FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2043932014> ?p ?o ?g. }

• W2043932014 endingPage "32276" @default.
• W2043932014 startingPage "32268" @default.
• W2043932014 abstract "The 5′ cap and 3′ poly(A) tail of eukaryotic mRNAs cooperate to stimulate synergistically translation initiationin vivo, a phenomenon observed to date in vitroonly in translation systems containing endogenous competitor mRNAs. Here we describe nuclease-treated rabbit reticulocyte lysates and HeLa cell cytoplasmic extracts that reproduce cap-poly(A) synergy in the absence of such competitor RNAs. Extracts were rendered poly(A)-dependent by ultracentrifugation to partially deplete them of ribosomes and associated initiation factors. Under optimal conditions, values for synergy in reticulocyte lysates approached 10-fold. By using this system, we investigated the molecular mechanism of poly(A) stimulation of translation. Maximal cap-poly(A) cooperativity required the integrity of the eukaryotic initiation factor 4G-poly(A)-binding protein (eIF4G-PABP) interaction, suggesting that synergy results from mRNA circularization. In addition, polyadenylation stimulated uncapped cellular mRNA translation and that driven by the encephalomyocarditis virus internal ribosome entry segment (IRES). These effects of poly(A) were also sensitive to disruption of the eIF4G-PABP interaction, suggesting that 5′–3′ end cross-talk is functionally conserved between classical mRNAs and an IRES-containing mRNA. Finally, we demonstrate that a rotaviral non-structural protein that evicts PABP from eIF4G is capable of provoking the shut-off of host cell translation seen during rotavirus infection. The 5′ cap and 3′ poly(A) tail of eukaryotic mRNAs cooperate to stimulate synergistically translation initiationin vivo, a phenomenon observed to date in vitroonly in translation systems containing endogenous competitor mRNAs. Here we describe nuclease-treated rabbit reticulocyte lysates and HeLa cell cytoplasmic extracts that reproduce cap-poly(A) synergy in the absence of such competitor RNAs. Extracts were rendered poly(A)-dependent by ultracentrifugation to partially deplete them of ribosomes and associated initiation factors. Under optimal conditions, values for synergy in reticulocyte lysates approached 10-fold. By using this system, we investigated the molecular mechanism of poly(A) stimulation of translation. Maximal cap-poly(A) cooperativity required the integrity of the eukaryotic initiation factor 4G-poly(A)-binding protein (eIF4G-PABP) interaction, suggesting that synergy results from mRNA circularization. In addition, polyadenylation stimulated uncapped cellular mRNA translation and that driven by the encephalomyocarditis virus internal ribosome entry segment (IRES). These effects of poly(A) were also sensitive to disruption of the eIF4G-PABP interaction, suggesting that 5′–3′ end cross-talk is functionally conserved between classical mRNAs and an IRES-containing mRNA. Finally, we demonstrate that a rotaviral non-structural protein that evicts PABP from eIF4G is capable of provoking the shut-off of host cell translation seen during rotavirus infection. eukaryotic initiation factor poly(A)-binding protein internal ribosome entry segment untranslated region human immunodeficiency virus type I nucleotide polymerase chain reaction non-structural protein non-structural encephalomyocarditis virus The 5′ ends of all eukaryotic mRNAs are modified post-transcriptionally to carry a methylated cap structure, m7GpppN (1Banerjee A.K. Microbiol. Rev. 1980; 44: 175-205Crossref PubMed Google Scholar). Aside from roles in RNA splicing, stabilization, and transport, the cap structure significantly enhances the recruitment of the 40 S ribosomal subunit to the mRNA 5′ end during translation initiation. The latter function requires recognition of the cap by the eukaryotic initiation factor (eIF)1 4F. The eIF4F holoenzyme complex consists of the cap-binding protein eIF4E and an ATP-dependent RNA helicase (eIF4A) bound toward the N- and C-terminal ends, respectively, of a scaffold molecule eIF4G (for review see Ref. 2Morley S.J. Curtis P.S. Pain V.M. RNA (NY ). 