 2547-base pair PCR fragment was digested with SmaI plus XbaI and inserted intoSmaI plus XbaI-digested pTZ18U (54Rokeach L.A. Haselby J.A. Hoch S.O. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 4832-4836Crossref PubMed Scopus (105) Google Scholar). To generate a skm1::HIS3 disruption, theSmaI-XhoI fragment containing HIS3from plasmid pJJ215 was blunt-ended with Klenow fragment and inserted into the blunt-ended unique StuI site at +241 of theSKM1 coding region in pTZ18U(SKM1). The resulting plasmid was digested with SmaI plus XbaI, releasing a 3.86-kilobase pair skm1::HIS3 fragment that was used to transform the diploid strain HD2 to His+. Sporulation and tetrad analysis of stable His+transformants yielded His+ haploid cells in which theskm1::HIS3 allele had replaced a wild-typeSKM1 allele at its chromosomal location, which was confirmed by DNA-DNA blot hybridization (data not shown). The PCR mutagenesis protocol was based on the Zhou et al. (55Zhou Y. Zhang X. Ebright R.H. Nucleic Acids Res. 1991; 19: 6052Crossref PubMed Scopus (204) Google Scholar) protocol previously described. Plasmid pRS315(cdc42 D118A, C188S) was amplified under essentially standard reaction conditions (reaction volume was 200 μl; reaction conditions were 10 mm Tris-HCl, pH 8.8, 50 mm KCl, 50 μm each dNTP, 2 fmol of template, 50 pmol of each primer, and 5 units of AmpliTaq DNA polymerase; cycle profile (30 cycles total) was 94 °C for 1 min, 50 °C for 2 min, and 72 °C for 3 min) on a Perkin-Elmer DNA thermal cycler model 480. The 5′- and 3′-primers were, respectively,GAATTCAAGCTTCGTATTAGGTCTTCC (underlined sequence is an EcoRI site; double underlined sequence is aHindIII site; nonunderlined sequence is −20 to −6 upstream of the CDC42 start codon), and CGCGGATCCGGGCATATACTAATATG (underlined sequence is aBamHI site; nonunderlined sequence is the reverse complement of +2 to +18 downstream of the CDC42 stop codon). The pool of PCR fragments was digested with NdeI plusBamHI (the NdeI site is at the CDC42start codon) and directionally inserted into NdeI plusBamHI-digested pAS1-CYH2. The pool of pAS1-CYH2(cdc42 D118A,C188S,X (X is any possible new mutation) plasmids was amplified in E. coli and transformed into S. cerevisiae HF7c cells already containing pGAD2F(CDC24). Plasmid pAS1-CYH2(cdc42 D118A,C188S) was obtained using the same procedure; the entire coding region was sequenced to confirm the presence of only those two mutations and no other spurious mutations. The introduction of the T35A mutation into the wild-type,cdc42 G12V, or cdc42 D118Amutant gene was accomplished by a modified Kunkel method of site-directed mutagenesis as described previously (16Ziman M. O'Brien J.M. Ouellette L.A. Church W.R. Johnson D.I. Mol. Cell. Biol. 1991; 11: 3537-3544Crossref PubMed Scopus (165) Google Scholar). The starting templates were uracil-containing single-stranded DNA isolated from E. coli CJ236 cells containing pRS315(CDC42), pRS315(cdc42 G12V), or pRS315(cdc42 D118A). The nucleotide sequence of the T35A mutagenic primer was GTTCCAGCAGTGTTCG (underlined G is A in the wild-type sequence). pGAL versions of the new double mutants were constructed using the same method as the original pGAL single mutants (16Ziman M. O'Brien J.M. Ouellette L.A. Church W.R. Johnson D.I. Mol. Cell. Biol. 1991; 11: 3537-3544Crossref PubMed Scopus (165) Google Scholar); the pRS315 double-mutant plasmids were digested with HpaI to delete CDC42upstream sequences, and the 685-base pairEcoRI-HindIII fragment from pBM272 containing the divergent GAL1/10 promoters was blunt-ended with the Klenow fragment of DNA polymerase