FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2043466478> ?p ?o ?g. }

• W2043466478 endingPage "30900" @default.
• W2043466478 startingPage "30889" @default.
• W2043466478 abstract "Using C6-NBD-glucosylceramide (GlcCer) as a substrate, we detected the activity of a conduritol B epoxide-insensitive neutral glycosylceramidase in cytosolic fractions of zebrafish embryos, mouse and rat brains, and human fibroblasts. The candidates for the enzyme were assigned to the Klotho (KL), whose family members share a β-glucosidase-like domain but whose natural substrates are unknown. Among this family, only the KL-related protein (KLrP) is capable of degrading C6-NBD-GlcCer when expressed in CHOP cells, in which Myc-tagged KLrP was exclusively distributed in the cytosol. In addition, knockdown of the endogenous KLrP by small interfering RNA increased the cellular level of GlcCer. The purified recombinant KLrP hydrolyzed 4-methylumbelliferyl-glucose, C6-NBD-GlcCer, and authentic GlcCer at pH 6.0. The enzyme also hydrolyzed the corresponding galactosyl derivatives, but each kcat/Km was much lower than that for glucosyl derivatives. The x-ray structure of KLrP at 1.6Å resolution revealed that KLrP is a (β/α)8 TIM barrel, in which Glu165 and Glu373 at the carboxyl termini of β-strands 4 and 7 could function as an acid/base catalyst and nucleophile, respectively. The substrate-binding cleft of the enzyme was occupied with palmitic acid and oleic acid when the recombinant protein was crystallized in a complex with glucose. GlcCer was found to fit well the cleft of the crystal structure of KLrP. Collectively, KLrP was identified as a cytosolic neutral glycosylceramidase that could be involved in a novel nonlysosomal catabolic pathway of GlcCer. Using C6-NBD-glucosylceramide (GlcCer) as a substrate, we detected the activity of a conduritol B epoxide-insensitive neutral glycosylceramidase in cytosolic fractions of zebrafish embryos, mouse and rat brains, and human fibroblasts. The candidates for the enzyme were assigned to the Klotho (KL), whose family members share a β-glucosidase-like domain but whose natural substrates are unknown. Among this family, only the KL-related protein (KLrP) is capable of degrading C6-NBD-GlcCer when expressed in CHOP cells, in which Myc-tagged KLrP was exclusively distributed in the cytosol. In addition, knockdown of the endogenous KLrP by small interfering RNA increased the cellular level of GlcCer. The purified recombinant KLrP hydrolyzed 4-methylumbelliferyl-glucose, C6-NBD-GlcCer, and authentic GlcCer at pH 6.0. The enzyme also hydrolyzed the corresponding galactosyl derivatives, but each kcat/Km was much lower than that for glucosyl derivatives. The x-ray structure of KLrP at 1.6Å resolution revealed that KLrP is a (β/α)8 TIM barrel, in which Glu165 and Glu373 at the carboxyl termini of β-strands 4 and 7 could function as an acid/base catalyst and nucleophile, respectively. The substrate-binding cleft of the enzyme was occupied with palmitic acid and oleic acid when the recombinant protein was crystallized in a complex with glucose. GlcCer was found to fit well the cleft of the crystal structure of KLrP. Collectively, KLrP was identified as a cytosolic neutral glycosylceramidase that could be involved in a novel nonlysosomal catabolic pathway of GlcCer. Glucosylceramide (GlcCer) 2The abbreviations used are: GlcCer, glucosylceramide; Cer, ceramide; CBE, conduritol B epoxide; GalCer, galactosylceramide; GBA, β-glucosidase; GC, gas-liquid chromatography; GCase, glycosylceramidase; GH, glycohydrolase; GSL, glycosphingolipid; KL, Klotho; KLrP, Klotho-related protein; LacCer, lactosylceramide; LPH, lactase phlorizin hydrolase; NBD, 4-nitrobenzo-2-oxa-1,3-diazole; 4MU, 4-methylumbelliferyl; GlcSph, glucosylsphingosine; GalSph, galactosylsphingosine; MES, 4-morpholineethanesulfonic acid; PBS, phosphate-buffered saline; HPLC, high pressure liquid chromatography. is a precursor for ganglio-, lacto/neolacto-, and globo/isoglobo-series glycosphingolipids (GSLs). The synthesis of GlcCer is catalyzed by GlcCer synthase-1, mainly located on the cytosolic face of the Golgi apparatus (1Futerman A.H. Pagano R.E. Biochem. J. 1991; 280: 295-302Crossref PubMed Scopus (246) Google Scholar, 2Ichikawa, S., and Hirabayashi, Y. (1998) Trends Cell Biol. 8, 198-202Google Scholar). The