FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2043538721> ?p ?o ?g. }

• W2043538721 endingPage "19349" @default.
• W2043538721 startingPage "19335" @default.
• W2043538721 abstract "Dok-like adapter molecules represent an expanding family of pleckstrin homology (PH) and phosphotyrosine-binding (PTB) domain-containing tyrosine kinase substrates with negative regulatory functions in hematopoietic cell signaling. In a search for nonhematopoietic counterparts to Dok molecules, we identified and characterized Dok-4, a recently cloned member of the family. dok-4 mRNA was strongly expressed in nonhematopoietic organs, particularly the intestine, kidney, and lung, whereas both mRNA and protein were expressed at high levels in cells of epithelial origin. In Caco-2 human colon cancer cells, endogenous Dok-4 underwent tyrosine phosphorylation in response to pervanadate stimulation. In transfected COS cells, Dok-4 was a substrate for the cytosolic tyrosine kinases Src and Fyn as well as for Jak2. Dok-4 could also be phosphorylated by the receptor tyrosine kinase Ret but not by platelet-derived growth factor receptor-β or IGF-IR. In both mammalian cells and yeast, Dok-4 was constitutively localized at the membrane in a manner that required both its PH and PTB domains. The PH and PTB domains of Dok-4 were also required for tyrosine phosphorylation of Dok-4 by Fyn and Ret. Finally, wild type Dok-4 strongly inhibited activation of Elk-1 induced by either Ret or Fyn. The attenuation of this inhibitory effect by deletion of the PH domain and its restoration by the addition of a myristoylation signal suggested an important role for constitutive membrane localization of Dok-4. In summary, Dok-4 is a constitutively membrane-localized adapter molecule that may function as an inhibitor of tyrosine kinase signaling in epithelial cells. Dok-like adapter molecules represent an expanding family of pleckstrin homology (PH) and phosphotyrosine-binding (PTB) domain-containing tyrosine kinase substrates with negative regulatory functions in hematopoietic cell signaling. In a search for nonhematopoietic counterparts to Dok molecules, we identified and characterized Dok-4, a recently cloned member of the family. dok-4 mRNA was strongly expressed in nonhematopoietic organs, particularly the intestine, kidney, and lung, whereas both mRNA and protein were expressed at high levels in cells of epithelial origin. In Caco-2 human colon cancer cells, endogenous Dok-4 underwent tyrosine phosphorylation in response to pervanadate stimulation. In transfected COS cells, Dok-4 was a substrate for the cytosolic tyrosine kinases Src and Fyn as well as for Jak2. Dok-4 could also be phosphorylated by the receptor tyrosine kinase Ret but not by platelet-derived growth factor receptor-β or IGF-IR. In both mammalian cells and yeast, Dok-4 was constitutively localized at the membrane in a manner that required both its PH and PTB domains. The PH and PTB domains of Dok-4 were also required for tyrosine phosphorylation of Dok-4 by Fyn and Ret. Finally, wild type Dok-4 strongly inhibited activation of Elk-1 induced by either Ret or Fyn. The attenuation of this inhibitory effect by deletion of the PH domain and its restoration by the addition of a myristoylation signal suggested an important role for constitutive membrane localization of Dok-4. In summary, Dok-4 is a constitutively membrane-localized adapter molecule that may function as an inhibitor of tyrosine kinase signaling in epithelial cells. Increased tyrosine kinase activity is a common mechanism for initiation of intracellular signaling following stimulation of many cell surface receptors. The specificity of the information conveyed by such events is determined in large part by the amino acid context of tyrosine residues accessible for phosphorylation within the cytoplasmic tail of the involved receptor(s) and by the availability of motif-specific Src homology 2 or phosphotyrosine-binding (PTB) 1The abbreviations used are: PTB, phosphotyrosine-binding; IRS, insulin receptor substrate; PH, pleckstrin homology; RTK, receptor tyrosine kinase(s); PDGF, platelet-derived growth factor; PDGFR, PDGF receptor; PtdIns, phosphatidylinositol; EST, expressed sequence tag; RT, reverse transcription; MDCK, Madin-Darby canine kidney; GFP, green fluorescent