I and inserted into this uniqueHpaI site. A PCR approach was employed to generate the Cdc42T35A,D118A,C188S triple mutant for use in two-hybrid protein studies. The starting template was 100 ng of pRS315(cdc42 T35A,D118A) and the nucleotide sequence of the C188S mutagenic primer was CGCGGATCCGACTACAAAATTGTAGATTTTTTACTTTTCTTGATAACAGG (Cys188 to Ser; underlined G is C in the wild-type sequence; the double underlined sequence is a BamHI restriction site). The mutagenic primer was used as the 3′-primer in the PCR reaction with the same 5′-primer used in the PCR mutagenesis reactions (see above). Primers were used at a final concentration of 0.1 nm in a final reaction volume of 50 μl. The PCR cycling parameters were 30 cycles of 94 °C for 1 min, 55 °C for 2 min, and 72 °C for 3 min, followed by a 5-min extension reaction at 72 °C. The resulting PCR product was digested with NdeI plus BamHI (the NdeI site is at theCDC42 start codon) and directionally inserted intoNdeI plus BamHI-digested pAS1-CYH2. Introduction of the K183–187Q mutations into either the wild-type orcdc42 G12V mutant gene was accomplished using a PCR approach. The nucleotide sequence of the K183–187Q mutagenic primer was CGCGGATCCGACTACAAAATTGTACATTGTTGACTTTGCTGGATAACAGG (lysine 183, 184, 186, and 187 to Gln; underlined G bases are T in the wild-type sequence; the double underlined sequence is aBamHI restriction site). The mutagenic primer was used as the 3′-primer in the PCR reaction with the same 5′-primer used in the PCR mutagenesis reactions (see above). Template for the PCR reaction was 1 μg of either YEp351(CDC42) to generate thecdc42 K183–187Q quadruple mutant or pRS315(cdc42 G12V) to generate thecdc42 G12V,K183–187Q quintuple mutant. Primers were used at a final concentration of 0.1 μm in a final reaction volume of 100 μl, and the PCR cycling parameters were as described above. The mutant genes were placed under the control of thePGK promoter by digesting the resulting ∼600-base pair PCR products with HindIII plus BamHI and inserting into HindIII plus BamHI-cleaved pPGK2. For all mutant genes, the entire coding region for each mutant gene was sequenced to confirm the presence of the desired mutation(s) and the absence of any spurious mutations. The two-hybrid interaction methodology has been described (44Feilotter H.E. Hannon G.J. Ruddell C.J. Beach D. Nucleic Acids Res. 1994; 22: 1502-1503Crossref PubMed Scopus (224) Google Scholar, 53Chien C.-T. Bartel P.L. Sternglanz R. Fields S. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 9578-9582Crossref PubMed Scopus (1222) Google Scholar). The HF7c transforma" @default.
• W2043076714 created "2016-06-24" @default.
• W2043076714 creator A5001737910 @default.
• W2043076714 creator A5017069888 @default.
• W2043076714 creator A5042900625 @default.
• W2043076714 creator A5045579130 @default.
• W2043076714 creator A5063673623 @default.
• W2043076714 creator A5086115442 @default.
• W2043076714 date "1998-01-01" @default.
• W2043076714 modified "2023-09-30" @default.
• W2043076714 title "Analysis of the Mechanisms of Action of the Saccharomyces cerevisiae Dominant Lethal cdc42 G12V and Dominant Negative cdc42 D118A Mutations" @default.
• W2043076714 cites W1492253723 @default.
• W2043076714 cites W1567983985 @default.
• W2043076714 cites W1596996692 @default.
• W2043076714 cites W1598998194 @default.
• W2043076714 cites W1611469980 @default.
• W2043076714 cites W1799140375 @default.
• W2043076714 cites W180885374 @default.
• W2043076714 cites W1856070105 @default.
• W2043076714 cites W1864334043 @default.
• W2043076714 cites W1956883206 @default.