GlcCer generated is then translocated to the luminal surface of the Golgi membrane by an unknown mechanism, where it is converted to lactosylceramide (LacCer) by LacCer synthase. This is followed by a step-by-step extension of sugar chains by corresponding glycosyltransferases to generate complex GSLs. Finally, the GSLs are transported through the trans-Golgi network to the plasma membrane, where the sugar moiety faces the extracellular space, and the Cer moiety is embedded in the upper layer of the membrane. Catabolism of GlcCer primarily takes place in the lysosomes where acid β-glucosidase (glucocerebrosidase, GBA1; EC 3.2.1.45) cleaves the β-glucosyl linkage between Cer and glucose with the assistance of a noncatalytic protein, saposin C, and negatively charged lipids (3O'Brien, J. S., and Kishimoto, Y. (1991) FASEB J. 5, 301-308Google Scholar, 4Kolter, T., and Sandhoff, K. (2005) Annu. Rev. Cell Dev. Biol. 21, 81-1035Google Scholar). The enzyme is specifically and irreversibly inhibited by conduritol B epoxide (CBE). An inherited deficiency of the enzyme causes Gaucher disease, the most common lysosomal storage disease, in which GlcCer is accumulated in lysosomes of laden tissue macrophages. However, the accumulation of GlcCer in other cell types is not obvious in patients with Gaucher disease despite the significant decrease of GBA1 activity, and thus the existence of an alternative catabolic pathway for GlcCer was speculated (5Barranger, J. A., and Ginns, E. I. (1989) in The Metabolic Basis of Inherited Disease, Vol. II (Scriver, C. R., Beaudet, A. L., Sly, W. S., and Valle, D. eds) pp. 1677-1698, McGraw-Hill Inc., New YorkGoogle Scholar, 6Beutler, E., and Grabowski, G. A. (2001) in The Metabolic and Molecular Bases of Inherited Disease III (Scriver, C. R., Beaudet, A. L., Valle, D., and Sly, W. S., eds) pp. 3635-3668, McGraw-Hill Inc., New YorkGoogle Scholar). Among the β-glucosidases reported, lactase phlorizin hydrolase (LPH, EC 3.2.1.62/108) was shown to hydrolyze GlcCer (7Kobayashi T. Suzuki K. J. Biol. Chem. 1981; 256: 7768-7773Abstract Full Text PDF PubMed Google Scholar). The enzyme, sensitive to CBE, is exclusively present in the microvilli of intestinal epithelial cells and possibly functions as a kind of digestive enzyme. Very recently, two research groups reported an alternative pathway (8Yildiz Y. Matern H. Thompson B. Allegood J.C. Warren R.L. Ramirez D.M.O. Hammer R.E. Hamra F.K. Matern S. Russell D.W. J. Clin. Invest. 2006; 116: 2985-2994Crossref PubMed Scopus (182) Google Scholar, 9Boot R.G. Vierhoek M. Donker-Koopman W. Strijland A. van Marle J. Overkleeft H.S. Wennekes T. Aerts J.M.F.G. J. Biol. Chem. 2006; 282: 1305-1312Abstract Full Text Full Text PDF PubMed Scopus (140) Google Scholar), the catabolism of GlcCer by β-glucosidase 2 (GBA2), which has been known as a bile acid β-glucosidase (10Marten H. Boermans H. Lottspeich F. Matern S. J. Biol. Chem. 2001; 276: 37929-37933Abstract Full Text Full Text PDF PubMed Google Scholar). The enzyme, relatively nonsensitive to CBE, seems to be a membrane-bound enzyme of the ER (8Yildiz Y. Matern H. Thompson B. Allegood J.C. Warren R.L. Ramirez D.M.O. Hammer R.E. Hamra F.K. Matern S. Russell D.W. J. Clin. Invest. 2006; 116: 2985-2994Crossref PubMed Scopus (182) Google Scholar) or located at or close to the cell surface (9Boot R.G. Vierhoek M. Donker-Koopman W. Strijland A. van Marle J. Overkleeft H.S. Wennekes T. Aerts J.M.F.G. J. Biol. Chem. 2006; 282: 1305-1312Abstract Full Text Full Text PDF PubMed Scopus (140) Google Scholar). Unexpectedly, GBA2 knock-out mice exhibited a normal metabolism of bile acid. Alternatively, GlcCer was found to be accumulated in the testes, brain, and liver, causing male infertility possibly because of abnormal sperm (8Yildiz Y. Matern H. Thompson B. Allegood J.C. Warren R.L. Ramirez D.M.O. Hammer R.E. Hamra F.K. Matern S. Russell D.W. J. Clin. Invest. 2006; 116: 2985-2994Crossref PubMed Scopus (182) Google Scholar). GBA2 was likely to be the same enzyme that was previously described as a nonlysosomal CBE-insensitive glucosylceramidase (11van Weely S. Brandsma M. Strijland A. Tager J.M. Aerts J.M.F.G. Biochem. Biophys. Acta. 1993; 1181: 55-62Crossref PubMed Scopus (108) Google Scholar), which was extremely sensitive to inhibition by hydrophobic deoxynojirimycin analogues (12Overkleeft H.S. Renkema G.H. Neele J. Vianello P. Hung I.O. Strijland A. van der Burg A.M. Koomen G.J. Pandit U.K. Aerts J.M.F.G. J. Biol. Chem. 1998; 273: 26522-26527Abstract Full Text Full Text PDF PubMed Scopus (157) Google Scholar). During the course of the development of a sensitive assay for glycosyltransferases using fluorescent substrates and HPLC (13Hayashi Y. Horibata Y. Sakaguchi K. Okino N. Ito M. Anal. Biochem. 