protein; EGFP, enhanced green fluorescent protein; IP, immunoprecipitation; GDNF, glial cell line-derived neurotrophic factor; GEC, glomerular epithelial cell(s); IGF, insulin-like growth factor; GST, glutathione S-transferase. domain-containing partner molecules (1Schlessinger J. Lemmon M.A. Science's STKE.http://stke.sciencemag.org/cgi/content/full/OC_sigtrans;2003/191/re12Date: 2003Google Scholar), including adapter molecules. While devoid of enzymatic activity, adapter molecules often contain additional sites for tyrosine phosphorylation and can generate signaling complexes through protein-protein and protein-lipid interactions in a phosphorylation-dependent or -independent manner, leading to signal amplification or diversification (2Pawson T. Scott J.D. Science. 1997; 278: 2075-2080Google Scholar). One example of a well characterized adapter molecule involved in tyrosine kinase signaling is the insulin receptor substrate (IRS)-1 molecule. IRS-1 belongs to a family of at least four members with overlapping yet distinct tissue expression patterns (3White M.F. Yenush L. Curr. Top. Microbiol. Immunol. 1998; 228: 179-208Google Scholar, 4Sun X.J. Wang L.M. Zhang Y. Yenush L. Myers Jr., M.G. Glasheen E. Lane W.S. Pierce J.H. White M.F. Nature. 1995; 377: 173-177Google Scholar, 5Patti M.E. Sun X.J. Bruening J.C. Araki E. Lipes M.A. White M.F. Kahn C.R. J. Biol. Chem. 1995; 270: 24670-24673Google Scholar, 6Anai M. Ono H. Funaki M. Fukushima Y. Inukai K. Ogihara T. Sakoda H. Onishi Y. Yazaki Y. Kikuchi M. Oka Y. Asano T. J. Biol. Chem. 1998; 273: 29686-29692Google Scholar). IRS molecules are characterized by an amino-terminal pleckstrin homology (PH) domain immediately followed by a PTB domain and a C-terminal region of variable length containing potential docking sites for Src homology 2 domains. IRS-1 interacts with both membrane phospholipids and with the phosphorylated insulin receptor through its PH and PTB domains, respectively (7Whitehead J.P. Clark S.F. Urso B. James D.E. Curr. Opin. Cell Biol. 2000; 12: 222-228Google Scholar). Following tyrosine phosphorylation by the insulin receptor, IRS-1 allows the recruitment and activation of phosphatidylinositol 3-kinase through multiple YXXM motifs contained in its sequence. In addition, perhaps because its association with the membrane and the insulin receptor is weak and transient, IRS-1 can translocate from the membrane to other cellular compartments where its signal is propagated (8Clark S.F. Martin S. Carozzi A.J. Hill M.M. James D.E. J. Cell Biol. 1998; 140: 1211-1225Google Scholar). Recently, the Dok family of adapter molecules (including Dok-1, -2, and -3) has emerged as an expanding group of related signaling molecules composed of an amino-terminal tandem of PH and PTB domains reminiscent of IRS molecules. Dok-1 was identified as a major 62-kDa RasGAP-associated phosphoprotein in v-Abl-transformed B cells and in Bcr-Abl-expressing leukemic cells (9Yamanashi Y. Baltimore D. Cell. 1997; 88: 205-211Google Scholar, 10Carpino N. Wisniewski D. Strife A. Marshak D. Kobayashi R. Stillman B. Clarkson B. Cell. 1997; 88: 197-204Google Scholar). Subsequently, Dok-2 was identified as a partner for the interleukin-4 receptor (11Nelms K. Snow A.L. Hu-Li J. Paul W.E. Immunity. 1998; 9: 13-24Google Scholar) and the angiopoietin receptor Tie-2 (12Jones N. Dumont D.J. Oncogene. 1998; 17: 1097-1108Google Scholar) and as a substrate of the Src family tyrosine kinase Lyn (13Lock P. Casagranda F. Dunn A.R. J. Biol. Chem. 1999; 274: 22775-22784Google Scholar). We and others cloned a third member, Dok-3, as a molecule associating with the tyrosine kinases Abl (14Cong F. Yuan B. Goff S.P. Mol. Cell. Biol. 1999; 19: 8314-8325Google Scholar) and Csk (15Lemay S. Davidson D. Latour S. Veillette A. Mol. Cell. Biol. 2000; 20: 2743-2754Google Scholar). The first three members of the Dok family (in particular Dok-2 and Dok-3) are primarily expressed in hematopoietic cells (11Nelms K. Snow A.L. Hu-Li J. Paul W.E. Immunity. 1998; 9: 13-24Google Scholar, 14Cong F. Yuan B. Goff S.P. Mol. Cell. Biol. 1999; 19: 8314-8325Google Scholar, 15Lemay S. Davidson D. Latour S. Veillette A. Mol. Cell. Biol. 2000; 20: 2743-2754Google Scholar). dok-1 is also expressed at significant, although reduced levels in nonhematopoietic tissues (9Yamanashi Y. Baltimore D. Cell. 1997; 88: 205-211Google Scholar, 10Carpino N. Wisniewski D. Strife A. Marshak D. Kobayashi R. Stillman B. Clarkson B. Cell. 1997; 88: 197-204Google Scholar, 16Lemay S. Rabb H. Postler G. Singh A.K. Transplantation. 