1997; 3: 1085-1104PubMed Google Scholar). The C-terminal domain of eIF4G also interacts with eIF3, a complex that associates directly with the 40 S ribosomal subunit. Most mRNAs carry a poly(A) tail at their 3′ ends, which determines mRNA stability (for review see Ref. 3Jacobson A. Hershey J.W.B. Mathews M.B. Sonenberg N. Translational Control. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York1996: 451-480Google Scholar) and enhances translation initiation efficiency (4Doel M.T. Carey N.H. Cell. 1976; 8: 51-58Abstract Full Text PDF PubMed Scopus (69) Google Scholar). However, reports concerning the actual extent of enhancement of translation initiation by the poly(A) tail are somewhat contradictory, depending on the system used. Moderate poly(A)-mediated stimulation of translation can occur in the absence of a cap structure or functional eIF4E, but a cap is absolutely required for optimal poly(A)-mediated translation stimulation (5Tarun Jr., S.Z. Sachs A.B. Genes Dev. 1995; 9: 2997-3007Crossref PubMed Scopus (330) Google Scholar, 6Preiss T. Hentze M.W. Nature. 1998; 392: 516-520Crossref PubMed Scopus (216) Google Scholar). Studies performed in the rabbit reticulocyte lysate (RRL) and other nuclease-treated cell-free extracts demonstrated that the stimulation of translation upon capping and poly(A) tailing were additive phenomena (7Munroe D. Jacobson A. Mol. Cell. Biol. 1990; 10: 3441-3455Crossref PubMed Scopus (284) Google Scholar, 8Iizuka N. Najita L. Franzusoff A. Sarnow P. Mol. Cell. Biol. 1994; 14: 7322-7330Crossref PubMed Scopus (240) Google Scholar). In contrast, in vivo translation studies have demonstrated that the poly(A) tail and cap interact synergistically to stimulate translation initiation in yeast, plant spheroplasts, and mammalian cells (5Tarun Jr., S.Z. Sachs A.B. Genes Dev. 1995; 9: 2997-3007Crossref PubMed Scopus (330) Google Scholar, 6Preiss T. Hentze M.W. Nature. 1998; 392: 516-520Crossref PubMed Scopus (216) Google Scholar, 9Gallie D.R. Genes Dev. 1991; 5: 2108-2116Crossref PubMed Scopus (594) Google Scholar). Synergy between the cap and poly(A) tail in promoting translation has also been observed in non-nucleased yeast andDrosophila cell-free translation extracts (6Preiss T. Hentze M.W. Nature. 1998; 392: 516-520Crossref PubMed Scopus (216) Google Scholar, 8Iizuka N. Najita L. Franzusoff A. Sarnow P. Mol. Cell. Biol. 1994; 14: 7322-7330Crossref PubMed Scopus (240) Google Scholar, 10Gebauer F. Corona D.F.V. Preiss T. Becker P.B. Hentze M.W. EMBO J. 1999; 18: 6146-6154Crossref PubMed Scopus (106) Google Scholar). However, synergy was abrogated by disruption of endogenous mRNA translation in yeast cells (9Gallie D.R. Genes Dev. 1991; 5: 2108-2116Crossref PubMed Scopus (594) Google Scholar) or by nuclease treatment of yeast cell-free extracts unless such extracts were supplemented with excess competitor mRNAs (6Preiss T. Hentze M.W. Nature. 1998; 392: 516-520Crossref PubMed Scopus (216) Google Scholar). It was thus suggested that an RNA requires the poly(A) tail for translation only when it is competing with other capped and polyadenylated RNAs for limiting concentrations of ribosomes or translation factors. Support for this suggestion came from the demonstration that mutations that affect polyadenylation only significantly reduce translation when introduced into yeast strains harboring low concentrations of ribosomal subunits (11Proweller A. Butler S. J. Biol. Chem. 1997; 272: 6004-6010Abstract Full Text Full Text PDF PubMed Scopus (27) Google Scholar). Biochemical analyses clearly demonstrated that poly(A) tail-mediated translation stimulation involves increased 40 S subunit recruitment to mRNAs and requires the intervention of poly(A) tail-binding protein (PABP) (5Tarun Jr., S.Z. Sachs A.B. Genes Dev. 1995; 9: 2997-3007Crossref PubMed Scopus (330) Google Scholar). PABP was recently demonstrated to interact physically with the N-terminal region of eIF4G from yeast (12Tarun Jr., S.Z. Sachs A.B. EMBO J. 1996; 15: 7168-7177Crossref PubMed Scopus (580) Google Scholar) and from mammals (13Imataka H. Gradi A. Sonenberg N. EMBO J. 1998; 17: 7480-7489Crossref PubMed Scopus (469) Google Scholar). Thus, a closed loop model of translation initiation on capped, polyadenylated mRNAs was postulated (3Jacobson A. Hershey J.W.B. Mathews M.B. Sonenberg N. Translational Control. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York1996: 451-480Google Scholar). Formal proof of mRNA circularization via the cap-eIF4E-eIF4G-PABP-poly(A) interaction was provided by atomic force microscopy of mRNAs complexed with purified recombinant proteins (14Wells S.E. Hillner P.E. Vale R.D. Sachs A.B. Mol. Cell. 1998; 2: 135-140Abstract Full Text Full Text PDF PubMed Scopus (723) Google Scholar). However, the functional consequences of mRNA circularization have not been directly addressed experimentally. Since the closed loop model of translation initiation depends upon interactions between the 5′-terminal cap structure and the 3′ poly(A) tail, the subset of eukaryotic and viral mRNAs that are either uncapped or non-polyadenylated are difficult to accommodate within this model. For certain viral mRNAs, an alternative means of closing the loop has already been proposed. For instance, for capped, non-polyadenylated rotaviral mRNAs, the viral non-structural protein NSP3 binds the conserved rotaviral RNA 3′ end and can interact with eIF4G and displace PABP from the eIF4F complex (15Poncet D. Aponte C. Cohen J. J. Virol. 1993; 67: 3159-3165Crossref PubMed Google Scholar, 16Piron M. Vende P. Cohen J. Poncet D. EMBO J. 1998; 17: 5811-5821Crossref PubMed Scopus (301) Google Scholar). However, the case for picornaviral RNAs remains unresolved. Whereas these viral RNAs are polyadenylated, they are uncapped, and translation initiation is independent of the RNA 5′ end. In fact, ribosome entry on these RNAs occurs internally, several hundred nucleotides downstream of the 5′ end, and is driven by a complex RNA signal of some 400–500 nt, coined the IRES (internal ribosome entry segment) (for review see Ref. 17Jackson R.J. Hunt S.L. Gibbs C.L. Kaminski A. Mol. Biol. Rep. 1994; 19: 147-159Crossref PubMed Scopus (91) Google Scholar). Here, we describe mammalian cell-free translation systems that exhibit cap-poly(A) synergy in the absence of added competitor mRNAs. These systems, derived from extracts in which IRES-driven translation is routinely studied, were used to examine the molecular mechanism of poly(A) tail-mediated translational stimulation on classical eukaryotic mRNAs and on an mRNA harboring an IRES. Plasmids were derived from the previously described pXLJCon clone (18Borman A. Jackson R.J. Virology. 1992; 188: 685-696Crossref PubMed Scopus (105) Google Scholar), which contains the cDNA for Xenopus laevis cyclin B2 (including the 5′ and 3′-UTRs) under the control of the bacteriophage T7 promoter, followed by a short artificial polylinker and then the cDNA corresponding to a truncated coding region and the 3′-UTR of the influenza virus NS protein. For the present study, the NS-coding region of pXLJCon was replaced by the gene encoding the p24 capsid protein of human immunodeficiency virus type I (HIV-ILAI; see Ref. 19Wain-Hobson S. Sonigo P. Danos O. Cole S. Alizon M. Cell. 1985; 40: 9-17Abstract Full Text PDF PubMed Scopus (850) Google Scholar). The different resulting constructs are represented schematically in Fig. 1. In a first step, the NS-coding region and 3′-UTR were excised by digestion with BamHI and EcoRI and replaced by a PCR-generated fragment corresponding to the 150-nt NS 3′-UTR (sense primer, 5′ ATGGATCCCGGGTGAAGAAGTGAGACACAAAC 3′; antisense primer SP6 primer; 30 cycles: 96 °C 30 s, 55 °C 45 s, 72 °C 1 min) to generate pXLinker. In a second step, a PCR fragment containing the entire p24-coding region was generated to contain uniqueNcoI and SmaI restriction sites at the 5′ and 3′ ends, respectively (PCR primers p24sense 5′ CCATGGATCCTATAGTGCAGAACATA 3′ and p24antisense 5′ TCCCCCGGGCAAAACTCTTGCCTTATG 3′; 30 cycles: 96 °C 30 s, 55 °C 45 s, 72 °C 2 min). Introduction of the NcoI-SmaI-digested PCR product into pXLinker digested with the same enzymes results in the fusion of p24 in frame between the polylinker ATG initiation codon and the TGA stop codon that precedes the NS 3′-UTR, producing pB2Op24. The resulting p24 gene product thus carries 2 amino acid extensions at each of the N and C termini. For the construction of pB2ΔIRESp24, nucleotides 10–547 of the human rhinovirus type 2 5′-UTR were excised from the previously described pXLJ10–547 (18Borman A. Jackson R.J. Virology. 1992; 188: 685-696Crossref PubMed Scopus (105) Google Scholar) by digestion with SalI andBamHI and were inserted into pB20p24 digested with the same enzymes. The monocistronic p0p24 plasmid was constructed by replacing the small SalI-EcoRI fragment of pJCon (18Borman A. Jackson R.J. Virology. 