2005; 345: 181-186Crossref PubMed Scopus (25) Google Scholar), activity for the hydrolysis of C6-NBD-GlcCer was detected in zebrafish embryos, mouse and rat brains, and human fibroblasts in the presence of CBE at neutral pH. The CBE-insensitive activity of rat brains was present in not only membrane-bound fractions (possibly GBA2) but also cytosolic fractions (this study). Using a bioinformative approach, the Klotho (KL) family emerged as a candidate for the novel GlcCer-degrading enzyme because they share a β-glucosidase-like domain, although their natural substrates remain unknown. It has been reported that mutation of the KL gene in mice leads to a syndrome resembling aging, and thus KL seems to be involved in the suppression of aging (14Kuro-o M. Matsumura Y. Aizawa H. Kawaguchi H. Suga T. Utsugi T. Ohyama Y. Kurabayashi M. Kaname T. Kume E. Iwasaki H. Iida A. Shiraki-Iida T. Nishikawa S. Nagai R. Nabeshima Y. Nature. 1997; 390: 45-51Crossref PubMed Scopus (2808) Google Scholar). Among the KL family proteins, including KL (14Kuro-o M. Matsumura Y. Aizawa H. Kawaguchi H. Suga T. Utsugi T. Ohyama Y. Kurabayashi M. Kaname T. Kume E. Iwasaki H. Iida A. Shiraki-Iida T. Nishikawa S. Nagai R. Nabeshima Y. Nature. 1997; 390: 45-51Crossref PubMed Scopus (2808) Google Scholar), βKL (15Ito S. Kinoshita S. Shiraishi N. Nakagawa S. Sekina S. Fujimori T. Nabeshima Y. Mech. Dev. 2000; 98: 115-119Crossref PubMed Scopus (262) Google Scholar), KL lactase phlorizin hydrolase (16Ito S. Fujimori T. Hayashizaki Y. Nabeshima Y. Biochim. Biophys. Acta. 2002; 1576: 341-345Crossref PubMed Scopus (83) Google Scholar), and KL-related protein (KLrP) (17Yahata K. Mori K. Arai H. Koide S. Ogawa Y. Mukoyama M. Sugawara A. Ozaki S. Tanaka I. Nabeshima Y. Nakao K. J. Mol. Med. 2000; 78: 389-394Crossref PubMed Scopus (46) Google Scholar), only KLrP was found to be capable of degrading C6-NBD-GlcCer in the presence of CBE at neutral pH when expressed in CHOP cells. A kinetic analysis uncovered that KLrP hydrolyzed C6-NBD-GlcCer and 4MU-Glc as well as C6-NBD-GalCer and 4MU-GalCer, although the kcat/Km for the former was relatively higher than that for the latter. This result indicated that KLrP should be defined as a “β-glycosylceramidase” (GCase) rather than a “β-glucosylceramidase” or “β-glucocerebrosidase.” We report here that KLrP is a novel cytosolic neutral GCase and present the results of kinetic, cellular, and x-ray crystal analyses of the enzyme. This is the first report describing the crystal structure of KLrP. Materials—Human primary fibroblasts were obtained from Dr. K. Ohno (Tottori University, Tottori, Japan). CHOP cells (Chinese hamster ovary-derived cells expressing polyoma LT antigen) were donated by Dr. J. W. Dennis (Samuel Lunenfeld Research Institute, Mt. Sinai Hospital, Toronto, Canada) through Dr. K. Nara (Mitsubishi Kagaku Institute of Life Sciences, Tokyo, Japan). HEK293 cells, human embryonic kidney cells (JCRB9068; established by F. L. Graham), were obtained from the Human Science Research Resource Bank. GlcCer, LacCer, and GM1a were purchased from Wako Pure Chemical Industries (Osaka, Japan). GalCer, sulfatides, GlcSph, and GalSph were purchased from Matreya, and α-GalCer (Gala1-1′Cer) was purchased from Alexis Biochemicals. Horseradish peroxidase-labeled anti-mouse IgG antibody was purchased from Nacalai Tesque (Kyoto, Japan). Cy3-labeled anti-mouse IgG antibody, C6-NBD-GlcCer, C6-NBD-GalCer, and C6-NBD-LacCer were obtained from Sigma. The anti-Myc antibody and C6-NBD-Cer were purchased from Invitrogen. Precoated Silica Gel 60 TLC plates were purchased from Merck. [14C]GlcCer and [14C]GalCer, labeled at C1 of stearic acid, were synthesized as described (18Mitsutake S. Kita K. Nakagawa T. Ito M. J. Biochem. (Tokyo). 