FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2043972038> ?p ?o ?g. }

• W2043972038 endingPage "16106" @default.
• W2043972038 startingPage "16097" @default.
• W2043972038 abstract "Actinomycin D and α-amanitin are commonly used to inhibit transcription. Unexpectedly, however, the transcription of the human immunodeficiency virus (HIV-1) long terminal repeats (LTR) is shown to be activated at the level of elongation, in human and murine cells exposed to these drugs, whereas the Rous sarcoma virus LTR, the human cytomegalovirus immediate early gene (CMV), and the HSP70 promoters are repressed. Activation of the HIV LTR is independent of the NFκB and TAR sequences and coincides with an enhanced average phosphorylation of the C-terminal domain (CTD) from the largest subunit of RNA polymerase II. Both the HIV-1 LTR activation and the bulk CTD phosphorylation enhancement are prevented by several CTD kinase inhibitors, including 5,6-dichloro-1-β-d-ribofuranosylbenzimidazole. The efficacies of the various compounds to block CTD phosphorylation and transcription in vivo correlate with their capacities to inhibit the CDK9/PITALRE kinase in vitro. Hence, the positive transcription elongation factor, P-TEFb, is likely to contribute to the average CTD phosphorylation in vivo and to the activation of the HIV-1 LTR induced by actinomycin D. Actinomycin D and α-amanitin are commonly used to inhibit transcription. Unexpectedly, however, the transcription of the human immunodeficiency virus (HIV-1) long terminal repeats (LTR) is shown to be activated at the level of elongation, in human and murine cells exposed to these drugs, whereas the Rous sarcoma virus LTR, the human cytomegalovirus immediate early gene (CMV), and the HSP70 promoters are repressed. Activation of the HIV LTR is independent of the NFκB and TAR sequences and coincides with an enhanced average phosphorylation of the C-terminal domain (CTD) from the largest subunit of RNA polymerase II. Both the HIV-1 LTR activation and the bulk CTD phosphorylation enhancement are prevented by several CTD kinase inhibitors, including 5,6-dichloro-1-β-d-ribofuranosylbenzimidazole. The efficacies of the various compounds to block CTD phosphorylation and transcription in vivo correlate with their capacities to inhibit the CDK9/PITALRE kinase in vitro. Hence, the positive transcription elongation factor, P-TEFb, is likely to contribute to the average CTD phosphorylation in vivo and to the activation of the HIV-1 LTR induced by actinomycin D. α-Amanitin and actinomycin D are commonly used inhibitors of transcription. α-Amanitin binds to the largest subunits of RNA polymerase II (RNAP II) 1The abbreviations used are: RNAP, RNA polymerase II; HIV-1, human immunodeficiency virus type 1; LTR, long terminal repeats; CTD, C-terminal domain; RSV, Rous sarcoma virus; CMV, cytomegalovirus; DRB, 5,6-dichloro-1-β-d-ribofuranosylbenzimidazole; CDK, cyclin-dependent kinases; PCR, polymerase chain reaction; Pipes, 1,4-piperazinediethanesulfonic acid. (1Kédinger C. Gniazdowski M. Mandel J.L. Gissinger F. Chambon P. Biochem. Biophys. Res. Commun. 1970; 38: 165-171Crossref PubMed Scopus (365) Google Scholar,2Lindell T.J. Weinberg F. Morris P.W. Roeder R.G. Rutter W.J. Science. 1970; 170: 447-449Crossref PubMed Scopus (666) Google Scholar) and RNAP III (3Weinman R. Roeder R.G. Proc. Natl. Acad. Sci. U. S. A. 1974; 71: 1790-1794Crossref PubMed Scopus (311) Google Scholar), with RNAP II being the most sensitive. As a consequence, the incorporation of new ribonucleotides into the nascent RNA chains is blocked (4de Mercoyrol L. Job C. Job D. Biochem. J. 1989; 258: 165-169Crossref PubMed Scopus (37) Google Scholar). Actinomycin D is generally thought to intercalate into DNA thereby preventing the progression of RNA polymerases, with RNAP I being the most sensitive (5Perry R.P. Kelley D.E. J. Cell. Physiol. 1970; 76: 127-140Crossref PubMed Scopus (407) Google Scholar, 6Sobell H.M. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 5328-5331Crossref PubMed Scopus (404) Google Scholar). In previous work, we have shown that the average phosphorylation of RNAP II C-terminal domain (CTD) increases in cells exposed to actinomycin D (7Dubois M.F. Nguyen V.T. Bellier S. Bensaude O. J. Biol. Chem. 1994; 269: 13331-13336Abstract Full Text PDF PubMed Google Scholar,8Dubois M.