FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2043946324> ?p ?o ?g. }

• W2043946324 endingPage "393" @default.
• W2043946324 startingPage "384" @default.
• W2043946324 abstract "Proteins that bind to single-stranded DNA (ssDNA) are essential for DNA replication, recombinational repair, and maintenance of genomic stability. Here, we describe the characterization of an ssDNA-binding heterotrimeric complex, SOSS (sensor of ssDNA) in human, which consists of human SSB homologs hSSB1/2 (SOSS-B1/2) and INTS3 (SOSS-A) and a previously uncharacterized protein C9orf80 (SOSS-C). We have shown that SOSS-A serves as a central adaptor required not only for SOSS complex assembly and stability, but also for facilitating the accumulation of SOSS complex to DNA ends. Moreover, SOSS-depleted cells display increased ionizing radiation sensitivity, defective G2/M checkpoint, and impaired homologous recombination repair. Thus, our study defines a pathway involving the sensing of ssDNA by SOSS complex and suggests that this SOSS complex is likely involved in the maintenance of genome stability. Proteins that bind to single-stranded DNA (ssDNA) are essential for DNA replication, recombinational repair, and maintenance of genomic stability. Here, we describe the characterization of an ssDNA-binding heterotrimeric complex, SOSS (sensor of ssDNA) in human, which consists of human SSB homologs hSSB1/2 (SOSS-B1/2) and INTS3 (SOSS-A) and a previously uncharacterized protein C9orf80 (SOSS-C). We have shown that SOSS-A serves as a central adaptor required not only for SOSS complex assembly and stability, but also for facilitating the accumulation of SOSS complex to DNA ends. Moreover, SOSS-depleted cells display increased ionizing radiation sensitivity, defective G2/M checkpoint, and impaired homologous recombination repair. Thus, our study defines a pathway involving the sensing of ssDNA by SOSS complex and suggests that this SOSS complex is likely involved in the maintenance of genome stability. DNA double-strand breaks (DSBs) are highly cytotoxic lesions that, if unrepaired or repaired incorrectly, can cause genome instability and promote tumorigenesis (Bartek and Lukas, 2007Bartek J. Lukas J. DNA damage checkpoints: from initiation to recovery or adaptation.Curr. Opin. Cell Biol. 2007; 19: 238-245Crossref PubMed Scopus (591) Google Scholar, Bartkova et al., 2005Bartkova J. Horejsi Z. Koed K. Kramer A. Tort F. Zieger K. Guldberg P. Sehested M. Nesland J.M. Lukas C. et al.DNA damage response as a candidate anti-cancer barrier in early human tumorigenesis.Nature. 2005; 434: 864-870Crossref PubMed Scopus (2234) Google Scholar, Friedberg, 2003Friedberg E.C. DNA damage and repair.Nature. 2003; 421: 436-440Crossref PubMed Scopus (674) Google Scholar, Hoeijmakers, 2001Hoeijmakers J.H. Genome maintenance mechanisms for preventing cancer.Nature. 2001; 411: 366-374Crossref PubMed Scopus (3137) Google Scholar). Cells possess two main DSB repair mechanisms: nonhomologous end joining (NHEJ) and homologous recombination (HR) (Kennedy and D'Andrea, 2006Kennedy R.D. D'Andrea A.D. DNA repair pathways in clinical practice: lessons from pediatric cancer susceptibility syndromes.J. Clin. Oncol. 2006; 24: 3799-3808Crossref PubMed Scopus (224) Google Scholar, Lukas and Bartek, 2004Lukas J. Bartek J. Watching the DNA repair ensemble dance.Cell. 2004; 118: 666-668Abstract Full Text Full Text PDF PubMed Scopus (24) Google Scholar, Weinstock et al., 2006bWeinstock D.M. Richardson C.A. Elliott B. Jasin M. Modeling oncogenic translocations: distinct roles for double-strand break repair pathways in translocation formation in mammalian cells.DNA Repair (Amst.). 2006; 5: 1065-1074Crossref PubMed Scopus (137) Google Scholar). In vertebrates, NHEJ and HR differentially contribute to DSB repair, depending on the nature of the DSB and the phase of the cell cycle (Bartek et al., 2004Bartek J. Lukas C. Lukas J. Checking on DNA damage in S phase.Nat. Rev. Mol. Cell Biol. 2004; 5: 792-804Crossref PubMed Scopus (592) Google Scholar, Sonoda et al., 2006Sonoda E. Hochegger H. Saberi A. Taniguchi Y. Takeda S. Differential usage of non-homologous end-joining and homologous recombination in double strand break repair.DNA Repair (Amst.). 2006; 5: 1021-1029Crossref PubMed Scopus (377) Google Scholar). HR pathway is critical for the maintenance of genome stability through its involvement in the precise repair of DNA DSBs and restarting stalled or collapsed DNA replication forks. It is believed that one of the initial steps during HR is the resection of DSBs to generate single-stranded DNA (ssDNA), which is bound by ssDNA-binding proteins (SSBs) that play essential roles in DNA replication, recombination, and repair in bacteria, archaea, and eukarya (Borde, 2007Borde V. The multiple roles of the Mre11 complex for meiotic recombination.Chromosome Res. 2007; 15: 551-563Crossref PubMed Scopus (88) Google Scholar, Buis et al., 2008Buis J. Wu Y. Deng Y. Leddon J. Westfield G. Eckersdorff M. Sekiguchi J.M. Chang S. Ferguson D.O. Mre11 nuclease activity has essential roles in DNA repair and genomic stability distinct from ATM activation.Cell. 2008; 135: 85-96Abstract Full Text Full Text PDF PubMed Scopus (247) Google Scholar, Clerici et al., 2005Clerici M. Mantiero D. Lucchini G. Longhese M.P. The Saccharomyces cerevisiae Sae2 protein promotes resection and bridging of double strand break ends.J. Biol. Chem. 2005; 280: 38631-38638Crossref PubMed Scopus (157) Google Scholar, Hopkins and Paull, 2008Hopkins B.B. Paull T.T. The P. furiosus mre11/rad50 complex promotes 5′ strand resection at a DNA double-strand break.Cell. 2008; 135: 250-260Abstract Full Text Full Text PDF PubMed Scopus (132) Google Scholar, Lavin, 2004Lavin M.F. The Mre11 complex and ATM: a two-way functional interaction in recognising and signaling DNA double strand breaks.DNA Repair (Amst.). 