1998; 123: 859-863Crossref PubMed Scopus (26) Google Scholar). All other reagents were of the highest purity available. Cloning of cDNA Encoding Proteins of the KL Family—The complete open reading frames for KL (NM_013823.1), KLβ (NM_031180.2), KL lactase phlorizin hydrolase (NM_145835.1), and KLrP (GBA3, NM_020973.2) were amplified from a cDNA library derived from human embryonic kidney-derived HEK293 cells and mouse liver using specific primers containing restriction sites and an extended Kozak sequence in front of the start codon. The PCR product was subcloned into pcDNA3.1/Myc-His(+) (Invitrogen) or pET23b(+) (Novagen). Cell Culture and Transfection—CHOP cells were grown at 37 °C in α-minimal essential medium supplemented with 10% fetal bovine serum, 100 μg/ml streptomycin, and 100 units/ml penicillin in a humidified incubator containing 5% CO2. HEK293 cells were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and 60 μg/ml kanamycin in a humidified incubator containing 5% CO2. cDNA transfection was carried out using Lipofectamine™ Plus (Invitrogen) according to the manufacturer's instructions. Assay of Neutral GCase Activity in Vitro—An aliquot of 100 pmol of C6-NBD-GlcCer or C6-NBD-GalCer was incubated at 37 °C for 30 min with an appropriate amount of enzyme in 20 μl of 50 mm MES buffer, pH 6.0, containing 0.25% sodium cholate in the presence or absence of 0.5 mm CBE. The reaction was stopped by adding 100 μl of chloroform/methanol (2:1; v/v). The reaction mixture was then dried using a SpeedVac concentrator, dissolved in 15 μl of chloroform/methanol (2:1; v/v), and applied to a TLC plate, which was developed with chloroform/methanol/H2O (65:25:4, v/v/v). The TLC plate was scanned with a Shimadzu CS-9300 chromatoscanner (excitation 470 nm, emission 530 nm). Alternatively, 100 pmol of [14C]GlcCer was used for the assay instead of the fluorescent substrates. After incubation at 37 °C for the periods indicated, reaction mixture was applied onto a TLC plate, which was developed with chloroform/methanol/H2O (65:25:4, v/v/v). [14C]Cer released and [14C]GlcCer unhydrolyzed on the TLC were quantified with FLA5000. Determination of Substrate Specificity of KLrP—Twenty nmol of various substrates (GlcCer, GalCer, α-GalCer, GlcSph, GalSph, sulfatides, LacCer, and GM1a) were incubated with an appropriate amount of enzyme in 20 μl of 50 mm MES buffer, pH 6.0, containing 1% sodium cholate. After incubation, the reaction was stopped by adding 100 μl of chloroform/methanol (2:1; v/v). The reaction mixture was then dried using a SpeedVac concentrator, dissolved in 15 μl of chloroform/methanol (2:1; v/v), and applied to a TLC plate, which was developed with chloroform, methanol, 0.02% CaCl2 (6.5:4:1, v/v/v) except in experiments using GM1a and sulfatide as a substrate. For these substrates, chloroform, methanol, 0.02% CaCl2 (2:3:1, v/v/v) was used as a developing solvent. GSLs and sugars were visualized by spraying TLC plates with orcinol-H2SO4 reagent and scanning them with a Shimadzu CS-9300 chromatoscanner with the reflectance mode set at 540 nm. Assay of Lactate Dehydrogenase Activity—An aliquot of 1 μmol of sodium pyruvate was incubated at 37 °C for 30 min with an appropriate amount of enzyme in 1 ml of 50 mm phosphate buffer, pH 7.5, and 0.2 mm NADH. The reaction was stopped by boiling for 5 min. The reaction mixture was then examined with an Ultraspec 3000 (Amersham Biosciences) with absorbance at 340 nm. Immunocytochemistry and Fluorescence Microscopy—Cells transfected with the cDNA were cultured on a coverglass and then fixed with 3% paraformaldehyde in PBS for 15 min. After being rinsed with PBS and 50 mm NH4Cl in PBS, cells were permeabilized with 0.1% Triton X-100 in PBS. After treatment with blocking buffer (5% skim milk in PBS) for 15 min, the samples were incubated with anti-Myc antibody (diluted 2000 times with blocking buffer) at 4 °C overnight, followed by incubation with Cy3-labeled anti-mouse IgG antibody at room temperature for 2 h. Samples were observed with a confocal laserscanning microscope (Digital Eclipse C1; Nikon). Catabolism of Fluorescent GlcCer in Vivo—CHOP cells (0.5 × 105) were seeded in a 12-well microplate and incubated at 37 °C for 24 h to allow them to attach to the plate. Then cells were transformed with expression vector pcDNA3.1 containing KLrP (KLrP overexpressor) or empty vector (mock transfectant) and then incubated at 37 °C for 3 h in α-minimal essential medium containing 1 nmol of