-F. Bellier S. Seo S.-J. Bensaude O. J. Cell. Physiol. 1994; 158: 417-426Crossref PubMed Scopus (49) Google Scholar). The activity of RNAP II is regulated by multisite phosphorylation on the CTD (9Dahmus M.E. J. Biol. Chem. 1996; 271: 19009-19012Abstract Full Text Full Text PDF PubMed Scopus (462) Google Scholar). The underphosphorylated CTD mediates multiple protein-protein interactions involved in the assembly of a preinitiation complex. The subsequent phosphorylation of the CTD occurs along the initiation of transcription and contributes to disrupt some of the interactions that lead to the assembly of the preinitiation complex on promoters. Phosphorylation of RNAP II at this step is required to elongate transcription and mediates the recruitment of various enzymatic complexes involved in processing of the primary transcript (10Corden J.L. Patturajan M. Trends Biochem. Sci. 1997; 22: 413-416Abstract Full Text PDF PubMed Scopus (149) Google Scholar, 11Shuman S. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 12758-12760Crossref PubMed Scopus (42) Google Scholar, 12Bentley D. Nature. 1998; 395: 21-22Crossref PubMed Scopus (12) Google Scholar). In contrast, phosphorylation of the CTD prior to the formation of the preinitiation complex represses the expression of specific genes (13Hengartner C.J. Myer V.E. Liao S.-M. Wilson C.J. Koh S.S. Young R.A. Mol. Cell. 1998; 2: 43-53Abstract Full Text Full Text PDF PubMed Scopus (335) Google Scholar). Hence, the increase in average phosphorylation of the CTD promoted by actinomycin D raises the possibility that different genes may have different susceptibilities to this drug. Several cyclin-dependent kinases (CDK) have been shown to phosphorylate the CTD and regulate transcription. CDK7, and its partner, cyclin H, are subunits of the general transcription factor, TFIIH, a component of the preinitiation complex (14Svejstrup J.Q. Vichi P. Egly J.-M. Trends Biochem. Sci. 1996; 21: 346-350Abstract Full Text PDF PubMed Scopus (196) Google Scholar, 15Orphanides G. Lagrange T. Reinberg D. Genes Dev. 1996; 10: 2657-2683Crossref PubMed Scopus (849) Google Scholar); CDK8 and its partner cyclin C belong to the RNAP II holoenzyme (16Koleske A.J. Young R.A. Trends Biochem. Sci. 1995; 20: 113-116Abstract Full Text PDF PubMed Scopus (266) Google Scholar, 17Leclerc V. Tassan J.P. O'Farrell P.H. Nigg E.A. Léopold P. Mol. Biol. Cell. 1996; 7: 505-513Crossref PubMed Scopus (76) Google Scholar); CDK9/PITALRE, and its partners, cyclins T1 and T2, are subunits of the transcription elongation factor P-TEFb (18Peng J. Zhu Y. Milton J.T. Price D.H. Genes Dev. 1998; 12: 755-762Crossref PubMed Scopus (450) Google Scholar). 5,6-Dichloro-1-β-d-ribofuranosylbenzimidazole (DRB) is another widely used transcriptional inhibitor (19Egyházi E. Nature. 1976; 262: 319-321Crossref PubMed Scopus (36) Google Scholar) that inhibits CDK7 (20Yankulov K. Yamashita K. Roy R. Egly J.M. Bentley D.L. J. Biol. Chem. 1995; 270: 23922-23925Abstract Full Text Full Text PDF PubMed Scopus (162) Google Scholar) and CDK9/PITALRE (21Zhu Y. Pe'ery T. Peng J. Ramanathan Y. Marshall N. Marshall T. Amendt B. Mathews M.B. Price D.H. Genes Dev. 1997; 11: 2622-2632Crossref PubMed Scopus (612) Google Scholar). The average CTD phosphorylation is decreased in cells exposed to DRB (7Dubois M.F. Nguyen V.T. Bellier S. Bensaude O. J. Biol. Chem. 1994; 269: 13331-13336Abstract Full Text PDF PubMed Google Scholar), suggesting that these kinases might contribute to global CTD phosphorylation in vivo. Involvement of the CDK7 and CDK9/PITALRE kinases in transcription is probably best documented for the human immunodeficiency virus type 1 (HIV-1) long terminal repeat (LTR) promoter. Transcriptional activation of the HIV LTR at the level of elongation is a key step for the viral replication cycle and has been extensively analyzed (reviewed in Refs.22Garcia J.A. Gaynor R. Prog. Nucleic Acid Res. 1994; 49: 157-196Crossref PubMed Scopus (33) Google Scholar and 23Jones K.A. Peterlin B.M. Annu. Rev. Biochem. 