1992; 188: 685-696Crossref PubMed Scopus (105) Google Scholar) with that from pB20p24. To insert the entire EMCV IRES (from the poly(C) tract to nt 848) into p0p24 (to produce pEMCVp24), the in-filledEcoRI-NcoI small fragment from p-CITE (Novagen) was inserted into the in-filled BamHI site of p0p24.Figure 2Development of an RRL-based translation system that exhibits cap-poly(A) synergy. A, standard RRL or ribosome-depleted RRL were supplemented with 33% (v/v) of non-nucleased HeLa cell S10 extract (33 lanes), H100 buffer (0 lanes), or 1:1 of S10 extract and H100 buffer (16.5 lanes). Reactions were programmed with RNAs (6.5 μg/ml) transcribed in vitro from pB2 in four distinct versions as indicated above each lane. Control reactions were programmed with water (no RNA lanes). Translations were processed as described under “Experimental Procedures.” The autoradiograph of the dried 20% polyacrylamide gel is shown. The position of the cyclin B2 translation product is marked. Translation efficiency derived from densitometric quantification is plotted below each lane. Relative stimulation of translation was calculated by comparing the translation efficiency of capped and/or polyadenylated RNA to that of the −/− RNA (arbitrary units for the −/− RNAs from left to right of 0.11, 0.12, 0.06, 0.06, 0.05, and 0.07). B,sucrose gradient analysis of the proportions of 40 S and 60 S ribosomal subunits in equivalent volumes of standard RRL (upper plot), ribosome-depleted RRL (middle plot), or RRL supplemented with 33% of non-nucleased HeLa cell S10 extract (lower plot). Absorbance at 254 nm (y axis) is plotted against gradient fraction number. The positions of the 40 S, 60 S, and 80 S peaks and the top and bottom of the gradients are indicated. C, ribosome-depleted RRL supplemented with H100 buffer (0×) or ribosomes recovered from RRL after ultracentrifugation (final concentrations of 0.8 or 1.6× with respect to intact RRL; see “Experimental Procedures”) and programmed with the indicated versions of B2 RNA as in A. The data are presented as in A. Arbitrary units for the −/− lanes were 0.16, 0.17, and 0.33.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Figure 1Schematic representation of plasmids used in this work. The X. laevis cyclin B2 and HIV-I p24-coding regions and the regions corresponding to the active EMCV and inactive HRV2 IRESes are shown as open boxes. Numbersbelow coding regions refer to the first and last amino acids of each reporter gene product; for the HRV2 and EMCV IRESes, the numbering is based on the viral genome sequence and denotes the first and last nucleotides of viral sequence. Other 5′- and 3′-UTRs are depicted asthick lines; the ATG codon that serves to initiate HIV-I p24 synthesis is shown in bold; restriction sites and stop codons are underlined. Clones were constructed in duplicate, differing only in the presence or absence of anA50insertion (bracketed) at the EcoRI site used for linearization prior to transcription.View Large Image Figure ViewerDownload Hi-res image Download (PPT) To produce a plasmid encoding only cyclin B2, and with 5′- and 3′-UTRs identical to those in pB20p24, the full 5′-UTR and cyclin B2-coding region up to the stop codon was amplified by PCR so as to contain a unique SmaI site at its 3′ end (sense primer T7 promoter, antisense primer 5′ TCTTCACCCGGGAGAGAGACTTGCAGCAAG 3′; 30 cycles: 96 °C 30 s, 55 °C 45 s, 72 °C 2 min). The Asp718I-SmaI internal fragment of this PCR product that includes the 3′ end of the coding region was then used to replace the full Asp718-SmaI region of the pB20p24 construct. The resulting pB2 construct thus contains the cyclin-coding region, with a 2-amino acid C-terminal extension, fused in frame with the NS stop codon and 3′-UTR (Fig. 1). Versions of all of these constructions carrying poly(A) stretches were constructed by inserting annealed 5′ AATTA50G 3′ and 5′ AATTCT50 3′ oligonucleotides into the uniqueEcoRI site at the 3′ end of the NS 3′-UTR. This gives an A50 followed directly by a unique EcoRI site, 24 nt downstream of the authentic polyadenylation signal. Constructs were verified by automatic sequencing. Human rhinovirus 2A proteinase, expressed in Escherichia coli and purified exactly as described previously (20Liebig H.