C6-NBD-GlcCer. After the incubation, cells were harvested by centrifugation (800 × g for 5 min) and washed three times with PBS. Total lipids were extracted with 200 μl of isopropyl alcohol/hexane/water (55:35: 10, v/v/v) for 10 min with sonication. After centrifugation at 20,000 × g for 5 min, the upper layer was dried under N2 gas, dissolved in 25 μl of chloroform/methanol (2:1, v/v), and then applied to a TLC plate that was developed with chloroform/methanol/H2O (65:25:4, v/v/v). Fluorescent lipids on the TLC plate were visualized under a UV illuminator. RNA Interference—Gene silencing of the KLrP in HEK293 cells was performed using stealth RNA interference (Invitrogen) according to the instructions of the manufacturer. The sequence-specific DNA oligonucleotide was designed using the sequence of human KLrP cDNA as described below. Two sets of siRNA corresponding to the sequences of the 332-nucleotide (siRNA-332) GGGTTACTCCCATTGTGACCCTCTA and the 564-nucleotide (siRNA-564) TGGAGGTTATCAGGCAGCTCATAAT, from the initiation codon of KLrP cDNA, were used. BLOCK-iT Fluorescent Oligo (Invitrogen), a fluorescence-labeled, double-stranded RNA duplex with the same length, charge, and configuration as standard siRNA, was used as a control siRNA (19Kolachala V.L. Obertone T.S. Wang L. Merlin D. Sitaraman S.V. Biochim. Biophys. Acta. 2006; 1760: 1102-1108Crossref PubMed Scopus (17) Google Scholar, 20Sitaraman S.V. Wang L. Wong M. Bruewer M. Hobert M. Yun C.H. Merlin D. Madara J.L. J. Biol. Chem. 2002; 277: 33188-33195Abstract Full Text Full Text PDF PubMed Scopus (84) Google Scholar). HEK293 cells were transfected with the siRNA using Oligofectamine™ reagent (Invitrogen) according to the instructions of the manufacturer. Metabolic Labeling and Extraction of GlcCer—HEK293 cells were incubated at 37 °C for the period indicated in Dulbecco's modified Eagle's medium supplemented with 5% fetal bovine serum containing 0.2 μCi of [14C]Gal for 9 h. Cells were harvested by centrifugation (800 × g for 5 min) and washed with PBS. Lipids were extracted with 200 μl of isopropyl alcohol/hexane/water (55:35:10, v/v/v) for 10 min with sonication. After centrifugation at 20,000 × g for 5 min, the upper layer was dried under N2 gas, dissolved in 25 μl of chloroform/methanol (2:1, v/v), and then applied to a TLC plate, which was developed with chloroform/methanol/H2O (65:25:4, v/v/v). Radioactive GlcCer on the TLC plate was detected with an imaging analyzer FLA5000 (Fuji Film). Expression and Purification of Recombinant KLrP—Escherichia coli strain BL21(DE3)pLysS cells were transformed with pET23b containing the KLrP cDNA and grown at 25 °C for 24 h with shaking in 200 ml of Luria-Bertani medium supplemented with 100 μg/ml carbenicillin and 35 μg/ml chloramphenicol. Then cells were harvested by centrifugation (8,000 × g for 10 min) and suspended in extraction solution (0.15 m NaCl in 20 mm sodium phosphate buffer, pH 7.4). After sonication for 1 min, cell debris was removed by centrifugation (8,000 × g for 10 min). The supernatant obtained was applied to a Hi-Trap Chelating HP column (Amersham Biosciences), which was chelated with Ni2+, and then the column was washed with 20 mm sodium phosphate buffer, pH 7.4, containing 0.15 m NaCl and 30 mm imidazole. The enzyme was eluted from the column with 20 mm sodium phosphate buffer, pH 7.5, containing 0.15 m NaCl and 100 mm imidazole. The eluted fractions were pooled and then loaded onto a column of Superdex™ 200 10/300 GL (Amersham Biosciences) equilibrated with 25 mm MES buffer, pH 6.0, containing 100 mm NaCl at a flow rate of 0.5 ml/min using a BioCAD sprint system (PE Biosystems). The purified enzyme was dialyzed against deionized water before use. Crystallization of KLrP and Data Collection—The purified recombinant KLrP was concentrated to 5 mg/ml in 25 mm MES buffer, pH 6.0, containing 100 mm NaCl. Initial screening for crystallization of KLrP was performed with the hanging drops by vapor diffusion method at 20 °C by mixing equal volumes of protein (0.5 μl) and reservoir solution (0.5 μl), using crystallization screen kit Crystal Screens (Hampton Research). The best crystal for x-ray diffraction analysis was obtained within 1 week, using 0.1 m Tris-HCl buffer, pH 8.5, containing 0.2 m magnesium chloride, 27.5% PEG3350, 5% glycerol, 0.5 m glucose or 0.5 m galactose (Crystal Screens, number 85 modified). X-ray diffraction data were collected using the synchrotron radiation source at the BL38B1 station of Spring-8 (Hyogo, Japan). Data were processed using HKL2000 (21Otwinowski Z. Minor W. Methods Enzymol. 