2004; 3: 1515-1520Crossref PubMed Scopus (62) Google Scholar, Lengsfeld et al., 2007Lengsfeld B.M. Rattray A.J. Bhaskara V. Ghirlando R. Paull T.T. Sae2 is an endonuclease that processes hairpin DNA cooperatively with the Mre11/Rad50/Xrs2 complex.Mol. Cell. 2007; 28: 638-651Abstract Full Text Full Text PDF PubMed Scopus (227) Google Scholar, Petrini and Stracker, 2003Petrini J.H. Stracker T.H. The cellular response to DNA double-strand breaks: defining the sensors and mediators.Trends Cell Biol. 2003; 13: 458-462Abstract Full Text Full Text PDF PubMed Scopus (289) Google Scholar, Sartori et al., 2007Sartori A.A. Lukas C. Coates J. Mistrik M. Fu S. Bartek J. Baer R. Lukas J. Jackson S.P. Human CtIP promotes DNA end resection.Nature. 2007; 450: 509-514Crossref PubMed Scopus (991) Google Scholar, Takeda et al., 2007Takeda S. Nakamura K. Taniguchi Y. Paull T.T. Ctp1/CtIP and the MRN complex collaborate in the initial steps of homologous recombination.Mol. Cell. 2007; 28: 351-352Abstract Full Text Full Text PDF PubMed Scopus (101) Google Scholar, West, 2003West S.C. Molecular views of recombination proteins and their control.Nat. Rev. Mol. Cell Biol. 2003; 4: 435-445Crossref PubMed Scopus (807) Google Scholar, Williams et al., 2008Williams R.S. Moncalian G. Williams J.S. Yamada Y. Limbo O. Shin D.S. Groocock L.M. Cahill D. Hitomi C. Guenther G. et al.Mre11 dimers coordinate DNA end bridging and nuclease processing in double-strand-break repair.Cell. 2008; 135: 97-109Abstract Full Text Full Text PDF PubMed Scopus (364) Google Scholar, Wold, 1997Wold M.S. Replication protein A: a heterotrimeric, single-stranded DNA-binding protein required for eukaryotic DNA metabolism.Annu. Rev. Biochem. 1997; 66: 61-92Crossref PubMed Scopus (1178) Google Scholar). The human SSB, known as human replication protein A (RPA), is a heterotrimer composed of subunits of 70, 32, and 14 kDa, each of which is conserved not only in mammals but also in all other eukaryotic species (Wold, 1997Wold M.S. Replication protein A: a heterotrimeric, single-stranded DNA-binding protein required for eukaryotic DNA metabolism.Annu. Rev. Biochem. 1997; 66: 61-92Crossref PubMed Scopus (1178) Google Scholar). RPA is generally believed to be the major SSB protein in eukaryotic cells given that it not only is critically important for DNA replication but also participates in various DNA repair or other cellular processes that involve DNA transaction. This view was challenged by the recent identification of two additional human SSB homologs, hSSB1 and hSSB2 (Richard et al., 2008Richard D.J. Bolderson E. Cubeddu L. Wadsworth R.I. Savage K. Sharma G.G. Nicolette M.L. Tsvetanov S. McIlwraith M.J. Pandita R.K. et al.Single-stranded DNA-binding protein hSSB1 is critical for genomic stability.Nature. 2008; 453: 677-681Crossref PubMed Scopus (192) Google Scholar). Cells deficient in hSSB1 exhibit defective checkpoint activation, increased radiation sensitivity, and defective HR repair, indicating that hSSB1 plays an important role in the cellular response to DNA damage (Richard et al., 2008Richard D.J. Bolderson E. Cubeddu L. Wadsworth R.I. Savage K. Sharma G.G. Nicolette M.L. Tsvetanov S. McIlwraith M.J. Pandita R.K. et al.Single-stranded DNA-binding protein hSSB1 is critical for genomic stability.Nature. 2008; 453: 677-681Crossref PubMed Scopus (192) Google Scholar). Unlike RPA, which exists as heterotrimeric complex, hSSB1 and hSSB2 were believed to be more similar to E. coli SSB, which exists as a monomeric form or homo-oligomers (Richard et al., 2008Richard D.J. Bolderson E. Cubeddu L. Wadsworth R.I. Savage K. Sharma G.G. Nicolette M.L. Tsvetanov S. McIlwraith M.J. Pandita R.K. et al.Single-stranded DNA-binding protein hSSB1 is critical for genomic stability.Nature. 2008; 453: 677-681Crossref PubMed Scopus (192) Google Scholar). However, exactly how hSSB1 (or hSSB2) would specifically sense ssDNA regions during DNA damage repair but not be involved in normal DNA replication is still unknown. In this study, we used an affinity purification approach to isolate the hSSB1/2-containing complex. Interestingly, we identified a heterotrimeric complex, which we refer to as SOSS (sensor of ssDNA) complex that contains not only hSSB1/2, but also INTS3 and a previously uncharacterized protein, C9orf80. We demonstrated that both SOSS complexes and CtIP/RPA act downstream of the MRE11/RAD50/NBS1 (MRN) complex and function in DNA damage repair. In an attempt to understand what determines the specialized role of hSSBs in DNA repair, we performed tandem affinity purification using HEK293T cells stably expressing streptavidin-flag-S protein (SFB)-tagged wild-type hSSB1/2 for the identification of hSSB1/2-associated proteins. We repeatedly found INTS3 and a previously uncharacterized protein, C9orf80, as major hSSB1/2-associated proteins (Figure 1A). To further confirm that INTS3 and C9orf80 exist