2000; 69: 959-963Google Scholar). These three molecules can serve as substrates for cytosolic tyrosine kinases of the Abl and Src families (15Lemay S. Davidson D. Latour S. Veillette A. Mol. Cell. Biol. 2000; 20: 2743-2754Google Scholar), which allows them to recruit Src homology 2 domain-containing molecules such as RasGAP, Csk, and SHIP-1 (9Yamanashi Y. Baltimore D. Cell. 1997; 88: 205-211Google Scholar, 15Lemay S. Davidson D. Latour S. Veillette A. Mol. Cell. Biol. 2000; 20: 2743-2754Google Scholar). In addition, Dok-1 and/or Dok-2 may be phosphorylated by a variety of receptor tyrosine kinases (RTK) including macrophage colony-stimulating factor receptor (17Heidaran M.A. Molloy C.J. Pangelinan M. Choudhury G.G. Wang L.M. Fleming T.P. Sakaguchi A.Y. Pierce J.H. Oncogene. 1992; 7: 147-152Google Scholar), vascular endothelial growth factor receptor (18Guo D. Jia Q. Song H.Y. Warren R.S. Donner D.B. J. Biol. Chem. 1995; 270: 6729-6733Google Scholar), insulin receptor (19Noguchi T. Matozaki T. Inagaki K. Tsuda M. Fukunaga K. Kitamura Y. Kitamura T. Shii K. Yamanashi Y. Kasuga M. EMBO J. 1999; 18: 1748-1760Google Scholar), epidermal growth factor receptor (20Jones N. Dumont D.J. Curr. Biol. 1999; 9: 1057-1060Google Scholar), platelet-derived growth factor receptor (PDGFR) (21Zhao M. Schmitz A.A. Qin Y. Di Cristofano A. Pandolfi P.P. Van Aelst L. J. Exp. Med. 2001; 194: 265-274Google Scholar), Tie-2 (12Jones N. Dumont D.J. Oncogene. 1998; 17: 1097-1108Google Scholar), Ret (22Murakami H. Yamamura Y. Shimono Y. Kawai K. Kurokawa K. Takahashi M. J. Biol. Chem. 2002; 277: 32781-32790Google Scholar), and c-Kit (23van Dijk T.B. van Den Akker E. Amelsvoort M.P. Mano H. Lowenberg B. von Lindern M. Blood. 2000; 96: 3406-3413Google Scholar), although the last seems to also require Src kinase activity (24Liang X. Wisniewski D. Strife A. Shivakrupa Clarkson B. Resh M.D. J. Biol. Chem. 2002; 277: 13732-13738Google Scholar). Dok-1 can also be phosphorylated in response to cell adhesion (19Noguchi T. Matozaki T. Inagaki K. Tsuda M. Fukunaga K. Kitamura Y. Kitamura T. Shii K. Yamanashi Y. Kasuga M. EMBO J. 1999; 18: 1748-1760Google Scholar), presumably because its PTB domain interacts with various β-integrin chains (25Calderwood D.A. Fujioka Y. de Pereda J.M. Garcia-Alvarez B. Nakamoto T. Margolis B. McGlade C.J. Liddington R.C. Ginsberg M.H. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 2272-2277Google Scholar). It is believed that IRS and Dok proteins function as docking molecules with regulated membrane-targeting properties (3White M.F. Yenush L. Curr. Top. Microbiol. Immunol. 1998; 228: 179-208Google Scholar, 21Zhao M. Schmitz A.A. Qin Y. Di Cristofano A. Pandolfi P.P. Van Aelst L. J. Exp. Med. 2001; 194: 265-274Google Scholar, 23van Dijk T.B. van Den Akker E. Amelsvoort M.P. Mano H. Lowenberg B. von Lindern M. Blood. 2000; 96: 3406-3413Google Scholar, 34Jacobs A.R. LeRoith D. Taylor S.I. J. Biol. Chem. 2001; 276: 40795-40802Google Scholar). Whereas inducible membrane localization may be a common feature of these molecules, the mechanisms through which this occurs may vary. For instance, phosphatidylinositol 3-kinase-generated phosphoinositides seem necessary for membrane targeting and phosphorylation of Dok-1 in response to PDGF stimulation (21Zhao M. Schmitz A.A. Qin Y. Di Cristofano A. Pandolfi P.P. Van Aelst L. J. Exp. Med. 2001; 194: 265-274Google Scholar), but they are not involved in IRS-1 recruitment to the insulin receptor. Moreover, among the different members of the IRS family, distinct patterns of intracellular distribution have been observed (6Anai M. Ono H. Funaki M. Fukushima Y. Inukai K. Ogihara T. Sakoda H. Onishi Y. Yazaki Y. Kikuchi M. Oka Y. Asano T. J. Biol. Chem. 1998; 273: 29686-29692Google Scholar). The PH domain of Dok-1 is necessary and sufficient for phosphatidylinositol 3-kinase-mediated membrane translocation (21Zhao M. Schmitz A.A. Qin Y. Di Cristofano A. Pandolfi P.P. Van Aelst L. J. Exp. Med. 2001; 194: 265-274Google Scholar), and the PH domain of IRS-1 appears equally important in subcellular targeting and function (34Jacobs A.R. LeRoith D. Taylor S.I. J. Biol. Chem. 2001; 276: 40795-40802Google Scholar, 35Yenush L. Makati K.J. Smith-Hall J. Ishibashi O. Myers Jr., M.G. White M.F. J. Biol. Chem. 1996; 271: 24300-24306Google Scholar). PH domains form a family of highly divergent amino acid sequences with a remarkably conserved tridimensional structure (reviewed in Ref. 36Lemmon M.A. Ferguson K.M. Curr. Top. Microbiol. Immunol. 