1994; 63: 717-743Crossref PubMed Scopus (558) Google Scholar). Like other retroviruses, the HIV can integrate in the cellular genome and remain silent for an indefinite period (24McCune J.M. Cell. 1995; 82: 183-188Abstract Full Text PDF PubMed Scopus (68) Google Scholar). In the latently infected cells, the basal transcription directed by the HIV LTR is inefficient as most of the transcription initiation events abort approximately 60–80 nucleotides (including the TAR RNA) downstream of the transcription initiation site (25Sheldon M. Ratneswaran R. Hernandez N. Mol. Cell. Biol. 1993; 13: 1251-1263Crossref PubMed Scopus (65) Google Scholar). A great variety of stimulations switch the latent-infected cells to cells producing viral proteins including Tat and viral particles. The Tat protein binds the TAR RNA and activates the transcription directed by the LTR promoter (reviewed in Refs. 26Cullen B.R. Cell. 1998; 93: 685-692Abstract Full Text Full Text PDF PubMed Scopus (304) Google Scholar and 27Emerman M. Malim M.H. Science. 1998; 280: 1880-1884Crossref PubMed Scopus (311) Google Scholar). Tat binds to a number of components of the basal transcriptional machinery such as TATA-binding protein or the RNAP II holoenzyme (28Kingsman S.M. Kingsman A.J. Eur. J. Biochem. 1996; 240: 491-507Crossref PubMed Scopus (106) Google Scholar, 29Cujec T.P. Cho H. Maldonado E. Meyer J. Reinberg D. Peterlin B.M. Mol. Cell. Biol. 1997; 17: 1817-1823Crossref PubMed Scopus (108) Google Scholar). Phosphorylation of the CTD assisted by the viral protein Tat is essential in establishing an efficient transcription of the entire viral genome (reviewed in Ref. 30Jones K.A. Genes Dev. 1997; 11: 2593-2599Crossref PubMed Scopus (196) Google Scholar). The Tat protein first facilitates the phosphorylation of the CTD by CDK7. In a second step, Tat recruits the CDK9/PITALRE CTD kinase (21Zhu Y. Pe'ery T. Peng J. Ramanathan Y. Marshall N. Marshall T. Amendt B. Mathews M.B. Price D.H. Genes Dev. 1997; 11: 2622-2632Crossref PubMed Scopus (612) Google Scholar, 31Wei P. Garber M.E. Fang S.-M. Fischer W.H. Jones K.A. Cell. 1998; 92: 451-462Abstract Full Text Full Text PDF PubMed Scopus (1051) Google Scholar). Therefore, to investigate whether an enhanced CTD phosphorylation influences the efficiency of actinomycin D and α-amanitin on transcription of identified genes, we followed their effect on the expression of a reporter gene driven by the HIV-1 LTR or by the human cytomegalovirus (CMV) immediate early promoters. Unexpectedly, both drugs were found to promote an enhanced reporter expression when the corresponding cDNA was placed under the control of the HIV-1 LTR promoter. This stimulation is shown to be at the level of elongation of transcription and is suggested to be linked to an enhanced average CTD phosphorylation which may involve the CDK9/PITALRE CTD kinase. The luciferase cDNA was placed under the control of the Rous sarcoma virus (RSV) LTR, pRSVLuc, (32De Wet J.R. Wood K.V. DeLuca M. Helinsky D.R. Subramani S. Mol. Cell. Biol. 1987; 7: 725-737Crossref PubMed Scopus (2481) Google Scholar) or the HIV-1 ARV-2 LTR between nucleotides −167 and +46, pHIVLucA41 (33Harrison G.S. Maxwell F. Long C.J. Rosen C.A. Glode L.M. Maxwell I.H. Hum. Gene Ther. 1991; 2: 53-60Crossref PubMed Scopus (60) Google Scholar). Plasmid pLTRWTLuc contained the HIV-1 ARV-2 LTR wild type sequences from −644 to +83, plasmid pLTRΔkBLuc derived from pLTRWTLuc, and the NFκB sites A and B were deleted and replaced by a BclI linker (34Bachelerie F. Alcami J. Arenzana-Seisdedos F. Virelizier J.L. Nature. 1991; 350: 709-712Crossref PubMed Scopus (151) Google Scholar). Plasmid pLTR476Luc contained the luciferase cDNA controlled by the HIV-1 ARV-2 LTR wild type sequences from −177 to +83; in the plasmid pLTR361ΔSp1Luc derived from pLTR476Luc, the three Sp1 sites (−75 to −50) have been replaced by the sequence 5′-ATATCGTGGC CTGTGTAGTC CGTGCC. Plasmids pLTRXLuc, pLTRBLuc, and pLTRBΔTARLuc contained the luciferase cDNA controlled by the HIV-1 Bru LTR between, respectively, nucleotides −644 to +83, −489 to +83, and −489 to +32 (35Schwartz O. Virelizier J.L. Montagnier L. Hazan U. Gene (Amst.). 1990; 88: 197-205Crossref PubMed Scopus (89) Google Scholar). Plasmid pHSPLuc contains the luciferase cDNA under the control of the human HSP70 promoter (36Morgan W.D. Williams G.T. Morimoto R.I. Greene J. Kingston R.E. Tjian R. Mol. Cell. Biol. 1987; 7: 1129-1138Crossref PubMed Scopus (122) Google Scholar), and plasmids pCMVTat and pCMVLuc contain the human cytomegalovirus (CMV) immediate early promoter followed by the cDNAs coding for either the Tat protein or luciferase (35Schwartz O. Virelizier J.L. Montagnier L. Hazan U. Gene (Amst.). 