in the same complex with hSSB1 or hSSB2, we generated stable cells expressing triple-tagged INTS3 and C9orf80, respectively. Notably, mass spectrometry analyses of INTS3 or C9orf80-associated protein complexes revealed peptides that corresponded to hSSB1 and hSSB2 (data not shown), suggesting that these proteins likely form a stable complex in vivo. INTS3 (integrator complex subunit 3) was originally identified as a subunit of Integrator (Baillat et al., 2005Baillat D. Hakimi M.A. Naar A.M. Shilatifard A. Cooch N. Shiekhattar R. Integrator, a multiprotein mediator of small nuclear RNA processing, associates with the C-terminal repeat of RNA polymerase II.Cell. 2005; 123: 265-276Abstract Full Text Full Text PDF PubMed Scopus (340) Google Scholar); however, there was no further characterization of this protein concerning its domain structure, activity, or biological function. C9orf80 is a hypothetical protein with no known function. Although INTS3 and C9orf80 were present in both hSSB1 and hSSB2 purification, we did not detect the presence of hSSB1 from several independent hSSB2 large-scale affinity purifications and vice versa (Figure 1A and data not shown), indicating that hSSB1 and hSSB2 might exist in two complementary complexes that contain the common subunits INTS3 and C9orf80. Therefore, in this study, we named the complex containing INTS3/hSSB1/C9orf80 or INTS3/hSSB2/C9orf80 as SOSS1/2 (SOSS DNA complex 1/2), respectively. Accordingly, we designated INTS3, hSSB1/2, and C9orf80 as SOSS subunit A, B1/2, and C, respectively. To verify the association among SOSS-A, SOSS-B1, SOSS-B2, and SOSS-C, we performed coimmunoprecipitation experiments. When immunoprecipitation experiments were conducted with anti-SOSS-A or anti-SOSS-C antibodies, all of the SOSS subunits could be detected (Figure 1B). However, while antibodies specifically recognizing SOSS-B1 or SOSS-B2 coimmunoprecipitated the common subunits SOSS-A and SOSS-C, no SOSS-B1 or 2 were present in each other's immunocomplex (Figure 1B). These data agree with the data obtained from SOSS-B1/2 large-scale affinity purifications and support our hypothesis that SOSS-A, SOSS-B1/2, and SOSS-C might form two complementary heterotrimeric complexes: SOSS1 (SOSS-A/B1/C) or SOSS2 (SOSS-A/B2/C) in vivo. Interestingly, neither RPA nor CTIP could interact with SOSS-A (see Figure S1 available online). Furthermore, the SOSS complex formation was DNA damage independent and these pre-existing complexes could be detected in HeLa cells as well as in other cell lines including HEK293T cells (Figure 1B and data not shown). Formation of the heterotrimeric complex was further ascertained by gel filtration analysis. Insect cells were coinfected with baculovirus expressing GST-SOSS-A, His-SOSS-B, and SOSS-C and complex formation was studied by FPLC. As shown in Figure 1C, SOSS-A, SOSS-B, and SOSS-C coeluted as a heterotrimeric complex with a molecular mass of approximately 190 kDa. A previous study has already established that recombinant SOSS-B1/hSSB1 binds specifically to ssDNA substrates (Richard et al., 2008Richard D.J. Bolderson E. Cubeddu L. Wadsworth R.I. Savage K. Sharma G.G. Nicolette M.L. Tsvetanov S. McIlwraith M.J. Pandita R.K. et al.Single-stranded DNA-binding protein hSSB1 is critical for genomic stability.Nature. 2008; 453: 677-681Crossref PubMed Scopus (192) Google Scholar). As shown in Figure S2, recombinant SOSS heterotrimeric complex also specifically binds to ssDNA but not to dsDNA. To find out exactly how the SOSS complex is assembled, we examined the association among SOSS-A, SOSS-B1, and SOSS-C in insect cells. As shown in Figure 1D, SOSS-A interacted strongly with SOSS-B or SOSS-C, whereas no direct binding was detected between SOSS-B and SOSS-C (data not shown), suggesting that SOSS-A likely serves as a central assembly factor that mediates the formation of this complex. Therefore we focused on this key subunit SOSS-A in this study. We first sought to identify the regions on SOSS-A responsible for its interaction with SOSS-B or SOSS-C. Myc-tagged wild-type SOSS-A and a series of deletion mutants that span the entire SOSS-A open reading frame were subjected to coimmunoprecipitation with full-length SFB-tagged SOSS-B or SOSS-C. Results showed that while the SOSS-A N terminus (residues 1–419) is responsible for SOSS-B binding, a larger N-terminal region (residues 1–628) is necessary for its binding to SOSS-C (Figures 1E and 1F). These data indicate that SOSS-B and SOSS-C share overlapping binding regions on SOSS-A. The absence of a critical subunit of a multicomponent protein complex often destabilizes the complex (Yin et al., 2005Yin J. Sobeck A. Xu C. Meetei A.R. Hoatlin M. Li L. Wang W. BLAP75, an essential component of Bloom's syndrome protein complexes that maintain genome integrity.EMBO J. 2005; 24: 1465-1476Crossref PubMed Scopus (151) Google Scholar). Therefore, we depleted either SOSS-A or SOSS-B1/2 and examined the stability of the other subunits. As shown in Figure 2A, depletion of SOSS-B1 or SOSS-B2 did not result in any significant change in SOSS-A protein level; however, depletion of SOSS-A by siRNA led to a dramatic decrease in SOSS-B1 and SOSS-B2 protein levels. This implies that SOSS-A may help to stabilize SOSS-B1 and SOSS-B2 in the cell. Interestingly, we noticed that the protein levels of SOSS-B1 and SOSS-B2 seem to have an inverse relationship, as depletion of one protein appears to increase the level of the other (Figure 2A), again indicating that SOSS-B1 and SOSS-B2 might play complementary roles in the DNA damage response pathway. Like many DNA damage/repair proteins, SOSS-B1 was able to localize at sites of DNA breaks and form discrete foci that colocalize with the DNA DSB marker γ-H2AX (Richard et al., 2008Richard D.J. Bolderson E. Cubeddu L. Wadsworth R.I. Savage K. Sharma G.G. Nicolette M.L. Tsvetanov S. McIlwraith M.J. Pandita R.K. et al.Single-stranded DNA-binding protein hSSB1 is critical for genomic stability.Nature. 