1997; 276: 307-326Crossref PubMed Scopus (38572) Google Scholar). The crystal of KLrP in a complex with Glc (KLrP·Glc) diffracted up to 1.6 Å and belongs to the orthorhombic space group P21P21P21 with unit cell dimensions of a = 66.04 Å, b = 83.98 Å, and c = 94.89 Å. The crystal of KLrP in a complex with Gal (KLrP/Gal) diffracted up to 1.8 Å and belongs to the orthorhombic space group P21P21P21 with unit cell dimensions of a = 66.24 Å, b = 83.80 Å, and c = 93.60 Å. The data statistics are summarized in Table 2.TABLE 2Data collection and refinement statisticsData setKLrP/GlcKLrP/GalData collectionSpace groupP212121P212121Unit cell parametersa = 66.04 Åa = 66.24 Åb = 83.98 Åb = 83.80 Åc = 94.88 Åc = 94.60 ÅBeam lineSPring-8 BL38B1SPring-8 BL38B1Wavelength (Å)1.0001.000Resolution range (Å)50.0-1.650.0-1.8Number of reflectionsObserved446,923289,509Unique62,94740,776RsymaValues in parentheses are for the highest resolution shell.,bRsym = ∑(I - 〈I〉/∑〈I〉, where I is the intensity measurement for a given reflection, and 〈I〉 is the average intensity for multiple measurements of this reflection.0.133 (0.421)0.057 (0.320)I/∑ (I)aValues in parentheses are for the highest resolution shell.44.7 (5.78)35.7 (6.73)Completeness (%)89.5 (95.5)85.3 (99.9)Refinement statisticsResolution range (Å)21.4-1.638.2-1.8No. of reflectionsWorking set56,09438,042Test set3,2012,006Completeness (%)88.981.9RcrystcRcryst = ∑|Fo - Fc∑Fo, where Fo and Fc are observed and calculated structure factor amplitudes. (%)0.1880.201RfreedRfree was calculated from Rcryst, using only an undefined subset of reflection data (5.1%). (%)0.2210.236Root mean square deviationsBond length (Å)0.0080.010Bond angles (Å)1.2281.183Average B-factor (Å2)Protein15.720.9Water26.931.0Glucose/galactose21.148.1Palmitic acid38.436.6Olenoic acid38.239.5Glycerol37.6No. of atomsProtein3,8843,782Water450380Glucose/galactose1212Palmitic acid3618Olenoic acid2020Glycerol1818Ramachandran analysisMost favored (%)89.789.2Allowed (%)9.39.9Generously allowed (%)1.01.0Disallowed (%)0.00.0a Values in parentheses are for the highest resolution shell.b Rsym = ∑(I - 〈I〉/∑〈I〉, where I is the intensity measurement for a given reflection, and 〈I〉 is the average intensity for multiple measurements of this reflection.c Rcryst = ∑|Fo - Fc∑Fo, where Fo and Fc are observed and calculated structure factor amplitudes.d Rfree was calculated from Rcryst, using only an undefined subset of reflection data (5.1%). Open table in a new tab Structural Determination and Model Refinement of KLrP—The crystal structure of KLrP·Glc or that in a complex with Gal (KLrP·Gal) was determined by molecular replacement using an aphid Brevicoryne brassicae myrosinase (Protein Data Bank code 1WCG) as a search model with the program molrep (22Vagin A. Teplyakov A. J. Appl. Crystallogr. 1997; 30: 1022-1025Crossref Scopus (4152) Google Scholar). Structure refinement was done using Refmac (23Murshudov G.N. Vagin A.A. Dodson E.J. Acta Crystallogr. Sect. D. 1997; 53: 240-255Crossref PubMed Scopus (13870) Google Scholar) with diffraction data from 21.4 to 1.6 Å. After the first step of refinement, the atomic model of the protein was rebuilt using the program ARP/wARP (24Perrakis A. Morris R. Lamzin V.S. Nat. Struct. Biol. 1999; 6: 458-463Crossref PubMed Scopus (2564) Google Scholar). Iterative cycles of refinement and manual rebuilding in Coot (25Emsley P. Cowtan K. Acta Crystallogr. Sect. D. 2004; 60: 2126-2132Crossref PubMed Scopus (23384) Google Scholar) were carried out until the free R-factor converged. The stereochemical checks were carried out using PROCHECK (26Laskowski R.A. MacArthur M.W. Moss D.S. Thornton J.M. J. Appl. Crystallogr. 