1990; 88: 197-205Crossref PubMed Scopus (89) Google Scholar). To generate plasmid pCM/IVLuc, the CMV sequences between −324 and −18 (relative to the transcription initiation site) were amplified by PCR from plasmid pCMVLuc using the primers 5′-GCGATCTCGA GCGTCAATGACG GTAAATG and 5′-GCATGCAGCT GCTTATATAG ACCTCC. The amplified fragment was digested with XhoI andPvuII and inserted between the unique XhoI andPvuII sites of pHIVLucA41. To generate plasmid pHI/MVLuc, the pCMVLuc sequences between −18 and +738 were amplified by PCR using the primers 5′-GAATATCAGC TGCTCGTTTA GTGAACCGTC AG and 5′-CTGGCATGCG AGAATCTGAC GCAGGCAGTT. The amplified fragment was digested withPvuII and BstEII and inserted between the uniquePvuII and BstEII sites of pHIVLucA41. To generate pmTATALuc, the pHIVLucA41 sequences were amplified by PCR using the primers 5′-GCAAAAAGCA GCTGCTTGTC TGCAGCATCT GAG and 5′-AACCTGATAT CCCCTCGAGG TCACGT that replaced the TATA box sequence by GACA. The amplified fragment was digested with XhoI andPvuII and inserted between the unique XhoI andPvuII sites of pHIVLucA41. All these plasmids were controlled by sequencing the 3′ ends of the promoter fragments. Murine Ltk−, NIH 3T3, and human HeLa cells (MRL2 strain) were cultured in Dulbecco's modified Eagle's medium (Life Technologies, Inc.) supplemented with 10% fetal calf serum. The muHL6b were derived from Ltk− cells after cotransfection with pHIVLucA41 and pAGO, plasmid carrying the herpes thymidine kinase gene. The huHL6 cells were derived from HeLa cells cotransfected with pHIVLucA41 and pRSVtkneo, a plasmid carrying the neomycin resistance gene. Clones were subcloned and selected, respectively, in HAT or G418 medium for luciferase expression. In transient transfection assays, cells were transfected by the standard calcium phosphate procedure and left to grow for 24 h before addition of the various drugs; semi-confluent growing cells, 8 × 105 cells per well of a 24-well tissue culture plate, were transfected with 0.25 μg of luciferase expression vector supplemented with 2 μg of DNA with plasmid pSP64 (Promega) as a carrier. Actinomycin D, α-amanitin, and DRB were purchased from Sigma. TRB, T276339, H7, T172298, T525636, T172299, and T163693 were kindly provided by Dr. Osvaldo Flores as 10 mm stock solutions in dimethyl sulfoxide (37Mancebo H.S. Lee G. Flygare J. Tomassini J. Luu P. Zhu Y. Peng J. Blau C. Hazuda D. Price D. Flores O. Genes Dev. 1997; 11: 2633-2644Crossref PubMed Scopus (479) Google Scholar). Cells were washed twice in ice-chilled phosphate-buffered saline and lysed on ice in buffer A (25 mm Tris-H3PO4, pH 7.8, 10 mm MgCl2, 1% Triton X-100, 1 mm2-mercaptoethanol 1 mm EDTA, and 15% glycerol). Luciferase activity was determined using a Berthold luminometer and mixing 150 μl of cell lysate to 100 μl of buffer A containing 1.2 mm ATP and 0.33 mm luciferin and measuring the light emission for 10 s after mixing. Total cellular RNAs were isolated by the guanidinium thiocyanate method. 15 μg of total RNA were denatured 15 min at 65 °C in 6% formaldehyde, run on a 1.2% agarose, 6.3% formaldehyde gel. Equal loading of each lane was checked by ethidium bromide staining. The gels were blotted onto Hybond N nylon membrane (Amersham Pharmacia Biotech) that were UV cross-linked, prehybridized at 65 °C for 1 h in 0.5 mNa2HPO4, 1% bovine serum albumin, 1 mm EDTA, and 7% SDS and hybridized overnight at 65 °C to radiolabeled probes in the prehybridization solution. The membranes were washed twice at room temperature in 2× NaCl/citrate buffer (SSC), 0.1% SDS for 1 h and twice at 42 °C in 0.2× SSC, 0.1% SDS for 1 h. Membranes were autoradiographed. Quantification was performed with a FUJI BAS-1 PhosphorImager. Before reprobing, the membranes were boiled for 10 min in 0.1% SDS to strip off the hybridized probe. DNA probes for luciferase from pRSVL (32De Wet J.R. Wood K.V. DeLuca M. Helinsky D.R. Subramani S. Mol. Cell. Biol. 1987; 7: 725-737Crossref PubMed Scopus (2481) Google Scholar), cytoplasmic actin from pAL41 (38Alonso S. Minty A. Bourlet Y. Buckingham M. J. Mol. Evol. 1986; 23: 11-22Crossref PubMed Scopus (604) Google Scholar), mouse 18 S ribosomal RNA from pMSE2 (39Raynal F. Michot B. Bachellerie J.P. FEBS Lett. 1984; 167: 263-268Crossref PubMed Scopus (149) Google Scholar), WAF-1 (40Nakanishi M. Robertorye R.S. Adami G.R. Pereira-Smith O. Smith J.R. EMBO J. 1995; 14: 555-563Crossref PubMed Scopus (172) Google Scholar), and HSC73 from pRC62 (41O'Malley K. Mauron A. Barchas J.D. Kedes L. Mol. Cell. Biol. 1985; 5: 3476-3483Crossref PubMed Scopus (132) Google Scholar) were labeled by random priming. The Alu5 luciferase antisense primer, 5′-TCTTTATGTT TTTGGCGTCT TCCAT, was end-labeled with T4 kinase. 