2008; 453: 677-681Crossref PubMed Scopus (192) Google Scholar). Given that SOSS-A and SOSS-C exist in a complex with SOSS-B1 or SOSS-B2, we would like to examine whether SOSS-A and SOSS-C could also form foci following DNA damage. Immunostaining experiments showed SOSS-A, SOSS-B2, and SOSS-C to be evenly distributed in the nucleoplasm in normal cells (data not shown). However, after exposure of cells to ionizing radiation (IR), SOSS-A, SOSS-B2, and SOSS-C relocalized to foci that costained with γ-H2AX (Figure 2B), indicating that the localization of SOSS-A, SOSS-B2, and SOSS-C, like that of SOSS-B1, is regulated in response to DNA damage. Since all the components of SOSS complexes form IR-induced foci (IRIF), we next examined how they would influence each other's foci formation ability. As shown in Figures 2C and 2D, IRIF of SOSS-B1 and SOSS-B2 were dramatically decreased in SOSS-A-depleted cells. However, depletion of SOSS-B1 or SOSS-B2 did not lead to any significant change in SOSS-A IRIF formation (Figures 4B and S6A), implying that SOSS-A may act upstream of SOSS-B1/2 and be required for SOSS-B1/2 focus formation. In agreement with our previous hypothesis that SOSS-B1 and SOSS-B2 might play a complementary role in the DNA damage response, depletion of SOSS-B1 led to a modest increase of SOSS-B2 foci formation and vice verse (Figure 2D). Generally, the DNA damage-induced focus formation reflects the assembly of proteins at the vicinity of DNA breaks. These proteins are recruited physically to the damaged DNA and become chromatin bound. Since SOSS-A is required for SOSS-B foci formation, we hypothesized that SOSS-A should also be required for the localization of SOSS-B to chromatin. Indeed, SOSS-A depletion results in abrogation of chromatin targeting of both SOSS-B1 and SOSS-B2 (Figure 2E). Together, these data suggest that SOSS-A not only is required for the assembly of this trimeric protein complex, but also plays an important role in stabilizing this protein complex at DNA damage sites. Cells deficient in hSSB1 display enhanced genomic instability including defective G2/M checkpoint activation, increased IR sensitivity, and deficient HR repair (Richard et al., 2008Richard D.J. Bolderson E. Cubeddu L. Wadsworth R.I. Savage K. Sharma G.G. Nicolette M.L. Tsvetanov S. McIlwraith M.J. Pandita R.K. et al.Single-stranded DNA-binding protein hSSB1 is critical for genomic stability.Nature. 2008; 453: 677-681Crossref PubMed Scopus (192) Google Scholar). We examined whether the loss of the SOSS-A would result in similar defects in the DNA damage response. Using a previously established G2/M checkpoint assay (Xu et al., 2001Xu B. Kim S. Kastan M.B. Involvement of Brca1 in S-phase and G(2)-phase checkpoints after ionizing irradiation.Mol. Cell. Biol. 2001; 21: 3445-3450Crossref PubMed Scopus (472) Google Scholar), we showed defective G2/M checkpoint control in SOSS-A-depleted cells (Figure 3A). SOSS-A-depleted cells were also more sensitive to radiation than control cells (Figure 3B). Moreover, we performed a gene conversion assay to examine HR efficiency using the DR-GFP reporter system (Weinstock et al., 2006aWeinstock D.M. Nakanishi K. Helgadottir H.R. Jasin M. Assaying double-strand break repair pathway choice in mammalian cells using a targeted endonuclease or the RAG recombinase.Methods Enzymol. 2006; 409: 524-540Crossref PubMed Scopus (125) Google Scholar). Indeed, HR repair efficiency was reduced by ∼2- to 2.5-fold in SOSS-A-depleted cells (Figures 3C and 3D). The recombination protein RAD51 is the key component of the HR repair machinery and the formation of Rad51 foci can be used as another indicator of HR repair. In agreement with the results from gene conversion assay, DNA damage-induced Rad51 foci formation was also impaired in SOSS-A-depleted cells (Figures 3E, 3F, and S3). Together, these data indicated that SOSS complexes play an important role in DNA damage response. It has been shown that the MRN complex promotes DNA end resection and the generation of ssDNA, which is critically important for recruitment of RPA and HR repair (Borde, 2007Borde V. The multiple roles of the Mre11 complex for meiotic recombination.Chromosome Res. 2007; 15: 551-563Crossref PubMed Scopus (88) Google Scholar, Buis et al., 2008Buis J. Wu Y. Deng Y. Leddon J. Westfield G. Eckersdorff M. Sekiguchi J.M. Chang S. Ferguson D.O. Mre11 nuclease activity has essential roles in DNA repair and genomic stability distinct from ATM activation.Cell. 2008; 135: 85-96Abstract Full Text Full Text PDF PubMed Scopus (247) Google Scholar, Hopkins and Paull, 2008Hopkins B.B. Paull T.T. The P. furiosus mre11/rad50 complex promotes 5′ strand resection at a DNA double-strand break.Cell. 2008; 135: 250-260Abstract Full Text Full Text PDF PubMed Scopus (132) Google Scholar, Lavin, 2004Lavin M.F. The Mre11 complex and ATM: a two-way functional interaction in recognising and signaling DNA double strand breaks.DNA Repair (Amst.). 