1993; 26: 283-291Crossref Google Scholar). Refinement statistics are summarized in Table 2. Gas-Liquid Chromatography (GC) of Fatty Acids—Purified recombinant KLrP (3 mg) was freeze-dried and dissolved in 1 ml of 5% HCl-MeOH and then heated at 80 °C for 12 h in a sealed tube. After cooling, the solution was extracted three times with hexanes. The hexane extracts were dried under N2 gas, dissolved in 2 μl of hexane, and then injected into a Shimadzu GC-14 GC (Shimadzu Co., Kyoto, Japan) equipped with a flame ionization detector and capillary column (HR-SS-10, 30 m × 0.25 mm; Shinwa Chemical Industries Ltd., Kyoto, Japan). The methyl esters detected by GC were identified by conventional methods using the retention time of a PUFA-3 standard mixture (Matrea, Inc.). Detection of Cytosolic Neutral GCase Activity—During the assay of the LacCer synthase activity of human primary fibroblasts using C6-NBD-GlcCer as an acceptor substrate and UDP-Gal as a donor substrate at pH 6.0, C6-NBD-Cer was detected on HPLC in addition to the expected product C6-NBD-LacCer (Fig. 1A). The generation of C6-NBD-Cer, which was prevented by boiling the lysate for 5 min, was significantly decreased but not completely eliminated by the addition of CBE, a potent inhibitor for acid glucocerebrosidase (GBA1) (Fig. 1A). Interestingly, the hydrolysis of C6-NBD-GlcCer to C6-NBD-Cer in the presence of CBE was observed when lysates of human fibroblasts, mouse (data not shown) and rat brains, zebrafish embryos, and puffer fish liver, but not slime mold, were used as an enzyme source (Fig. 1B). The neutral GCase activity of human fibroblasts reached a maximum at around pH 5 in the absence of CBE and at pH 6-7 in the presence of CBE (Fig. 1C). The CBE-insensitive GCase activity of rat brain was mainly recovered from the cytosolic fraction (lactate dehydrogenase-rich fraction) rather than the membrane fraction (acid glucocerebrosidase-rich fraction) (Fig. 1D). It is worth noting that a cytosolic protein capable of hydrolyzing GlcCer has yet to be reported. Candidates for a Novel Neutral GCase—We have isolated the gene encoding a neutral GCase from the bacterium Paenibacillus sp. TS12 (27Sumida T. Sueyoshi N. Ito M. J. Biochem. (Tokyo). 2002; 132: 237-243Crossref PubMed Scopus (13) Google Scholar); however, no homologous sequence has been found in the human gene data base. When CAZy (a data base describing the families of structurally related catalytic and carbohydrate-binding modules or functional domains of enzymes that degrade, modify, or create glycosidic bonds) was searched using the key words “beta/glucosidase/human,” several candidate proteins were found in glycohydrolase (GH) family 1, 9, and 30. Notably, proteins assigned to the KL family in GH1 emerged as possible candidates for the neutral GCase, because they share the β-glucosidase-like domain (GH1 domain), although their natural substrates have yet to be clarified. Furthermore, its orthologues were found in data bases of rat, zebrafish, and puffer fish, but not slime mold, consistent with the detection of the activity (Fig. 1B). Thus, we attempted to examine the neutral GCase activity of KL family proteins, including KL (14Kuro-o M. Matsumura Y. Aizawa H. Kawaguchi H. Suga T. Utsugi T. Ohyama Y. Kurabayashi M. Kaname T. Kume E. Iwasaki H. Iida A. Shiraki-Iida T. Nishikawa S. Nagai R. Nabeshima Y. Nature. 1997; 390: 45-51Crossref PubMed Scopus (2808) Google Scholar), βKL (15Ito S. Kinoshita S. Shiraishi N. Nakagawa S. Sekina S. Fujimori T. Nabeshima Y. Mech. Dev. 2000; 98: 115-119Crossref PubMed Scopus (262) Google Scholar), KL lactase phlorizin hydrolase (16Ito S. Fujimori T. Hayashizaki Y. Nabeshima Y. Biochim. Biophys. Acta. 2002; 1576: 341-345Crossref PubMed Scopus (83) Google Scholar), and KLrP (17Yahata K. Mori K. Arai H. Koide S. Ogawa Y. Mukoyama M. Sugawara A. Ozaki S. Tanaka I. Nabeshima Y. Nakao K. J. Mol. Med. 2000; 78: 389-394Crossref PubMed Scopus (46) Google Scholar), when they were expressed in CHOP cells. As a result, neutral GCase activity was found to increase in the cell lysates of the overexpressors of KLrP but not other KL family proteins (Fig. 2A), although each protein was expressed at almost the same level in CHOP cells (Fig. 2C). Interestingly, the increase in the neutral GCase activity of KLrP-overexpressing cells was much greater in the pres" @default.
• W2043466478 created "2016-06-24" @default.
• W2043466478 creator A5019075362 @default.
• W2043466478 creator A5019763301 @default.
• W2043466478 creator A5027286765 @default.
• W2043466478 creator A5033004946 @default.
• W2043466478 creator A5045942750 @default.
• W2043466478 creator A5069434243 @default.
• W2043466478 creator A5085826947 @default.
• W2043466478 date "2007-10-01" @default.