1998; 228: 39-74Google Scholar). They are generally believed to bind phospholipids and as such serve as membrane-targeting domains. Some PH domains, such as that of Btk, display specificity for binding products of phosphatidylinositol 3-kinase metabolism (37Salim K. Bottomley M.J. Querfurth E. Zvelebil M.J. Gout I. Scaife R. Margolis R.L. Gigg R. Smith C.I. Driscoll P.C. Waterfield M.D. Panayotou G. EMBO J. 1996; 15: 6241-6250Google Scholar), which allows their membrane localization to be regulated (38Bolland S. Pearse R.N. Kurosaki T. Ravetch J.V. Immunity. 1998; 8: 509-516Google Scholar). However, unlike that of Btk, most PH domains studied so far bind phospholipids with low affinity and specificity (39Kavran J.M. Klein D.E. Lee A. Falasca M. Isakoff S.J. Skolnik E.Y. Lemmon M.A. J. Biol. Chem. 1998; 273: 30497-30508Google Scholar), and the identity of their physiological ligands therefore remains controversial (40Lemmon M.A. Ferguson K.M. Biochem. J. 2000; 350: 1-18Google Scholar). Nevertheless, it has been postulated that either post-translational modification (such as serine/threonine or tyrosine phosphorylation) or oligomerization might enable low affinity PH domain-containing molecules to bind membranes with more avidity (40Lemmon M.A. Ferguson K.M. Biochem. J. 2000; 350: 1-18Google Scholar). PTB domains are structurally related to PH domains (41Borg J.P. Margolis B. Curr. Top. Microbiol. Immunol. 1998; 228: 23-38Google Scholar, 42Blomberg N. Baraldi E. Nilges M. Saraste M. Trends Biochem. Sci. 1999; 24: 441-445Google Scholar). Like PH domains, some PTB domains may bind phospholipids (43Howell B.W. Lanier L.M. Frank R. Gertler F.B. Cooper J.A. Mol. Cell. Biol. 1999; 19: 5179-5188Google Scholar, 44Ravichandran K.S. Zhou M.M. Pratt J.C. Harlan J.E. Walk S.F. Fesik S.W. Burakoff S.J. Mol. Cell. Biol. 1997; 17: 5540-5549Google Scholar), although they mainly serve as protein-protein interaction modules (1Schlessinger J. Lemmon M.A. Science's STKE.http://stke.sciencemag.org/cgi/content/full/OC_sigtrans;2003/191/re12Date: 2003Google Scholar, 45Forman-Kay J.D. Pawson T. Curr. Opin. Struct. Biol. 1999; 9: 690-695Google Scholar). Whereas the typical target peptide initially described for the PTB domains of Shc and IRS-1 is a phosphorylated NPXY sequence (46Zhou S. Margolis B. Chaudhuri M. Shoelson S.E. Cantley L.C. J. Biol. Chem. 1995; 270: 14863-14866Google Scholar, 47Wolf G. Trub T. Ottinger E. Groninga L. Lynch A. White M.F. Miyazaki M. Lee J. Shoelson S.E. J. Biol. Chem. 1995; 270: 27407-27410Google Scholar), it has more recently been recognized that many PTB domains can bind peptide sequences in a phosphorylation-independent (48Borg J.P. Ooi J. Levy E. Margolis B. Mol. Cell. Biol. 1996; 16: 6229-6241Google Scholar) or in a tyrosine-independent manner (49Charest A. Wagner J. Jacob S. McGlade C.J. Tremblay M.L. J. Biol. Chem. 1996; 271: 8424-8429Google Scholar, 50Ong S.H. Guy G.R. Hadari Y.R. Laks S. Gotoh N. Schlessinger J. Lax I. Mol. Cell. Biol. 2000; 20: 979-989Google Scholar, 51Meyer D. Liu A. Margolis B. J. Biol. Chem. 1999; 274: 35113-35118Google Scholar, 52Chien C.T. Wang S. Rothenberg M. Jan L.Y. Jan Y.N. Mol. Cell. Biol. 1998; 18: 598-607Google Scholar). Whereas PH and PTB domains co-exist in IRS and Dok family proteins, a related adapter molecule, FRS2, possesses a myristoylation signal instead of a PH domain (53Kouhara H. Hadari Y.R. Spivak-Kroizman T. Schilling J. Bar-Sagi D. Lax I. Schlessinger J. Cell. 1997; 89: 693-702Google Scholar), presumably bypassing the requirement for PtdIns binding in membrane targeting. In contrast to IRS family members and other RTK-associated adapter molecules, which are generally involved in signal amplification, Dok family molecules have been shown to function primarily as inhibitors of tyrosine kinase signaling (14Cong F. Yuan B. Goff S.P. Mol. Cell. Biol. 1999; 19: 8314-8325Google Scholar, 15Lemay S. Davidson D. Latour S. Veillette A. Mol. Cell. Biol. 2000; 20: 2743-2754Google Scholar, 26Tamir I. Stolpa J.C. Helgason C.D. Nakamura K. Bruhns P. Daeron M. Cambier J.C. Immunity. 