2004; 3: 1515-1520Crossref PubMed Scopus (62) Google Scholar, Petrini and Stracker, 2003Petrini J.H. Stracker T.H. The cellular response to DNA double-strand breaks: defining the sensors and mediators.Trends Cell Biol. 2003; 13: 458-462Abstract Full Text Full Text PDF PubMed Scopus (289) Google Scholar, Williams et al., 2008Williams R.S. Moncalian G. Williams J.S. Yamada Y. Limbo O. Shin D.S. Groocock L.M. Cahill D. Hitomi C. Guenther G. et al.Mre11 dimers coordinate DNA end bridging and nuclease processing in double-strand-break repair.Cell. 2008; 135: 97-109Abstract Full Text Full Text PDF PubMed Scopus (364) Google Scholar). Given that the SOSS complex bound to ssDNA, we expected that MRN might be required for SOSS complex foci formation. Strikingly, like RPA2, SOSS complex foci formation was significantly reduced upon MRN depletion, indicating that MRN complexes are involved in the generation of not only RPA but also SOSS-coated ssDNAs (Figures 4A and S4A–S4C). This requirement of MRN complex for the formation of SOSS foci appears to be restricted to S or G2 cells, since the damage-induced SOSS focus formation in G1-arrested cells could still occur independent of the MRN complex (Figures S4D and S4E). Because SOSS-A was absolutely required for SOSS complex chromatin targeting and focus formation, we tested the possibility that the MRN complex might bring the SOSS complex to ssDNAs via a direct interaction with SOSS-A. Indeed, we found that SOSS-A specifically interacted with NBS1, but not with Mre11 or RAD50 (Figure S5A). Moreover, SOSS-A interacted with NBS1 in insect cells (Figure S5B). This interaction between SOSS-A and NBS1 suggests that SOSS and MRN complexes may at least in part act together and participate in DNA damage response. More recently, the proposed mammalian Sae2 homolog CTIP was also shown to interact with MRN complex and be required for the generation of RPA-coated ssDNAs (Clerici et al., 2005Clerici M. Mantiero D. Lucchini G. Longhese M.P. The Saccharomyces cerevisiae Sae2 protein promotes resection and bridging of double strand break ends.J. Biol. Chem. 2005; 280: 38631-38638Crossref PubMed Scopus (157) Google Scholar, Lengsfeld et al., 2007Lengsfeld B.M. Rattray A.J. Bhaskara V. Ghirlando R. Paull T.T. Sae2 is an endonuclease that processes hairpin DNA cooperatively with the Mre11/Rad50/Xrs2 complex.Mol. Cell. 2007; 28: 638-651Abstract Full Text Full Text PDF PubMed Scopus (227) Google Scholar, Mimitou and Symington, 2008Mimitou E.P. Symington L.S. Sae2, Exo1 and Sgs1 collaborate in DNA double-strand break processing.Nature. 2008; 455: 770-774Crossref PubMed Scopus (767) Google Scholar, Sartori et al., 2007Sartori A.A. Lukas C. Coates J. Mistrik M. Fu S. Bartek J. Baer R. Lukas J. Jackson S.P. Human CtIP promotes DNA end resection.Nature. 2007; 450: 509-514Crossref PubMed Scopus (991) Google Scholar, Takeda et al., 2007Takeda S. Nakamura K. Taniguchi Y. Paull T.T. Ctp1/CtIP and the MRN complex collaborate in the initial steps of homologous recombination.Mol. Cell. 2007; 28: 351-352Abstract Full Text Full Text PDF PubMed Scopus (101) Google Scholar). We thus examined whether CTIP, like the MRN complex, would also be involved in SOSS complex focus formation. When cells were treated with CTIP siRNA, only RPA focus formation, but not the focus formation of SOSS complex, was disrupted (Figures 4B and S6A–6D). Conversely, in SOSS-depleted cells, CTIP or RPA2 foci formation was not obviously altered (Figures 4B, S6A–6D, and data not shown), indicating that the foci formation of RPA and SOSS can arise independently of each other. It is now apparent that there are at least two sets of heterotrimeric ssDNA-binding complexes, RPA and SOSS, involved in DNA damage response. The observation that the association of SOSS or CtIP/RPA with ssDNA occurs independently of each other raises the possibility that these two different complexes may each be responsible for a part of this DNA damage repair process. To test this possibility, we compared their relative contributions to HR repair through siRNA-mediated deletion of these proteins either individually or in combination. As shown in Figures 4C and S6E, although HR repair efficiency is impaired in the absence of SOSS-A or CTIP, we noticed that codepletion of SOSS-A and CTIP decreased HR efficiency further than that achieved by SOSS-A or CTIP depletion alone. Consistently, simultaneous ablation of SOSS-A and CTIP by siRNA resulted in a further increase of cellular sensitivity to IR (Figure 4D). Together, these results indicate that SOSS and CtIP/RPA likely represent two independent subpathways, which act at least in part downstream of the MRN complex and function in DNA damage repair (Figure 4E). In summary, we identified a trimeric complex, which we refer to as SOSS complex in this study. The existence of two independent ssDNA-binding complexes, RPA and SOSS, in mammalian cells underscores the importance of this process in DNA repair. We believe that further study of this second human ssDNA-binding heterotrimeric complex will provide insight in the repair of DNA DSBs, especially the poorly understood HR repair process. Rabbit polyclonal anti-SOSS-B1, SOSS-B2, and SOSS-C