-D. Ziegler E. Yan R. Hartmuth K. Klump H. Kowalski H. Blaas D. Sommergruber W. Frasel L. Lamphear B. Rhoads R.E. Kuechler E. Skern T. Biochemistry. 1993; 32: 7581-7588Crossref PubMed Scopus (164) Google Scholar), was a gift from T. Skern. A recombinant fragment of rotavirus NSP3 protein encompassing amino acids 163–313 was overexpressed in E. coli and purified exactly as described previously (16Piron M. Vende P. Cohen J. Poncet D. EMBO J. 1998; 17: 5811-5821Crossref PubMed Scopus (301) Google Scholar, 21Piron M. Delaunay T. Grosclaude J. Poncet D. J. Virol. 1999; 73: 5411-5421Crossref PubMed Google Scholar). Both NSP3 and 2A proteinase were dialyzed against H100 buffer (10 mm HEPES-KOH, pH 7.5, 100 mm KCl, 1 mm MgCl2, 0.1 mm EDTA, and 7 mm β-mercaptoethanol) prior to use. Rabbit anti-eIF4G peptide 7 antiserum (raised against residues 327–342) was a gift of R. Rhoads. Monoclonal antibody 10E10 against human PABP was a gift of M. Görlach. Nuclease-treated RRL was partially depleted of ribosomes by ultracentrifugation. Briefly, 2-ml volumes of flexi-reticulocyte lysate (Promega) were centrifuged at 90,000 rpm for 15–20 min in a Beckman TL-100 benchtop ultracentrifuge. The supernatant was removed, aliquoted, and stored at −80 °C. The ribosomal pellets were resuspended in 1/10 volume (with respect to the initial volume of lysate) of H100 buffer and frozen at −80 °C. Non-nucleased HeLa cell S10 extracts were prepared exactly as described previously (22Borman A. Howell M.T. Patton J. Jackson R.J. J. Gen. Virol. 1993; 74: 1775-1788Crossref PubMed Scopus (124) Google Scholar) and were dialyzed overnight against H100 buffer. Translation-competent HeLa cell S10 extracts were prepared and treated with micrococcal nuclease as described (23Molla A. Paul A.V. Wimmer E. Science. 1991; 254: 1647-1651Crossref PubMed Scopus (276) Google Scholar) except that dialysis was performed against H100 buffer. Ribosome depletion of translation-competent HeLa cell S10 extracts was performed as described above for RRL. In vitro transcriptions and translations were performed as described previously (24Borman A.M. Kirchweger R. Zeigler E. Rhoads R.E. Skern T. Kean K.M. RNA (NY ). 1997; 3: 186-196PubMed Google Scholar) except that artificially capped transcripts were synthesized in the presence of 0.8 mm cap analogue (Ambion Inc.). Transcription reactions included trace quantities of [α-32P]UTP to allow accurate quantification of RNA yields. All RNAs were purified on G-50 Sephadex spin columns (Roche Molecular Biochemicals) to eliminate non-incorporated cap analogue and nucleotides prior to ethanol precipitation and washing with 70% ethanol. In vitro translation reactions were performed in the presence of [35S]methionine. RRL-based reactions contained 50% by volume of flexi-reticulocyte lysate (Promega) or ribosome-depleted RRL and 33% by volume of H100 buffer or non-nucleased HeLa cell S10 extract in H100 buffer, and were programmed with the indicated concentrations of in vitro transcribed mRNAs. Final concentrations, respectively, of added KCl and MgCl2 were 102 and 0.8 mm (for the experiments presented in Fig. 2) and 115 and 0.9 mm in all subsequent reactions. For translation reactions performed in translation-competent HeLa cell extracts, reactions containing 40% of HeLa cell extract were programmed with 6.5 μg/ml of in vitro transcribed mRNAs. In certain experiments, translation reactions were supplemented with ribosomal pellet resuspended in H100 buffer, or purified recombinant proteins (2A proteinase or a fragment of NSP3) also in H100 buffer. Translations were performed for 90 min at 30 °C, and the translation products were analyzed by SDS-polyacrylamide gel electrophoresis as described previously (25Dasso M.C. Jackson R.J. Nucleic Acids Res. 1989; 17: 6485-6497Crossref PubMed Scopus (49) Google Scholar), using gels containing 20% w/v acrylamide. Dried gels were exposed to Hyperfilm β-max (Amersham Pharmacia Biotech) typically for 12–16 h. Densitometric quantification of translation products was as described previously (24Borman A.M. Kirchweger R. Zeigler E. Rhoads R.E. Skern T. Kean K.M. RNA (NY ). 1997; 3: 186-196PubMed Google Scholar) using multiple exposures of each gel to ensure that the linear response range of the film was respected and that low levels of translation could be accurately quantified. In some experiments, the total radioactivity incorporated into proteins was assayed by trichloroacetic acid precipitation exactly as described (26Jackson R.J. Hunt T. Methods Enzymol. 