FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2044079355> ?p ?o ?g. }

• W2044079355 endingPage "19499" @default.
• W2044079355 startingPage "19492" @default.
• W2044079355 abstract "Mammalian cationic amino acid transporters (CAT) differ in their substrate affinity and sensitivity to trans-stimulation. The apparent Km values for cationic amino acids and the sensitivity to trans-stimulation of CAT-1, -2B, and -3 are characteristic of system y+. In contrast, CAT-2A exhibits a 10-fold lower substrate affinity and is largely independent of substrate at the trans-side of the membrane. CAT-2A and -2B demonstrate such divergent transport properties, even though their amino acid sequences differ only in a stretch of 42 amino acids. Here, we identify two amino acid residues within this 42-amino acid domain of the human CAT-2A protein that are responsible for the apparent low affinity of both the extracellular and intracellular substrate-binding sites. These residues are located in the fourth intracellular loop, suggesting that they are not part of the translocation pathway. Rather, they may be responsible for the low affinity conformation of the substrate-binding sites. The sensitivity to trans-stimulation is not determined by the same amino acid residues as the substrate affinity and must involve a more complex interaction between individual amino acid residues. In addition to the 42-amino acid domain, the adjacent transmembrane domain X seems to be involved in this function. Mammalian cationic amino acid transporters (CAT) differ in their substrate affinity and sensitivity to trans-stimulation. The apparent Km values for cationic amino acids and the sensitivity to trans-stimulation of CAT-1, -2B, and -3 are characteristic of system y+. In contrast, CAT-2A exhibits a 10-fold lower substrate affinity and is largely independent of substrate at the trans-side of the membrane. CAT-2A and -2B demonstrate such divergent transport properties, even though their amino acid sequences differ only in a stretch of 42 amino acids. Here, we identify two amino acid residues within this 42-amino acid domain of the human CAT-2A protein that are responsible for the apparent low affinity of both the extracellular and intracellular substrate-binding sites. These residues are located in the fourth intracellular loop, suggesting that they are not part of the translocation pathway. Rather, they may be responsible for the low affinity conformation of the substrate-binding sites. The sensitivity to trans-stimulation is not determined by the same amino acid residues as the substrate affinity and must involve a more complex interaction between individual amino acid residues. In addition to the 42-amino acid domain, the adjacent transmembrane domain X seems to be involved in this function. The cationic amino acid transporter (CAT) 1The abbreviations used are: CAT, cationic amino acid transporter (prefixes m and h represent mouse and human, respectively); TM, transmembrane domain; GFP, green fluorescent protein; EGFP, enhanced green fluorescent protein; GST, glutathione S-transferase; PBS, phosphate-buffered saline.1The abbreviations used are: CAT, cationic amino acid transporter (prefixes m and h represent mouse and human, respectively); TM, transmembrane domain; GFP, green fluorescent protein; EGFP, enhanced green fluorescent protein; GST, glutathione S-transferase; PBS, phosphate-buffered saline. family comprises four members: CAT-1, -2A, -2B, and -3 (for review, see Refs. 1Deves R. Boyd C.A.R. Physiol. Rev. 1998; 78: 487-545Crossref PubMed Scopus (444) Google Scholar, 2Closs E.I. Gräf P. Amidon G.L. Sadee W. Membrane Transporters as Drug Targets. Kluwer Academic/Plenum Publishers, New York1999: 229-249Google Scholar, 3Closs E.I. Mann G.E. Ignarro L.J. Nitric Oxide: Biology and Pathobiology. Academic Press, Inc., San Diego, CA2000: 225-241Google Scholar). All CAT proteins mediate Na+-independent transport of cationic amino acids. However, they differ in their substrate affinity and sensitivity to trans-stimulation and to pH changes. The transport properties of the mouse and human CAT isoforms (mCAT and hCAT, respectively) have been characterized in greatest detail, e.g. in transport studies in Xenopus laevis oocytes, either using radiolabeled amino acids or by measuring amino acid-induced membrane currents by whole cell voltage clamping. The apparent Km values for cationic amino acids reported for mouse and human CAT-1, -2B, and -3 (0.1–0.4 mm) are characteristic of system y+ (4Kim J.W. Closs E.I. Albritton L.M. Cunningham J.M. Nature. 1991; 352: 725-728Crossref PubMed Scopus (428) Google Scholar, 5Wang H. Kavanaugh M.P. North R.A. Kabat D. Nature. 1991; 352: 729-731Crossref PubMed Scopus (350) Google Scholar, 6Closs E.I. Lyons C.R. Kelly C. Cunningham J.M. J. Biol. Chem. 1993; 268: 20796-20800Abstract Full Text PDF PubMed Google Scholar, 7Kakuda D.K. Finley K.D. Dionne V.E. MacLeod C.L. Transgene. 