antibodies were generated by immunizing rabbits with MBP-SOSS-B1, MBP-SOSS-B2, and MBP-SOSS-C recombinant protein expressed and purified from E. Coli, respectively. These antibodies were further affinity purified using columns containing corresponding GST fusion proteins. Antibodies against the myc epitope, γ-H2AX, and RAD51 were previously described (Chen et al., 1998Chen J. Silver D.P. Walpita D. Cantor S.B. Gazdar A.F. Tomlinson G. Couch F.J. Weber B.L. Ashley T. Livingston D.M. Scully R. Stable interaction between the products of the BRCA1 and BRCA2 tumor suppressor genes in mitotic and meiotic cells.Mol. Cell. 1998; 2: 317-328Abstract Full Text Full Text PDF PubMed Scopus (511) Google Scholar, Huen et al., 2007Huen M.S. Grant R. Manke I. Minn K. Yu X. Yaffe M.B. Chen J. RNF8 transduces the DNA-damage signal via histone ubiquitylation and checkpoint protein assembly.Cell. 2007; 131: 901-914Abstract Full Text Full Text PDF PubMed Scopus (814) Google Scholar). The anti-SOSS-A and anti-H3 antibodies were purchased from Bethyl and Millipore, respectively. Anti-CHK1 and GST antibodies were obtained from Santa Cruz Biotechnology Inc. Anti-Flag (M2) and anti-β-actin antibodies were purchased from Sigma. Anti-MRE11, RAD50, and NBS1 antibodies were purchased from Novus Biologicals, Abcam, and Calbiochem, respectively. 293T and HeLa Cells were maintained in RPMI supplemented with 10% fetal bovine serum and 1% penicillin and streptomycin. SF9 insect cells were maintained in Grace's medium supplemented with 10% fetal bovine serum. Cell lines of human origin were maintained in 37°C incubator with 5% CO2, whereas insect cells were maintained at 27°C. U2OS cells with DR-GFP integration were kindly provided by Maria Jasin at Memorial Sloan-Kettering Cancer Center (NY, New York). Cell transfection was performed using Lipofectamine 2000 (Invitrogen) following the manufacturer's protocol. The full-length and deletion/point mutants of human SOSS-A, SOSS-B, SOSS-C, and NBS1 were generated by PCR and subcloned into the pDONR201 vector using Gateway Technology (Invitrogen). The corresponding fragments in entry vectors were transferred into a Gateway compatible destination vector, which harbors an N-terminal triple-epitope tag (S protein tag, flag epitope tag, and streptavidin-binding peptide tag) or a Myc epitope tag for expression in mammalian cells. DNA fragment containing full-length SOSS-A, SOSS-B1, SOSS-C, or NBS1 in pDONR201 vector were transferred to pDEST20, pDEST10, pDEST8, and SFB-tagged vectors for the expression of GST-SOSS-A, His-SOSS-B1, SOSS-C, and SFB fusion proteins in insect cells, respectively. Transposition occurred in DH10Bac-competent cells and correct bacmids confirmed by PCR were transfected into SF9 cells for baculovirus production. After viral amplification, SF9 cells were infected with the desired baculovirus and cell lysates were collected 48 hr later. Sf9 cells were coinfected with baculovirus stocks expressing GST-SOSS-A, His-SOSS-B1, and untagged SOSS-C. Forty-eight hours later, cells were harvested, washed with 1 × PBS, and resuspended in 10 ml lysis buffer (10% [v/v] glycerol, 20 mM HEPES [pH 7.6], 0.3 M KCl, 0.01% NP-40, 1 mM DTT, 0.2 mM PMSF, and 1 μg/ml each of leupeptin, aprotinin, and pepstatin). Cells were homogenized with ten strokes with Dounce homogenizer on ice. The lysate was centrifuged for 15 min at 10,000 rpm. The supernatant was incubated at 4°C with 300 μl of glutathione Sepharose 4B for 4 hr. The resin was washed with wash buffer (lysis buffer containing 0.5 M KCl). Protein was eluted with elution buffer (lysis buffer containing 20 mM glutathione). Eluted protein was dialyzed in buffer B (10% [v/v] glycerol, 20 mM sodium phosphate [pH 7.6], 0.3 M KCl, 0.01% NP-40, and 1 mM DTT) and incubated with 200 μl Ni-NTA beads at 4°C for 4 hr. Ni-NTA beads were washed with wash buffer (buffer B containing 20 mM imidazole) and eluted with elution buffer (buffer B containing 300 mM imidazole). The eluted protein was resolved on Superdex 200 gel filtration column against buffer C (10% [v/v] glycerol, 20 mM HEPES [pH 7.6], 0.3 M KCl, 0.01% NP-40, and 1 mM DTT). Indicated fractions were analyzed on 12.5% SDS-PAGE. Reaction mixtures (20 μl) contained 20 mM Tris-HCl (pH 7.5), 50 mM NaCl, 1 mM MgCl2, 0.5 mM EDTA, 0.2 mM DTT, and 100 pmol 32P-labeled ssDNA (d60T) or dsDNA (d60A-T; d60T annealed to its complimentary d60A) and were incubated with increasing concentrations of SOSS-B1 (0, 0.5, 1, 2, 4, and 6 μM) or SOSS complex (0, 0.5, 1, 2, 4, 6, 8, and 10 μM) for 60 min at 37°C. Reaction was terminated by the addition of 2 μl of gel loading dye (0.1% [w/v] bromophenol blue and 0.1% [w/w] xylene cyanol in 20% glycerol) and transferred on ice. Samples were separated by PAGE in an 8% gel at 10V/cm for 6 hr at 4°C using 45 mM Tris-borate (pH 8.3) and 1 mM EDTA as the running buffer. The gels were visualized by phosphorimaging. All siRNA duplexes were purchased from Dharmacon Research (Lafayette, CO). The following sequences were used in HeLa Cells: SOSS-A#1: GAUGAGAGUUGCUAUGA CAdTdT; SOSS-A#2: CCAAGCGAGCUGUGACGAAdTdT; SOSS-B1: CGACGGA GACCUUUGUGAAdTdT; SOSS-B2: CGUGCAAAGUAGCAGAUAAdTdT; MRE11: GGA GGUACGUCGUUUCAGAdTdT; RAD50: ACAAGGAUCUGGAUAUUUAUU; and NBS1: CCAACUAAAUUGCCAAGUAUU. The following sequences were used in U2OS cells: SOSS-A#1: CGUGAUGGCAUGAAUAUUGdTdT; SOSS-A#2: GUAG UCCACCCUUCUAAUGdTdT; and RAD51: CUAAUCAGGUGGUAGCUCAUU. The siRNA for CtIP was previously described (Yu and Chen, 2004Yu X. Chen J. DNA damage-induced cell cycle checkpoint control requires CtIP, a phosphorylation-dependent binding partner of BRCA1 C-terminal domains.Mol. Cell. Biol. 2004; 24: 9478-9486Crossref PubMed Scopus (311) Google Scholar). The siRNAs transfection was performed using Oligofectamine (Invitrogen) following the manufacturer's instruction. 