1983; 96: 50-74Crossref PubMed Scopus (396) Google Scholar). The data presented in each figure are representative of at least three independent translation assays. Quantification of 40 S and 60 S ribosomal subunits in translation extracts was performed exactly as described previously (27Foiani M. Cigan A.M. Paddon C.J. Harashima S. Hinnebusch A.G. Mol. Cell. Biol. 1991; 11: 3203-3216Crossref PubMed Scopus (150) Google Scholar), using 110-μl aliquots of RRL or translation-competent HeLa cell S10 extract (20–30 A 260 units). Translation reactions (200 μl) were incubated with and without recombinant NSP3 for 30 min at 30 °C before immunoprecipitation as described previously (16Piron M. Vende P. Cohen J. Poncet D. EMBO J. 1998; 17: 5811-5821Crossref PubMed Scopus (301) Google Scholar) with 1 μl per reaction of rabbit anti-eIF4G peptide 7 antisera. Western blot analysis of immunoprecipitated proteins was exactly as described (24Borman A.M. Kirchweger R. Zeigler E. Rhoads R.E. Skern T. Kean K.M. RNA (NY ). 1997; 3: 186-196PubMed Google Scholar). Membranes were incubated with mouse anti-PABP primary antibody, followed by horseradish peroxidase-linked goat anti-mouse secondary antibodies, and were revealed by enhanced chemiluminescence (ECLplus, Amersham Pharmacia Biotech). To date, several cell-free translation extracts have been described that reproduce the cap-poly(A) synergistic stimulation of translation previously observed in vivo (6Preiss T. Hentze M.W. Nature. 1998; 392: 516-520Crossref PubMed Scopus (216) Google Scholar, 8Iizuka N. Najita L. Franzusoff A. Sarnow P. Mol. Cell. Biol. 1994; 14: 7322-7330Crossref PubMed Scopus (240) Google Scholar, 10Gebauer F. Corona D.F.V. Preiss T. Becker P.B. Hentze M.W. EMBO J. 1999; 18: 6146-6154Crossref PubMed Scopus (106) Google Scholar). However, synergy was only observed in these cell-free extracts in the presence of competitor mRNAs (6Preiss T. Hentze M.W. Nature. 1998; 392: 516-520Crossref PubMed Scopus (216) Google Scholar), which complicates a dissection of the molecular basis of synergy. The primary aim of the study presented here was to develop cell-free extracts from mammals that would exhibit synergy between the cap and poly(A) tail in the absence of added competitor mRNAs, and therefore could be used to examine the molecular mechanism of cap-poly(A) cooperativity. The effects of the poly(A) tail on translation can be measured in two ways: by comparing the translation efficiency of uncapped mRNAs with and without a poly(A) tail, or by examining the synergy obtained upon addition of both poly(A) and a cap to an mRNA (28Tarun Jr., S.Z. Wells S.E. Deardorff J.A. Sachs A.B. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 9046-9051Crossref PubMed Scopus (266) Google Scholar). To carry out a comprehensive analysis, we compared the translation efficiency of four versions of a given mRNA as follows: neither capped nor polyadenylated (−/−), capped and non-polyadenylated (+/−), uncapped and polyadenylated (−/+), and both capped and polyadenylated (+/+). These were synthesized in vitro from cDNA transcription templates that only differed by an oligonucleotide-derived homopolymer A50 insertion preceding a unique EcoRI site at the end of a 150-nt 3′-UTR (pB2; see “Experimental Procedures” and Fig.1). Thus, the polyadenylated mRNAs described here terminate with an A50- GAAUU tail. It has previously been shown that a short 3′ end heterologous sequence does not affect poly(A) tail-promoted translation (6Preiss T. Hentze M.W. Nature. 1998; 392: 516-520Crossref PubMed Scopus (216) Google Scholar), and that 50 A residues suffice to demonstrate the roles of the poly(A) tail in translation initiation (9Gallie D.R. Genes Dev. 1991; 5: 2108-2116Crossref PubMed Scopus (594) Google Scholar, 29Preiss T. Muckenthaler M. Hentze M.W. RNA (NY ). 