• W2043466478 modified "2023-10-17" @default.
• W2043466478 title "Klotho-related Protein Is a Novel Cytosolic Neutral β-Glycosylceramidase" @default.
• W2043466478 cites W1368384 @default.
• W2043466478 cites W1495319386 @default.
• W2043466478 cites W1515107397 @default.
• W2043466478 cites W1518481952 @default.
• W2043466478 cites W1520730837 @default.
• W2043466478 cites W1531439018 @default.
• W2043466478 cites W1539796472 @default.
• W2043466478 cites W1674715246 @default.
• W2043466478 cites W1971884283 @default.
• W2043466478 cites W1980991502 @default.
• W2043466478 cites W1983571376 @default.
• W2043466478 cites W1986191025 @default.
• W2043466478 cites W1991034359 @default.
• W2043466478 cites W1995421172 @default.
• W2043466478 cites W2002311959 @default.
• W2043466478 cites W2015370016 @default.
• W2043466478 cites W2019571467 @default.
• W2043466478 cites W2025447466 @default.
• W2043466478 cites W2034546193 @default.
• W2043466478 cites W2038840577 @default.
• W2043466478 cites W2039884825 @default.
• W2043466478 cites W2046340987 @default.
• W2043466478 cites W2049229440 @default.
• W2043466478 cites W2068015921 @default.
• W2043466478 cites W2070126973 @default.
• W2043466478 cites W2093406710 @default.
• W2043466478 cites W2097493124 @default.
• W2043466478 cites W2109315211 @default.
• W2043466478 cites W2114360920 @default.
• W2043466478 cites W2116966882 @default.
• W2043466478 cites W2125738893 @default.
• W2043466478 cites W2142115754 @default.
• W2043466478 cites W2144081223 @default.
• W2043466478 cites W2163527490 @default.
• W2043466478 cites W2171954574 @default.
• W2043466478 cites W4244088709 @default.
• W2043466478 doi "https://doi.org/10.1074/jbc.m700832200" @default.
• W2043466478 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17595169" @default.
• W2043466478 hasPublicationYear "2007" @default.
• W2043466478 type Work @default.
• W2043466478 sameAs 2043466478 @default.
• W2043466478 citedByCount "84" @default.
• W2043466478 countsByYear W20434664782012 @default.
• W2043466478 countsByYear W20434664782013 @default.
• W2043466478 countsByYear W20434664782014 @default.
• W2043466478 countsByYear W20434664782015 @default.
• W2043466478 countsByYear W20434664782016 @default.
• W2043466478 countsByYear W20434664782017 @default.
• W2043466478 countsByYear W20434664782018 @default.
• W2043466478 countsByYear W20434664782019 @default.
• W2043466478 countsByYear W20434664782020 @default.
• W2043466478 countsByYear W20434664782021 @default.
• W2043466478 countsByYear W20434664782022 @default.
• W2043466478 countsByYear W20434664782023 @default.
• W2043466478 crossrefType "journal-article" @default.
• W2043466478 hasAuthorship W2043466478A5019075362 @default.
• W2043466478 hasAuthorship W2043466478A5019763301 @default.
• W2043466478 hasAuthorship W2043466478A5027286765 @default.
• W2043466478 hasAuthorship W2043466478A5033004946 @default.
• W2043466478 hasAuthorship W2043466478A5045942750 @default.
• W2043466478 hasAuthorship W2043466478A5069434243 @default.
• W2043466478 hasAuthorship W2043466478A5085826947 @default.
• W2043466478 hasBestOaLocation W20434664781 @default.
• W2043466478 hasConcept C12554922 @default.
• W2043466478 hasConcept C134018914 @default.
• W2043466478 hasConcept C181199279 @default.
• W2043466478 hasConcept C185592680 @default.
• W2043466478 hasConcept C2780091579 @default.
• W2043466478 hasConcept C55493867 @default.
• W2043466478 hasConcept C86803240 @default.
• W2043466478 hasConcept C95444343 @default.
• W2043466478 hasConcept C9832595 @default.
• W2043466478 hasConcept C98539663 @default.
• W2043466478 hasConceptScore W2043466478C12554922 @default.
• W2043466478 hasConceptScore W2043466478C134018914 @default.
• W2043466478 hasConceptScore W2043466478C181199279 @default.
• W2043466478 hasConceptScore W2043466478C185592680 @default.
• W2043466478 hasConceptScore W2043466478C2780091579 @default.
• W2043466478 hasConceptScore W2043466478C55493867 @default.
• W2043466478 hasConceptScore W2043466478C86803240 @default.
• W2043466478 hasConceptScore W2043466478C95444343 @default.
• W2043466478 hasConceptScore W2043466478C9832595 @default.
• W2043466478 hasConceptScore W2043466478C98539663 @default.
• W2043466478 hasIssue "42" @default.
• W2043466478 hasLocation W20434664781 @default.
• W2043466478 hasOpenAccess W2043466478 @default.

• next