20 μg of total RNA were denatured 10 min at 75 °C and annealed to the primer overnight at 42 °C in 20 μl 10 mm Pipes, pH 6.4, and 400 mm NaCl, overlaid with 20 μl of mineral oil. Nucleic acids were precipitated in ethanol and redissolved in 20 μl of 50 mm Tris-HCl, pH 8.2, 6 mm MgCl2, 10 mm dithiothreitol, 100 μm of the four dNTPs, 0.1 unit/μl RNasin (Promega), and 1 unit/μl SuperScript II RNase H− reverse transcriptase (Life Technologies, Inc.). Primer extension was performed at 42 °C for 60 min using the Alu5 luciferase primer. Nucleic acids were precipitated in ethanol, redissolved in formamide loading buffer, and run on a 10% denaturing polyacrylamide-urea gel. The dried gels were exposed for autoradiography. DNA sequences were obtained using the Alu5 primer, plasmid pHIVLucA41, and a T7 Sequencing kit (Amersham Pharmacia Biotech). The primers GCCCTCAGATGCTGCATATA and CGGTCCATCCTCTAGAGGAT were used to generate the 5′ probes (177 base pairs from −42 to +136), whereas the primers CAGCTATTCTGATTACACCCG and ATTCGCCTCTCTGATTAACG were used for the M probes (127 base pairs from +1111 to +1238). These primers were used to amplify DNA fragments by symmetric PCR (30 cycles) using pHIVLucA41Luc as a starting template. The single-strand antisense probes were amplified from these DNA fragments by asymmetric PCR (30 cycles) using only one of the primers. Run-on assays were performed following established procedures (42Linial M. Gunderson N. Groudine M. Science. 1985; 230: 1126-1132Crossref PubMed Scopus (257) Google Scholar). 2 × 107 nuclei were allowed to transcribe in vitro for 20 min at 30 °C in the presence of [α-32P]UTP, non-radioactive ATP, CTP, and GTP with or without α-amanitin (0.1 μg/ml), and the resulting RNAs were isolated. These RNAs were hybridized to Hybond-N+ membranes (Amersham Pharmacia Biotech) on which either linearized and denatured plasmids (5 μg) or single-strand probes (1 μg) had been slotted. Hybridizations were at 65 °C in Church buffer (0.5 m sodium phosphate, 7% SDS, 1 mm EDTA, 1% serum albumin). Dehybridization washes were done at 65 °C in 0.2× SSC, 0.5% SDS. The cells were dissolved in 1× Laemmli buffer, and the samples were heated for 5 min at 95 °C before loading on sodium dodecyl sulfate-5% polyacrylamide gels. The RNAP II largest subunit was detected with the POL 3/3 antibody that recognizes an epitope located outside the CTD (43Kontermann R.E. Liu Z. Schulze R.A. Sommer K.A. Queitsch I. Dubel S. Kipriyanov S.M. Breitling F. Bautz E.K. Biol. Chem. Hoppe-Seyler. 1995; 376: 473-481Crossref PubMed Scopus (31) Google Scholar). This monoclonal antibody was visualized with an anti-mouse IgG horseradish peroxidase conjugate (Promega) and chemiluminescence (Pierce). To investigate the dose effect of α-amanitin on the expression of a reporter gene under the control of a defined promoter, firefly luciferase activity was followed in lysates from muHL6b cells exposed to varying amounts of the drug for 24 h. This clonal cell line was derived from murine Ltk− cells stably transfected with a plasmid, pHIVLucA41, in which the luciferase cDNA had been placed under the control of an HIV LTR. Unexpectedly, increasing amounts of luciferase activity were found in lysates from muHL6b cells exposed during 24 h to α-amanitin up to 30 μg/ml (Fig.1 A). The highest stimulation (∼28-fold) was achieved at 10 μg/ml, a rather elevated concentration. To extend these observations to other cell systems, we stably transfected HeLa cells with pHIVLucA41 and isolated the huHL6 clonal human cell line. α-Amanitin also stimulated the luciferase expression in huHL6 cells but with much lower efficiency than in the murine cells (only 3.5-fold). To establish whether the increase in luciferase synthesis might be