1998; 4: 1321-1331Crossref PubMed Scopus (93) Google Scholar). B2 RNAs were first translated in a nuclease-treated RRL in vitro translation system, in the absence of added competitor RNAs (see Fig. 2 A, RRL + 0% HeLaS10 lanes). As expected, translation of capped B2 mRNA in this system was some 30-fold more efficient than that of the uncapped equivalent (compare +/− and −/− lanes). Polyadenylation of uncapped B2 mRNA stimulated its translation approximately 6-fold (compare −/+ and −/− lanes). Moreover, additive stimulation of translation was achieved by polyadenylation and capping (compare the +/+ lane with the sum of the +/− and −/+lanes), in accordance with previous reports (7Munroe D. Jacobson A. Mol. Cell. Biol. 1990; 10: 3441-3455Crossref PubMed Scopus (284) Google Scholar, 8Iizuka N. Najita L. Franzusoff A. Sarnow P. Mol. Cell. Biol. 1994; 14: 7322-7330Crossref PubMed Scopus (240) Google Scholar). Since poly(A)-mediated synergistic stimulation of translation in nuclease-treated yeast extracts required the presence of competitor RNAs (6Preiss T. Hentze M.W. Nature. 1998; 392: 516-520Crossref PubMed Scopus (216) Google Scholar), we next measured the translation activity of the B2 mRNAs in RRL supplemented with increasing amounts of non-nucleased HeLa cell S10 extract. Non-nucleased cell extract was employed rather than purified poly(A) RNA to ensure that physiological cell equivalents of mRNA were added. Global translation efficiency was significantly lowered in such conditions (Fig. 2 A, RRL compare 0, 16.5 and 33 HeLaS10 lanes). Furthermore, the stimulatory effects of addition of a cap or poly(A) tail alone were then reduced (see values for Relative Stimulation, Fig.2 A). In contrast, slight cap-poly(A) synergy (calculated as the relative stimulation of +/+ RNA divided by the sum of the relative stimulations of −/+ and +/− RNAs) was reproducibly observed. This increased concomitantly with the quantity of added competitor but never reached 2-fold. It has been suggested that the concentration of free ribosomesper se determines the magnitude of poly(A)-mediated translation stimulation (11Proweller A. Butler S. J. Biol. Chem. 1997; 272: 6004-6010Abstract Full Text Full Text PDF PubMed Scopus (27) Google Scholar). Thus, in an attempt to amplify cap-poly(A) synergy in the RRL system, and to circumvent the need for addition of competitor RNAs, RRL was partially depleted of ribosomes by ultracentrifugation (see “Experimental Procedures”). Translation efficiency was dramatically reduced in reactions containing the ultracentrifugation supernatant compared with those based on intact RRL (Fig. 2 A, compare ribosome-depleted RRL andRRL lanes; 0% HeLaS10). The stimulatory effects of capping non-polyadenylated mRNA and polyadenylating uncapped mRNA were also reduced as compared with the reactions performed in standard RRL. However, cap-poly(A) cooperative stimulation of translation was observed (synergy of approximately 3-fold). Whereas the addition of a non-nucleased HeLa cell S10 extract to ribosome-depleted RRL moderately improved global translation efficiency, it did not affect the synergy (see Fig. 2 A, right-hand side), presumably because the positive effects of the added competitor mRNAs in increasing synergy are negated by the free ribosomes and initiation factors present in the HeLa cell extract. Thus, all further studies using the RRL system were performed with ribosome-depleted RRL, without HeLa cell extract supplementation. Sucrose gradient analysis was performed to determine the proportions of 40 S and 60 S ribosomal subunits present in the different translation systems used (Fig. 2 B). The concentration of 60 S and 40 S ribosomal subunits in ribosome-depleted RRL was below the detection limit of the assay (middle plot), whereas, compared with RRL (upper plot), larger 40 S and 60 S peaks and an additional peak corresponding to 80 S ribosomes could be detected in RRL supplemented with non-nucleased HeLa cell extract (lower plot). As an additional control of the ribosome-depleted sy" @default.
• W2043932014 created "2016-06-24" @default.
• W2043932014 creator A5002380779 @default.
• W2043932014 creator A5037882604 @default.
• W2043932014 creator A5055423758 @default.
• W2043932014 creator A5055578001 @default.
• W2043932014 creator A5062892359 @default.
• W2043932014 date "2000-10-01" @default.
• W2043932014 modified "2023-09-29" @default.
• W2043932014 title "Cap-Poly(A) Synergy in Mammalian Cell-free Extracts" @default.
• W2043932014 cites W100014517 @default.
• W2043932014 cites W1493069978 @default.
• W2043932014 cites W1543920123 @default.
• W2043932014 cites W1568133569 @default.