• W2043076714 cites W1963525943 @default.
• W2043076714 cites W1966732663 @default.
• W2043076714 cites W1970705112 @default.
• W2043076714 cites W1971152163 @default.
• W2043076714 cites W1971227936 @default.
• W2043076714 cites W1977598234 @default.
• W2043076714 cites W1979027806 @default.
• W2043076714 cites W1984875233 @default.
• W2043076714 cites W1989768998 @default.
• W2043076714 cites W1992405604 @default.
• W2043076714 cites W1993972454 @default.
• W2043076714 cites W1998029045 @default.
• W2043076714 cites W2004373826 @default.
• W2043076714 cites W2004749537 @default.
• W2043076714 cites W2010207338 @default.
• W2043076714 cites W2011756230 @default.
• W2043076714 cites W2015391676 @default.
• W2043076714 cites W2019410656 @default.
• W2043076714 cites W2032952059 @default.
• W2043076714 cites W2034092404 @default.
• W2043076714 cites W2036692489 @default.
• W2043076714 cites W2037439187 @default.
• W2043076714 cites W2038912552 @default.
• W2043076714 cites W2041797886 @default.
• W2043076714 cites W2045710644 @default.
• W2043076714 cites W2045894626 @default.
• W2043076714 cites W2058282339 @default.
• W2043076714 cites W2059052497 @default.
• W2043076714 cites W2060006253 @default.
• W2043076714 cites W2065314308 @default.
• W2043076714 cites W2066790438 @default.
• W2043076714 cites W2068702557 @default.
• W2043076714 cites W2075686543 @default.
• W2043076714 cites W2079564526 @default.
• W2043076714 cites W2080418520 @default.
• W2043076714 cites W2086121244 @default.
• W2043076714 cites W2088822716 @default.
• W2043076714 cites W2091512138 @default.
• W2043076714 cites W2100837269 @default.
• W2043076714 cites W2114618350 @default.
• W2043076714 cites W2120425861 @default.
• W2043076714 cites W2120613121 @default.
• W2043076714 cites W2138270253 @default.
• W2043076714 cites W2142454421 @default.
• W2043076714 cites W2142946131 @default.
• W2043076714 cites W2145186174 @default.
• W2043076714 cites W2165220994 @default.
• W2043076714 cites W2169333620 @default.
• W2043076714 cites W2281196102 @default.
• W2043076714 cites W243361401 @default.
• W2043076714 cites W3024468432 @default.
• W2043076714 doi "https://doi.org/10.1074/jbc.273.2.849" @default.
• W2043076714 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9422741" @default.
• W2043076714 hasPublicationYear "1998" @default.
• W2043076714 type Work @default.
• W2043076714 sameAs 2043076714 @default.
• W2043076714 citedByCount "41" @default.
• W2043076714 countsByYear W20430767142012 @default.
• W2043076714 countsByYear W20430767142014 @default.
• W2043076714 countsByYear W20430767142015 @default.
• W2043076714 countsByYear W20430767142019 @default.
• W2043076714 countsByYear W20430767142020 @default.
• W2043076714 countsByYear W20430767142022 @default.
• W2043076714 countsByYear W20430767142023 @default.
• W2043076714 crossrefType "journal-article" @default.
• W2043076714 hasAuthorship W2043076714A5001737910 @default.
• W2043076714 hasAuthorship W2043076714A5017069888 @default.
• W2043076714 hasAuthorship W2043076714A5042900625 @default.
• W2043076714 hasAuthorship W2043076714A5045579130 @default.
• W2043076714 hasAuthorship W2043076714A5063673623 @default.
• W2043076714 hasAuthorship W2043076714A5086115442 @default.
• W2043076714 hasBestOaLocation W20430767141 @default.
• W2043076714 hasConcept C104317684 @default.
• W2043076714 hasConcept C121332964 @default.
• W2043076714 hasConcept C1491633281 @default.
• W2043076714 hasConcept C2777576037 @default.
• W2043076714 hasConcept C2780040266 @default.

• next