related to a general interference with transcription, we investigated the response to actinomycin D, another transcriptional inhibitor acting through a different mechanism. The luciferase activity increased up to 130-fold in muHL6b cells treated with an optimal actinomycin D concentration around 0.3 μg/ml and up to 45-fold in the huHL6 cells, culminating for 0.2 μg/ml of actinomycin D (Fig. 1 B). Due to a higher actinomycin toxicity, the increase in luciferase activity dropped more rapidly than with the muHL6b cells. This increase was exponential between 0 and 20 h of treatment (Fig. 1 C), but to be observed, the cells had to remain exposed to the drug until lysis; and when actinomycin D was removed after 6 h, no significant increase was observed 18 h later (data not shown). Thus, moderate actinomycin D or α-amanitin concentrations enhance luciferase synthesis in murine and human cell lines stably transfected with a plasmid associating the HIV-1 LTR to the luciferase cDNA. But no stimulation was observed when actinomycin D (0.2 μg/ml) and α-amanitin (10 μg/ml) were added simultaneously (data not shown). This finding as well as the bell-shaped dose-response curves suggests two opposing effects: an activation and an inhibition. At high drug concentration, the latter overcomes. The increased expression of the luciferase gene in stably transfected cells might relate to a positional effect in the region of plasmid DNA insertion. Indeed, Tat transactivation of the HIV-1 LTR has been reported to differ for integrated versus unintegrated vectors (44Jeang K.-T. Berkhout B. Dropulic B. J. Biol. Chem. 1993; 268: 24940-24949Abstract Full Text PDF PubMed Google Scholar). Therefore, HeLa cells were transiently transfected with the pHIVLucA41 plasmid. The luciferase activity in the lysates was strongly enhanced when the cells were exposed 24 h to actinomycin D after transfection (Fig.2). The strongest effects were obtained around 0.1 μg/ml drug, and higher concentrations led to a drop in activation. The optimal drug concentration was lower than with the related huHL6 cells as the calcium phosphate treatment exacerbated an extensive cell death. The transient transfection assays allowed us to compare different promoters. Therefore, HeLa cells were transfected with plasmids associating the luciferase cDNA to other promoters such as the Rous sarcoma virus LTR (RSV), the cytomegalovirus early promoter (CMV), or the human HSP70 promoter (there was no need to stress the cells to observe a relatively high basal level of HSP70-driven luciferase expression). In the two latter cases, the luciferase activity in the lysates decreased with increasing concentrations of actinomycin D (Fig. 2). However, the Rous sarcoma virus LTR resisted inhibition up to 0.1 μg/ml actinomycin D. These results, which were also obtained upon transient transfection of NIH 3T3 cells (not shown), suggest that the effect of actinomycin D is a characteristic of the HIV LTR promoter. To establish that the increase in luciferase activity reflected an increase in the corresponding mRNA, total RNAs were isolated from muHL6b cells incubated with actinomycin D for 24 h and were analyzed by Northern blot. The luciferase probe detected a major RNA species between the 18 S and the 28 S rRNAs and a minor species below the 18 S RNA (Fig.3 A). The size of the major species (2.9 ± 0.2 kilobases) was consistent with the 2.62 kilobase pairs separating the expected transcription initiation from the termination site on the pHIVLucA41 plasmid and likely corresponded to a full-length luciferase mRNA as the luciferase cDNA coding sequence spans over 1650 bases (32De Wet J.R. Wood K.V. DeLuca M. Helinsky D.R. Subramani S. Mol. Cell. Biol. 1987; 7: 725-737Crossref PubMed Scopus (2481) Google Scholar). In muHL6b cells treated for 24 h with actinomycin D, both RNA species markedly increased in a dose-dependent manner (Fig. 3 A, left). The highest increase was observed with cells treated with 0.2 μg/ml actinomycin D. At higher concentrations (2 μg/ml), the signal corresponding to luciferase mRNA remained as in the controls and decreased at 20 μg/ml (not shown). The increase in luciferase mRNA was observable after 6 h of exposure to 0.2 μg/ml actinomycin D (Fig. 3 A, right). When the muHL6b cells were exposed to α-amanitin, the 