• W2043932014 cites W1605480781 @default.
• W2043932014 cites W1788436564 @default.
• W2043932014 cites W1967520902 @default.
• W2043932014 cites W1973433187 @default.
• W2043932014 cites W1985654383 @default.
• W2043932014 cites W1988211576 @default.
• W2043932014 cites W2027150388 @default.
• W2043932014 cites W2048013101 @default.
• W2043932014 cites W2049747157 @default.
• W2043932014 cites W2050594447 @default.
• W2043932014 cites W2068378422 @default.
• W2043932014 cites W2094182822 @default.
• W2043932014 cites W2095950646 @default.
• W2043932014 cites W2102754190 @default.
• W2043932014 cites W2117149353 @default.
• W2043932014 cites W2117843359 @default.
• W2043932014 cites W2123742352 @default.
• W2043932014 cites W2131997866 @default.
• W2043932014 cites W2132497602 @default.
• W2043932014 cites W2134085241 @default.
• W2043932014 cites W2142597062 @default.
• W2043932014 cites W2160334805 @default.
• W2043932014 cites W2162739904 @default.
• W2043932014 cites W2166914418 @default.
• W2043932014 cites W233265278 @default.
• W2043932014 doi "https://doi.org/10.1074/jbc.m004304200" @default.
• W2043932014 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10922367" @default.
• W2043932014 hasPublicationYear "2000" @default.
• W2043932014 type Work @default.
• W2043932014 sameAs 2043932014 @default.
• W2043932014 citedByCount "142" @default.
• W2043932014 countsByYear W20439320142012 @default.
• W2043932014 countsByYear W20439320142014 @default.
• W2043932014 countsByYear W20439320142015 @default.
• W2043932014 countsByYear W20439320142016 @default.
• W2043932014 countsByYear W20439320142017 @default.
• W2043932014 countsByYear W20439320142018 @default.
• W2043932014 countsByYear W20439320142019 @default.
• W2043932014 countsByYear W20439320142020 @default.
• W2043932014 countsByYear W20439320142021 @default.
• W2043932014 countsByYear W20439320142022 @default.
• W2043932014 countsByYear W20439320142023 @default.
• W2043932014 crossrefType "journal-article" @default.
• W2043932014 hasAuthorship W2043932014A5002380779 @default.
• W2043932014 hasAuthorship W2043932014A5037882604 @default.
• W2043932014 hasAuthorship W2043932014A5055423758 @default.
• W2043932014 hasAuthorship W2043932014A5055578001 @default.
• W2043932014 hasAuthorship W2043932014A5062892359 @default.
• W2043932014 hasBestOaLocation W20439320141 @default.
• W2043932014 hasConcept C12554922 @default.
• W2043932014 hasConcept C1491633281 @default.
• W2043932014 hasConcept C185592680 @default.
• W2043932014 hasConcept C55493867 @default.
• W2043932014 hasConcept C86803240 @default.
• W2043932014 hasConcept C95444343 @default.
• W2043932014 hasConceptScore W2043932014C12554922 @default.
• W2043932014 hasConceptScore W2043932014C1491633281 @default.
• W2043932014 hasConceptScore W2043932014C185592680 @default.
• W2043932014 hasConceptScore W2043932014C55493867 @default.
• W2043932014 hasConceptScore W2043932014C86803240 @default.
• W2043932014 hasConceptScore W2043932014C95444343 @default.
• W2043932014 hasIssue "41" @default.
• W2043932014 hasLocation W20439320141 @default.
• W2043932014 hasLocation W20439320142 @default.
• W2043932014 hasLocation W20439320143 @default.
• W2043932014 hasOpenAccess W2043932014 @default.
• W2043932014 hasPrimaryLocation W20439320141 @default.
• W2043932014 hasRelatedWork W1790932677 @default.
• W2043932014 hasRelatedWork W2058393114 @default.
• W2043932014 hasRelatedWork W2083693850 @default.
• W2043932014 hasRelatedWork W2155429083 @default.
• W2043932014 hasRelatedWork W2160733843 @default.
• W2043932014 hasRelatedWork W2331261012 @default.
• W2043932014 hasRelatedWork W2416128704 @default.
• W2043932014 hasRelatedWork W2545003596 @default.
• W2043932014 hasRelatedWork W2902975418 @default.
• W2043932014 hasRelatedWork W2999643822 @default.
• W2043932014 hasVolume "275" @default.
• W2043932014 isParatext "false" @default.
• W2043932014 isRetracted "false" @default.
• W2043932014 magId "2043932014" @default.
• W2043932014 workType "article" @default.