2000; 12: 347-358Google Scholar, 27Yamanashi Y. Tamura T. Kanamori T. Yamane H. Nariuchi H. Yamamoto T. Baltimore D. Genes Dev. 2000; 14: 11-16Google Scholar, 28Suzu S. Tanaka-Douzono M. Nomaguchi K. Yamada M. Hayasawa H. Kimura F. Motoyoshi K. EMBO J. 2000; 19: 5114-5122Google Scholar, 29Di Cristofano A. Niki M. Zhao M. Karnell F.G. Clarkson B. Pear W.S. Van Aelst L. Pandolfi P.P. J. Exp. Med. 2001; 194: 275-284Google Scholar). Since Dok molecules had been found to be prominent Src kinase substrates in hematopoietic cells, we hypothesized that additional nonhematopoietic family members might also exist to serve as substrates downstream of these ubiquitously expressed kinases. In the current study, we present evidence that a novel Dok family member, Dok-4, is expressed prominently in epithelial cells and can be phosphorylated by a number of tyrosine kinases, including Src family members. The structural basis of Dok-4 tyrosine phosphorylation was studied as well as its relationship to intracellular localization. Surprisingly, we found that Dok-4 was constitutively membrane-associated in mammalian cells as well as in yeast, through a mechanism that required both its PH and PTB domains. Tyrosine phosphorylation of Dok-4 also required an intact PH and PTB domain. Finally, Dok-4 inhibited the tyrosine kinase-induced activation of the transcription factor Elk-1, suggesting that inhibitory signaling is a general property of Dok family molecules. Ribonuclease Protection Assay—RNase protection assays were performed essentially as described previously (15Lemay S. Davidson D. Latour S. Veillette A. Mol. Cell. Biol. 2000; 20: 2743-2754Google Scholar, 54Lemay S. Mao C. Singh A.K. Kidney Int. 1996; 50: 85-93Google Scholar) with minor modifications. Radiolabeled antisense RNA probes were prepared by in vitro transcription (Promega kit) of appropriate cDNA templates in the presence of [α-32P]UTP (PerkinElmer Life Sciences). The templates for probe synthesis were as follows. For dok-4, pBluescriptSK-D4RPA was prepared by subcloning the EcoRI/XmnI fragment from expressed sequence tag (EST) W85217 (a putative splice variant of dok-4 containing a 62-bp deletion compared with wild-type dok-4) into the EcoRI/SmaI sites of the pBluescriptSK vector. After linearization with EcoRI and transcription with T3 RNA polymerase, this resulted in a probe of ∼325 nucleotides when undigested. Because of the internal position of its 62-bp deletion (presumably allowing loop formation in the sense RNA transcripts with full protection of some antisense probes), this probe resulted in RNase-protected fragments of 255 and 211 nucleotides when hybridized to full-length dok-4 (data not shown). For dok-5, a template containing nucleotides -9 to 293 of murine dok-5 was derived from plasmid pPCR-Script-Dok-5 (see below) by BglII/EcoRI digestion and vector religation. After linearization with NotI and transcription with T7 RNA polymerase, the resulting probe had ∼395 nucleotides when undigested and 302 nucleotides when RNase-protected. A probe for the L32 riboprotein transcript (template from BD Pharmingen; 141 nucleotides undigested, 112 nucleotides protected) was included with each dok-4 and dok-5 hybridization reaction to ensure equal loading. Each sample contained 25 μg of total RNA obtained from organs of adult CD-1 mice using the TRIzol reagent (Invitrogen). Cloning of dok-4 and dok-5—The full-length murine dok-4 cDNA was obtained from EST AA111459 and later cloned independently by reverse transcription (RT)-PCR from mouse kidney RNA to confirm the sequence. The oligonucleotides used to clone dok-4 were AACCATGGCGACCAATTTCA (4-3) and CAGCTCCTCGAGGCTGTC (4-2). The full-length murine dok-5 cDNA was obtained by RT-PCR cloning using oligonucleotides derived from the consensus sequence of ESTs AK012430 and AU051646 as follows. First, mouse brain total RNA was reverse transcribed using oligonucleotide GAAAATCACACAAATCCACA (6-4). An initial PCR was performed using oligonucleotides AAAGTGGCTGCTGGGCG (6-7) and 6-4 (see above), followed by a second nested PCR with oligonucleotides CTGTCTGGGATGGCTTCCAA (6-5) and 6-4. All PCR products were blunt-ended and cloned in the SrfI site of the pPCR-Script vector (Stratagene). All constructs were fully sequenced (Sheldon Biotechnology Centre, McGill University). Cells—COS-1 and 293 cells as well as primary mouse mesangial cells (from Dr. D. Baran) were cultured in high glucose Dulbecco's modified Eagle's medium containing pyridoxine-HCl and sodium pyruvate (Invitrogen) with 10% fetal bovine serum (Invitrogen). Caco-2 human colon cancer cells (from Dr. C. Stanners) were cultured in α-minimal essential medium containing ribonucleosides and deoxyribonucleosides (Invitrogen) and 10% fetal bovine serum. Differentiated Caco-2 cells were obtained by keeping fully confluent monolayers in culture for 14 days with medium change every 2-3 days. LLC-PK1 cells (from Dr. J. Orlowski) were grown in RPMI 1640 with 6% fetal bovine serum. MDCK cells (from ATCC) were grown in minimal essential medium containing Earle's salts, NaHCO3, nonessential amino acids, and sodium pyruvate. Parental and cytosolic phospholipase A2-transfected rat glomerular epithelial cells (GEC and GEC-cPLA2, from Dr. A. Cybulsky) were grown in K1 medium as described previously (55Takano T. Cybulsky A.V. Am. J. Pathol. 2000; 156: 2091-2101Google Scholar). RT-PCR Expression Studies—RNA was extracted with the TRIzol reagent (Invitrogen). Human umbilical vein endothelial cell total RNA was obtained from Dr. M.-J. Hébert. Glomerular RNA was obtained from Sprague-Dawley rats after differential sieving of a kidney cortex preparation (55Takano T. Cybulsky A.V. Am. J. Pathol. 2000; 156: 2091-2101Google Scholar). Reverse transcription was performed with Superscript II enzyme (Invitrogen) in the presence of oligo(dT)12-18 primer. For dok-4, the primer sequences were AACCATGGCGACCAATTTCA (4-3) and ATAGCTGGAGGCTTCAGC (4-10). The sequences of the β-actin oligonucleotides (derived from the rat sequence) were AGCCATGTACGTAGCCATCC (β-actin sense) and GCCATCTCTTGCTCGAAGTC (β-actin antisense). The size of the expected PCR products was 862 bp for dok-4 and 298 bp for β-actin. The PCRs were performed with Taq DNA polymerase (Amersham Biosciences) under the following conditions: 1.5 mm MgCl2, 52 °C annealing temperature, 30 cycles (for dok-4) or 28 cycles (for β-actin). Aliquots of PCRs representing ∼80 ng of initial RNA were loaded for agarose gel electrophoresis. cDNAs—The human PDGFR-β cDNA cloned in the pCDNA3 vector was from Dr. S. Meloche. The human wild-type and activated (C634R) Ret cDNA (from Dr. Lois Mulligan) were subcloned in the pCDNA3.1 vector. The pCI-IGF-IR plasmid was from Dr. D. LeRoith. The pME18S vectors containing cDNAs for mouse Fyn (wild-type and kinase-negative), Src, and Csk were from Dr. T. Yamamoto. The Jak2 cDNA cloned in vector pRK5 was from Dr. J. Ihle. The murine Dok-1 cDNA was obtained from Dr. Y. Yamanashi. The pFC-MEKK1 plasmid containing the activated (N-terminal deletion mutant) of MEKK1 was purchased from Stratagene. Mammalian Expression Constructs for Dok Proteins—The dok-4 cDNA originally cloned in pPCR-Script vector (see above) was sub-cloned in the pCDNA3.1 mammalian expression vector (Invitrogen). All sequence modifications were performed by PCR using the proofreading Pwo DNA polymerase (Roche Applied Science). Dok-1 and Dok-4 were tagged with a Myc epitope by replacing their stop codon with an in-frame Hind III site and cloning in the pCDNA3.1(-)Myc-His A vector (Invitrogen). A Myc-tagged Dok-5 construct was also created with the same vector after replacing the stop codon with an in-frame KpnI site. The antisense oligonucleotides used for these three constructs were, respectively, as follows: TTAAGCTTGGTGGAACCCTCAGACTT (Dok-1 Myc), TTAAGCTTCTGGGCAGGGGTCTTGG (Dok-4 Myc), and ATATAGGTACCGTGCTCAGACCGGTAGGT (Dok-5 Myc) (restriction sites underlined). The Dok-4 Myc ΔCT mutant (deletion of amino acids 234-325) was created with the antisense oligonucleotide CTGTATAAGCTTCTGCTCGGCGATGGCCAG (D4ΔCT). Dok-4 ΔPH (deletion of amino acids 1-99) was generated with the sense oligonucleotide CAACCATGGCGACCAATTTCAACGCAGAAGAGTGGTACAAG (D4ΔPH). The PCR product was cloned in pPCR-Script with the initiation codon toward the EcoRI site. The EcoRI/PpuMI fragment resulting from this was used to replace the corresponding sequence in pCDNA3.1-Dok-4 Myc. Dok-4 Myc