2.9 kilobase pairs of luciferase mRNA abundance also increased with time (Fig. 3 B). To evaluate the general transcriptional inhibition, the above-mentioned Northern blots were rehybridized with cellular genes probes. In RNAs prepared from muHL6b cells, the actin and the 70-kDa heat shock cognate (HSC73) probes each detected a single mRNA species with the expected sizes. When the cells were exposed to actinomycin D at concentrations above 0.02 μg/ml, both the actin and HSC73 mRNA abundance decreased indicating that these genes were inhibited (Fig.3 A). The decrease was more pronounced for HSC73 due to the shorter half-life of the corresponding mRNA in murine cells. Both signals were distinctly stronger with 0.2 μg/ml than with 2 μg/ml actinomycin D indicating that for this concentration, which was optimal for luciferase induction, the transcriptional inhibition was not complete. When the muHL6b cells were exposed to α-amanitin, the HSC73 mRNA levels also decreased (Fig. 3 B). When the RNAs were prepared from actinomycin-treated huHL6 cells, a strong increase in luciferase mRNA was also observed, but the minor species was less abundant than in muHL6b cells (Fig. 3 C). Very low concentrations of actinomycin D (0.006 μg/ml) have been reported to promote an increase in p21WAF-1 mRNA in MRC5 human fibroblasts (45Bates S. Rowan S. Vousden K.H. Oncogene. 1996; 13: 1103-1109PubMed Google Scholar). However, no reliable changes in p21WAF-1 signals were found in huHL6 cells exposed to actinomycin D in the 0.02 to 0.1 μg/ml range. Primer extension using RNAs prepared from actinomycin D-treated huHL6 cells demonstrated that under these conditions, the luciferase mRNAs were correctly initiated at the usual +1 position (Fig. 4). Thus, treatments that determine an enhanced luciferase mRNA accumulation lead to a neat decrease in housekeeping gene mRNAs indicating a general transcriptional arrest. The increase in luciferase mRNA abundance was more pronounced with actinomycin D than with α-amanitin, as anticipated by luciferase activity determinations. To establish that the accumulation of luciferase mRNA was due to an enhanced transcription of the corresponding gene, run-on assays were performed with nuclei prepared from huHL6 cells untreated or exposed to actinomycin D. The actinomycin D treatment determined a 13-fold increase in the luciferase gene signal (Fig.5 A). In contrast, the actin and HSC73 gene signals remained unaffected, and the ribosomal gene signal decreased more than 100 times as expected from the known high susceptibility of class I gene transcription (5Perry R.P. Kelley D.E. J. Cell. Physiol. 1970; 76: 127-140Crossref PubMed Scopus (407) Google Scholar). To demonstrate that the luciferase gene transcription in actinomycin D-treated cells was attributable to RNAP II transcription, the run-ons were also performed in the presence of α-amanitin in the assay (0.1 μg/ml). Addition of α-amanitin to nuclei prepared from control untreated cells did not affect the 18 S rRNA signal as expected since RNAP I is insensitive to this compound; however, it completely wiped off the luciferase and the actin signals. The luciferase and actin signals as well as the remaining 18 S signal were also suppressed by addition of α-amanitin to nuclei from actinomycind-treated cells. First, it should be emphasized that this finding does not conflict the data provided in Fig. 1 A asin vitro α-amanitin poisoning of RNAP II is likely to be fast and complete, whereas in vivo it is a slow, incomplete process controlled by the penetration of the drug (46Kidder G.M. Green A.F. McLachlin J.R. J. Exp. Zool. 1985; 233: 155-159Crossref PubMed Scopus (18) Google Scholar, 47Nguyen V.T. Giannoni F. Dubois M.-F. Seo S.-J. Vigneron M. Kédinger C. Bensaude O. Nucleic Acids Res. 1996; 24: 2924-2929Crossref PubMed Scopus (203) Google Scholar). Second, an involvement of RNAP II in ribosomal DNA transcription has been shown to occur in yeast cells that lack RNAP I activity (48Conrad-Webb H. Butow R.A. Mol. Cell. Biol. 1995; 15: 2420-2428Crossref PubMed Scopus (67) Google Scholar). To discriminate between an enhanced initiation of transcription and an enhanced elongation of transcription, the run-ons" @default.
• W2043972038 created "2016-06-24" @default.
• W2043972038 creator A5015959862 @default.