293T cells were transfected with plasmids encoding SFB-tagged proteins. Cell lines stably expressing tagged proteins were selected by culturing in the medium containing puromycin (2 μg/ml) and confirmed by immunoblotting and immunostaining. For affinity purification, 293T cells stably expressing tagged proteins were lysed with NETN buffer for 20 min. Crude lysates were removed by centrifugation at 14,000 rpm at 4°C for 10 min, and pellet was sonicated for 40 s in high-salt solution (20 mM HEPES [pH 7.8], 0.4 M NaCl, 1 mM EDTA, 1 mM EGTA, and protease inhibitor) to extract chromatin-bound proteins fractions. The supernatants were cleared at 14,000 rpm to remove debris and then incubated with streptavidin-conjugated beads (Amersham) for 2 hr at 4°C. The immunocomplexes were washed three times with NETN buffer and then bead-bound proteins were eluted with NETN buffer containing 1 mg/ml biotin (Sigma). The elutes were incubated with S protein beads (Novagen). The immunocomplexes were again washed three times with NETN buffer and subjected to SDS-PAGE. Protein bands were excised and digested, and the peptides were analyzed by mass spectrometry. To visualize IRIF, cells cultured on coverslips were treated with 10 Gy of gamma irradiation (1 Gy = 100 Rads) followed by recovery for 6 hr. Cells were then fixed using 3% paraformaldehyde solution for 10 min at room temperature and then extracted with buffer containing 0.5% Triton X-100 for 5 min. Samples were blocked with 5% goat serum and incubated with primary antibody for 30 min. Samples were washed and incubated with secondary antibody for 30 min. Cells were then counterstained with DAPI to visualize nuclear DNA. HeLa cells were treated with 2 mM thymidine for 19 hr and then released in fresh medium for 9 hr. Two micromoles of thymidine were added again and cells were incubated for another 16 hr to arrest cells in G1 phase. Cell cycle distributions were confirmed by FACS analysis. Preparation of chromatin fractions were described previously with some modifications (Yu et al., 2006Yu X. Fu S. Lai M. Baer R. Chen J. BRCA1 ubiquitinates its phosphorylation-dependent binding partner CtIP.Genes Dev. 2006; 20: 1721-1726Crossref PubMed Scopus (211) Google Scholar). Briefly, cells were collected 2 hr after treatment with 10 Gy of IR and washed once with PBS. Cell pellets were subsequently resuspended in NETN buffer (10 mM HEPES [pH 7.4], 10 mM KCl, 0.05% NP-40, and protease inhibitors) and incubated on ice for 20 min. Crude lysates were removed by centrifugation at 14,000 rpm at 4°C for 10 min, and pellet was recovered and resuspended in 0.2 M HCl for 20 min. The soluble fraction was then neutralized with 1 M Tris-HCl (pH 8.0) for further analysis. G2/M checkpoint assay was performed as described previously (Lou et al., 2003Lou Z. Chini C.C. Minter-Dykhouse K. Chen J. Mediator of DNA damage checkpoint protein 1 regulates BRCA1 localization and phosphorylation in DNA damage checkpoint control.J. Biol. Chem. 2003; 278: 13599-13602Crossref PubMed Scopus (117) Google Scholar). Briefly, cells were treated with 2 Gy IR. One hour later, cells were fixed with 70% (v/v) ethanol overnight, and then stained with anti-phospho-histone H3 (Ser10) antibody and propidium iodide. Samples were analyzed by flow cytometry to determine the percentages of cells in mitosis. Cells (1 × 103) were seeded onto 60 mm dish in triplicates. Twenty-four hours after seeding, cells were irradiated with IR and then incubated for 14 days. Resulting colonies were fixed and stained with Coomassie blue. Numbers of colonies were counted using a GelDoc with Quantity One software (Bio-Rad). Results were the averages of data obtained from three independent experiments. A U2OS cell clone stably expressing HR reporter DR-GFP was described previously (Weinstock et al., 2006aWeinstock D.M. Nakanishi K. Helgadottir H.R. Jasin M. Assaying double-strand break repair pathway choice in mammalian cells using a targeted endonuclease or the RAG recombinase.Methods Enzymol. 2006; 409: 524-540Crossref PubMed Scopus (125) Google Scholar). U2OS-DR-GFP cells (1 × 106) were electroporated with 12 μg of pCBASce plasmid at 270 V and 975 uF, using a Bio-Rad genepulsar II. Cells were plated onto 10 cm dishes and incubated for 48 hr prior to FACS analyses using a Becton Dickinson FACScan on a green (FL1) versus orange (FL2) fluorescence plot. Results were the averages of data obtained from three independent experiments. We thank all colleagues in Chen's laboratory for insightful discussion and technical assistance, especially Dr. Jingsong Yuan and Michael S.Y. Huen. This work was supported in part by grants from the National Institutes of Health to J.C. (CA089239, CA092312, and CA100109). J.C is a recipient of an Era of Hope Scholar award from the Department of Defense and a member of the Mayo Clinic Breast SPORE program. Download .doc (3.06 MB) Help with doc files Document S1. Six Figures" @default.