Myr-ΔPH (substitution of amino acids 1-99 of Dok-4 by amino acids 1-6 of FRS2 (53Kouhara H. Hadari Y.R. Spivak-Kroizman T. Schilling J. Bar-Sagi D. Lax I. Schlessinger J. Cell. 1997; 89: 693-702Google Scholar)) was generated with the sense oligonucleotide TATGAATTCACCATGGGCTCATGTTGTTCGGCAGAAGAGTGGTACAA (EcoRI site underlined), followed by EcoRI/PpuMI exchange as above. Dok-4 Myc ΔPTB (deletion of amino acids 100-233) was generated by overlap PCR using the sense oligonucleotide TCAGAGCTGGAGCACAAGCGGGTCCTGCTG and the antisense oligonucleotide GACCCGCTTGTGCTCCAGCTCTGAGTCACA. The BGHR antisense and T7 sense oligonucleotides (Invitrogen) derived from pCDNA3.1 were used to complete the reactions. The final PCR product was used for an EcoRI/PpuMI exchange as above. For fusion of Dok molecules to enhanced green fluorescent protein (EGFP), the NheI/HindIII inserts from pCDNA3.1Myc constructs were cloned in-frame in the NheI/HindIII sites of pEGFP-N1 vector (Clontech). Dok-4 PH-EGFP (fusion of amino acids 1-108 of Dok-4 to EGFP) was obtained by PCR amplification with the antisense oligonucleotide TATAAAGCTTGGACAGTGTCTTGATCCA (HindIII site underlined) and cloning of the resulting NheI/HindIII in pEGFP-N1. The Dok-1 Myc Y146F mutant was generated using overlap PCR with oligonucleotides GAGAATTCGCTGTTCAGCCCCACCTGG (D1Y146F sense) and CCAGGTGGGGCTGAACAGCGAATTCTC (D1Y146F antisense), completed by BGHR and T7 (see above). COS Cell Tranfections—One day prior to transfection, COS-1 cells were trypsinized and plated on 100-mm culture dishes at a density of ∼25%. Transfection was performed with LipofectAMINE 2000 reagent (Invitrogen) in a ratio of 3 μl per μg of plasmid. After overnight incubation, 1 volume of Dulbecco's modified Eagle's medium with 20% fetal bovine serum and 2× penicillin/streptomycin was added. The next morning, cells were washed in PBS, collected by scraping, and lysed in ice-cold immunoprecipitation (IP) buffer. Where applicable, stimulation with IGF-IR was performed with the addition of human IGF-IR (PeproTech) (100 ng/ml) prior to lysis. Antibodies—Monoclonal antibodies against the Myc epitope (9E10; sc-40), as well as polyclonal antibodies against Fyn (sc-16), Csk (sc-286), Ret (sc-167), PDGFR-β (sc-432), and Dok-1 (sc-6934) were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Rabbit anti-Myc polyclonal antibody (used for all anti-Myc immunoblots) was from Cell Signaling. Anti-phosphotyrosine monoclonal antibody (4G10), as well as anti-Src and anti-Jak2 polyclonal antibodies, were purchased from Upstate Biotechnology, Inc. (Lake Placid, NY). Anti-Dok-4 antiserum was generated by immunizing rabbits with a bacterially expressed GST fusion protein containing amino acids 234-325 of Dok-4, a strategy similar to that previously employed to obtain anti-Dok-1, -2, and -3 antisera (15Lemay S. Davidson D. Latour S. Veillette A. Mol. Cell. Biol. 2000; 20: 2743-2754Google Scholar). Immunoprecipitation and Immunoblotting—Cells were lysed on ice in buffer consisting of 50 mm Tris-HCl (pH 8.0), 2 mm EDTA, 1% Nonidet P-40, 100 mm sodium fluoride, 10 mm sodium pyrosphosphate, 1 mm sodium orthovanadate, 0.1 mm phenylmethylsulfonyl fluoride, 2 μg/ml leupeptin, 1 μg/ml aprotinin, and 0.7 μg/ml pepstatin A. IP was performed by the addition of either 1 or 2 μg of affinity-purified antibody or 5 μl of Dok-4 antiserum followed by 8 μl of protein A-agarose beads (Santa Cruz Biotechnology). For monoclonal antibodies, protein A-agarose was precoupled to 5 μg of rabbit anti-mouse IgG (Jackson Immunoresearch). After three washes, immunoprecipitates were eluted in 1× Laemmli buffer, boiled, and resolved on an SDS-polyacrylamide gel. Proteins were transferred to polyvinylidene difluoride membranes (Hybond P; Amersham Biosciences), and immunodetection was performed according to a standard protocol using horseradish peroxidase-labeled secondary antibodies (Amersham Biosciences) and ECL or ECL Plus detection solutions (Amersham Biosciences). Inducible Expression of Dok-4-EGFP in 293 Cells—293 cells were stably transfected with the pVgRXR vector (Invitrogen) and selected in zeomycin (300 μg/ml). Individual clones confirmed to overexpres" @default.
• W2043538721 created "2016-06-24" @default.
• W2043538721 creator A5008528503 @default.
• W2043538721 creator A5024023421 @default.