• W2043972038 creator A5021306262 @default.
• W2043972038 creator A5049585595 @default.
• W2043972038 creator A5053591491 @default.
• W2043972038 creator A5070363854 @default.
• W2043972038 date "1999-06-01" @default.
• W2043972038 modified "2023-10-17" @default.
• W2043972038 title "The Transcriptional Inhibitors, Actinomycin D and α-Amanitin, Activate the HIV-1 Promoter and Favor Phosphorylation of the RNA Polymerase II C-terminal Domain" @default.
• W2043972038 cites W1484532115 @default.
• W2043972038 cites W1517171683 @default.
• W2043972038 cites W1521159279 @default.
• W2043972038 cites W1590436404 @default.
• W2043972038 cites W1605613258 @default.
• W2043972038 cites W1606360269 @default.
• W2043972038 cites W1743350135 @default.
• W2043972038 cites W1824520331 @default.
• W2043972038 cites W1882361119 @default.
• W2043972038 cites W1964197602 @default.
• W2043972038 cites W1967946050 @default.
• W2043972038 cites W1969528530 @default.
• W2043972038 cites W1972920876 @default.
• W2043972038 cites W1973000551 @default.
• W2043972038 cites W1973429171 @default.
• W2043972038 cites W1974881056 @default.
• W2043972038 cites W1976675484 @default.
• W2043972038 cites W1977660540 @default.
• W2043972038 cites W1988626042 @default.
• W2043972038 cites W1990213691 @default.
• W2043972038 cites W1991985869 @default.
• W2043972038 cites W2000833264 @default.
• W2043972038 cites W2001406822 @default.
• W2043972038 cites W2003868334 @default.
• W2043972038 cites W2006409246 @default.
• W2043972038 cites W2011303568 @default.
• W2043972038 cites W2021739060 @default.
• W2043972038 cites W2027982069 @default.
• W2043972038 cites W2028902411 @default.
• W2043972038 cites W2029816972 @default.
• W2043972038 cites W2033834764 @default.
• W2043972038 cites W2034331383 @default.
• W2043972038 cites W2044961083 @default.
• W2043972038 cites W2045854456 @default.
• W2043972038 cites W2046091591 @default.
• W2043972038 cites W2046854154 @default.
• W2043972038 cites W2048180296 @default.
• W2043972038 cites W2053476280 @default.
• W2043972038 cites W2058106399 @default.
• W2043972038 cites W2064050331 @default.
• W2043972038 cites W2070144920 @default.
• W2043972038 cites W2070837106 @default.
• W2043972038 cites W2072836045 @default.
• W2043972038 cites W2074300083 @default.
• W2043972038 cites W2076100163 @default.
• W2043972038 cites W2076701374 @default.
• W2043972038 cites W2080759619 @default.
• W2043972038 cites W2085008509 @default.
• W2043972038 cites W2085985329 @default.
• W2043972038 cites W2087000089 @default.
• W2043972038 cites W2088358220 @default.
• W2043972038 cites W2089404827 @default.
• W2043972038 cites W2090594487 @default.
• W2043972038 cites W2092644213 @default.
• W2043972038 cites W2093814954 @default.
• W2043972038 cites W2094973595 @default.
• W2043972038 cites W2105192976 @default.
• W2043972038 cites W2108422586 @default.
• W2043972038 cites W2108857688 @default.
• W2043972038 cites W2112139849 @default.
• W2043972038 cites W2117262917 @default.
• W2043972038 cites W2121542842 @default.
• W2043972038 cites W2124253765 @default.
• W2043972038 cites W2124330168 @default.
• W2043972038 cites W2125026064 @default.
• W2043972038 cites W2129277820 @default.
• W2043972038 cites W2135736528 @default.
• W2043972038 cites W2136222232 @default.
• W2043972038 cites W2148330261 @default.
• W2043972038 cites W2154743385 @default.
• W2043972038 cites W2156506178 @default.
• W2043972038 cites W2164154631 @default.
• W2043972038 cites W2166604988 @default.
• W2043972038 cites W2168453023 @default.
• W2043972038 cites W2179112409 @default.
• W2043972038 cites W2327225020 @default.
• W2043972038 cites W343278539 @default.
• W2043972038 cites W4237570448 @default.
• W2043972038 cites W63697704 @default.
• W2043972038 cites W1970553988 @default.
• W2043972038 cites W28413234 @default.
• W2043972038 doi "https://doi.org/10.1074/jbc.274.23.16097" @default.
• W2043972038 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10347161" @default.
• W2043972038 hasPublicationYear "1999" @default.
• W2043972038 type Work @default.
• W2043972038 sameAs 2043972038 @default.
• W2043972038 citedByCount "95" @default.
• W2043972038 countsByYear W20439720382012 @default.

• next