• W2043946324 created "2016-06-24" @default.
• W2043946324 creator A5029892501 @default.
• W2043946324 creator A5039747575 @default.
• W2043946324 creator A5057760489 @default.
• W2043946324 creator A5086597104 @default.
• W2043946324 date "2009-08-01" @default.
• W2043946324 modified "2023-10-07" @default.
• W2043946324 title "SOSS Complexes Participate in the Maintenance of Genomic Stability" @default.
• W2043946324 cites W1548113823 @default.
• W2043946324 cites W1966018310 @default.
• W2043946324 cites W1979385111 @default.
• W2043946324 cites W1983346858 @default.
• W2043946324 cites W1987615467 @default.
• W2043946324 cites W1988280121 @default.
• W2043946324 cites W1993026474 @default.
• W2043946324 cites W1998499862 @default.
• W2043946324 cites W2000206408 @default.
• W2043946324 cites W2004360438 @default.
• W2043946324 cites W2006268714 @default.
• W2043946324 cites W2012046347 @default.
• W2043946324 cites W2016789453 @default.
• W2043946324 cites W2019239618 @default.
• W2043946324 cites W2020120461 @default.
• W2043946324 cites W2025370752 @default.
• W2043946324 cites W2038725972 @default.
• W2043946324 cites W2042056279 @default.
• W2043946324 cites W2048839078 @default.
• W2043946324 cites W2059168612 @default.
• W2043946324 cites W2059971436 @default.
• W2043946324 cites W2062520229 @default.
• W2043946324 cites W2081201480 @default.
• W2043946324 cites W2096136751 @default.
• W2043946324 cites W2107991933 @default.
• W2043946324 cites W2125732268 @default.
• W2043946324 cites W2139229198 @default.
• W2043946324 cites W2155947365 @default.
• W2043946324 cites W2157642353 @default.
• W2043946324 cites W2168225429 @default.
• W2043946324 cites W2168732780 @default.
• W2043946324 cites W2171775098 @default.
• W2043946324 doi "https://doi.org/10.1016/j.molcel.2009.06.011" @default.
• W2043946324 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/2756616" @default.
• W2043946324 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/19683501" @default.
• W2043946324 hasPublicationYear "2009" @default.
• W2043946324 type Work @default.
• W2043946324 sameAs 2043946324 @default.
• W2043946324 citedByCount "127" @default.
• W2043946324 countsByYear W20439463242012 @default.
• W2043946324 countsByYear W20439463242013 @default.
• W2043946324 countsByYear W20439463242014 @default.
• W2043946324 countsByYear W20439463242015 @default.
• W2043946324 countsByYear W20439463242016 @default.
• W2043946324 countsByYear W20439463242017 @default.
• W2043946324 countsByYear W20439463242018 @default.
• W2043946324 countsByYear W20439463242019 @default.
• W2043946324 countsByYear W20439463242020 @default.
• W2043946324 countsByYear W20439463242021 @default.
• W2043946324 countsByYear W20439463242022 @default.
• W2043946324 countsByYear W20439463242023 @default.
• W2043946324 crossrefType "journal-article" @default.
• W2043946324 hasAuthorship W2043946324A5029892501 @default.
• W2043946324 hasAuthorship W2043946324A5039747575 @default.
• W2043946324 hasAuthorship W2043946324A5057760489 @default.
• W2043946324 hasAuthorship W2043946324A5086597104 @default.
• W2043946324 hasBestOaLocation W20439463241 @default.
• W2043946324 hasConcept C112972136 @default.
• W2043946324 hasConcept C119857082 @default.
• W2043946324 hasConcept C127413603 @default.
• W2043946324 hasConcept C41008148 @default.
• W2043946324 hasConcept C55587333 @default.
• W2043946324 hasConcept C70721500 @default.
• W2043946324 hasConcept C86803240 @default.
• W2043946324 hasConceptScore W2043946324C112972136 @default.
• W2043946324 hasConceptScore W2043946324C119857082 @default.
• W2043946324 hasConceptScore W2043946324C127413603 @default.
• W2043946324 hasConceptScore W2043946324C41008148 @default.
• W2043946324 hasConceptScore W2043946324C55587333 @default.
• W2043946324 hasConceptScore W2043946324C70721500 @default.
• W2043946324 hasConceptScore W2043946324C86803240 @default.
• W2043946324 hasIssue "3" @default.
• W2043946324 hasLocation W20439463241 @default.
• W2043946324 hasLocation W20439463242 @default.
• W2043946324 hasLocation W20439463243 @default.
• W2043946324 hasLocation W20439463244 @default.
• W2043946324 hasOpenAccess W2043946324 @default.
• W2043946324 hasPrimaryLocation W20439463241 @default.
• W2043946324 hasRelatedWork W1641042124 @default.
• W2043946324 hasRelatedWork W1990804418 @default.
• W2043946324 hasRelatedWork W1993764875 @default.
• W2043946324 hasRelatedWork W2013243191 @default.
• W2043946324 hasRelatedWork W2046158694 @default.
• W2043946324 hasRelatedWork W2051339581 @default.
• W2043946324 hasRelatedWork W2082860237 @default.
• W2043946324 hasRelatedWork W2130076355 @default.
• W2043946324 hasRelatedWork W2151865869 @default.
• W2043946324 hasRelatedWork W4234157524 @default.
• W2043946324 hasVolume "35" @default.

• next