• W2043538721 creator A5034101987 @default.
• W2043538721 creator A5054224462 @default.
• W2043538721 creator A5057779986 @default.
• W2043538721 date "2004-04-01" @default.
• W2043538721 modified "2023-10-09" @default.
• W2043538721 title "Pleckstrin Homology and Phosphotyrosine-binding Domain-dependent Membrane Association and Tyrosine Phosphorylation of Dok-4, an Inhibitory Adapter Molecule Expressed in Epithelial Cells" @default.
• W2043538721 cites W1507160997 @default.
• W2043538721 cites W1508994506 @default.
• W2043538721 cites W1566581202 @default.
• W2043538721 cites W1887759764 @default.
• W2043538721 cites W1964881184 @default.
• W2043538721 cites W1967352670 @default.
• W2043538721 cites W1969751051 @default.
• W2043538721 cites W1972172786 @default.
• W2043538721 cites W1972974751 @default.
• W2043538721 cites W1975731076 @default.
• W2043538721 cites W1978531552 @default.
• W2043538721 cites W1981552687 @default.
• W2043538721 cites W1982142716 @default.
• W2043538721 cites W1985113364 @default.
• W2043538721 cites W1990883677 @default.
• W2043538721 cites W1991592196 @default.
• W2043538721 cites W2007458155 @default.
• W2043538721 cites W2007727729 @default.
• W2043538721 cites W2016441216 @default.
• W2043538721 cites W2025870139 @default.
• W2043538721 cites W2032062053 @default.
• W2043538721 cites W2032407944 @default.
• W2043538721 cites W2040063654 @default.
• W2043538721 cites W2045929031 @default.
• W2043538721 cites W2049761828 @default.
• W2043538721 cites W2056462157 @default.
• W2043538721 cites W2059378930 @default.
• W2043538721 cites W2066195224 @default.
• W2043538721 cites W2070193928 @default.
• W2043538721 cites W2070362107 @default.
• W2043538721 cites W2071940759 @default.
• W2043538721 cites W2075645766 @default.
• W2043538721 cites W2078920527 @default.
• W2043538721 cites W2079270029 @default.
• W2043538721 cites W2080361561 @default.
• W2043538721 cites W2082176941 @default.
• W2043538721 cites W2088882706 @default.
• W2043538721 cites W2089112795 @default.
• W2043538721 cites W2089314674 @default.
• W2043538721 cites W2093670935 @default.
• W2043538721 cites W2094173028 @default.
• W2043538721 cites W2097137746 @default.
• W2043538721 cites W2098494612 @default.
• W2043538721 cites W2107551117 @default.
• W2043538721 cites W2113438288 @default.
• W2043538721 cites W2122393978 @default.
• W2043538721 cites W2123209706 @default.
• W2043538721 cites W2123379707 @default.
• W2043538721 cites W2124615128 @default.
• W2043538721 cites W2130370264 @default.
• W2043538721 cites W2134484762 @default.
• W2043538721 cites W2136188534 @default.
• W2043538721 cites W2139380465 @default.
• W2043538721 cites W2141206157 @default.
• W2043538721 cites W2142543015 @default.
• W2043538721 cites W2145545657 @default.
• W2043538721 cites W2152847526 @default.
• W2043538721 cites W2154230667 @default.
• W2043538721 cites W2162051767 @default.
• W2043538721 cites W2165080661 @default.
• W2043538721 cites W2417505128 @default.
• W2043538721 cites W53296430 @default.
• W2043538721 doi "https://doi.org/10.1074/jbc.m310689200" @default.
• W2043538721 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/14963042" @default.
• W2043538721 hasPublicationYear "2004" @default.
• W2043538721 type Work @default.
• W2043538721 sameAs 2043538721 @default.
• W2043538721 citedByCount "33" @default.
• W2043538721 countsByYear W20435387212012 @default.
• W2043538721 countsByYear W20435387212014 @default.
• W2043538721 countsByYear W20435387212017 @default.
• W2043538721 countsByYear W20435387212018 @default.
• W2043538721 countsByYear W20435387212020 @default.
• W2043538721 countsByYear W20435387212022 @default.
• W2043538721 countsByYear W20435387212023 @default.
• W2043538721 crossrefType "journal-article" @default.
• W2043538721 hasAuthorship W2043538721A5008528503 @default.
• W2043538721 hasAuthorship W2043538721A5024023421 @default.
• W2043538721 hasAuthorship W2043538721A5034101987 @default.
• W2043538721 hasAuthorship W2043538721A5054224462 @default.
• W2043538721 hasAuthorship W2043538721A5057779986 @default.
• W2043538721 hasBestOaLocation W20435387211 @default.
• W2043538721 hasConcept C108636557 @default.
• W2043538721 hasConcept C11960822 @default.
• W2043538721 hasConcept C153911025 @default.
• W2043538721 hasConcept C177917778 @default.
• W2043538721 hasConcept C183786373 @default.
• W2043538721 hasConcept C185592680 @default.

• next