1993; 1: 91-101Google Scholar, 8Closs E.I. Gräf P. Habermeier A. Cunningham J.M. Förstermann U. Biochemistry. 1997; 36: 6462-6468Crossref PubMed Scopus (124) Google Scholar, 9Ito K. Groudine M. J. Biol. Chem. 1997; 272: 26780-26786Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar). In contrast, CAT-2A exhibits a 10-fold lower substrate affinity and also a greater maximal velocity (10Closs E.I. Albritton L.M. Kim J.W. Cunningham J.M. J. Biol. Chem. 1993; 268: 7538-7544Abstract Full Text PDF PubMed Google Scholar, 11Kavanaugh M.P. Wang H. Zhang Z. Zhang W. Wu Y.N. Dechant E. North R.A. Kabat D. J. Biol. Chem. 1994; 269: 15445-15450Abstract Full Text PDF PubMed Google Scholar). The CAT proteins differ also in their sensitivity to trans-stimulation. The activities of CAT-1, -2B, and -3 are stimulated by physiological concentrations of substrate at the trans-side of the plasma membrane (0.1–1 mm), a characteristic also consistent with system y+. The most pronounced trans-stimulation has been observed for CAT-1. In contrast, transport mediated by CAT-2A is largely independent of the presence of substrate at the trans-side of the membrane. So far, only little information is available about the role of specific CAT protein amino acid residues in the recognition and translocation of cationic amino acids. Glu107 has been shown to be essential for the transport activity of mCAT-1 (12Wang H. Kavanaugh M.P. Kabat D. Virology. 1994; 202: 1058-1060Crossref PubMed Scopus (26) Google Scholar). Located in or adjacent to transmembrane domain (TM) III and conserved in all other known CAT isoforms, this Glu residue is likely to be part of the substrate translocation pathway. However, the amino acid residues that determine the particular transport properties of individual CAT isoforms, such as substrate affinity and sensitivity to trans-stimulation, have not been identified.As evidenced from analyses of data bases of both the human and mouse genomes, CAT-2A and -2B are products of the same gene. Two alternative forms of the sixth coding exon give rise to the two splice variants, which differ only in a stretch of 42 amino acids (6Closs E.I. Lyons C.R. Kelly C. Cunningham J.M. J. Biol. Chem. 1993; 268: 20796-20800Abstract Full Text PDF PubMed Google Scholar, 8Closs E.I. Gräf P. Habermeier A. Cunningham J.M. Förstermann U. Biochemistry. 1997; 36: 6462-6468Crossref PubMed Scopus (124) Google Scholar, 11Kavanaugh M.P. Wang H. Zhang Z. Zhang W. Wu Y.N. Dechant E. North R.A. Kabat D. J. Biol. Chem. 1994; 269: 15445-15450Abstract Full Text PDF PubMed Google Scholar). All known CAT proteins exhibit quite similar hydrophobicity plots, suggesting that their structures in the membrane are similar. They are integral membrane proteins with 12–14 putative TMs and intracellular N and C termini. According to the model with 14 TMs, the region divergent between CAT-2A and -2B is located in the fourth intracellular loop and in part of the adjacent TM IX. Interestingly, in this region, the three isoforms exhibiting similar transport properties (CAT-1, -2B, and -3) also show the highest percentage of amino acid sequence identity (3Closs E.I. Mann G.E. Ignarro L.J. Nitric Oxide: Biology and Pathobiology. Academic Press, Inc., San Diego, CA2000: 225-241Google Scholar). It is noteworthy that CAT-2A and -2B demonstrate such divergent transport properties, even though their amino acid sequences differ only in 20 residues (within the stretch of 42 amino acids). Replacement of a 80-amino acid fragment containing the corresponding 42-amino acid domain of mCAT-1 with that of mCAT-2A or -2B and vice versa lead to chimeric proteins with transport properties of the donor of that domain (including the apparent affinity for l-arginine and sensitivity to trans-stimulation) (6Closs E.I. Lyons C.R. Kelly C. Cunningham J.M. J. Biol. Chem. 1993; 268: 20796-20800Abstract Full Text PDF PubMed Google Scholar). In this study, we aimed to identify the amino acid residues in the 42-amino acid domain of hCAT-2A that are responsible for its distinct transport properties.EXPERIMENTAL PROCEDURESSite-directed Mutagenesis and Generation of Chimeric cDNAs—Site-directed mutagenesis was performed using the QuikChange mutagenesis kit (Stratagene, Heidelberg, Germany) and the oligonucleotides listed in Table I. Silent in-frame BamHI and SalI sites were introduced into the coding regions of hCAT-1 and -2A. These, sites as well as a NcoI and a KpnI site (both conserved in hCAT-1 and -2A), were used to construct chimeric cDNAs between hCAT-2A and -1. The first letters of the restriction enzymes used are included in the name of each chimera, e.g. hCAT-2A/1.BK is a chimera that contains the backbone of hCAT-2A and the BamHI/KpnI fragment of hCAT-1.Table IOligonucleotides used for site-directed mutagenesis The sequence of each oligonucleotide pair is given in the sense orientation.OligonucleotideMutationAGTCTTCTAGGATCCATGTTTCCCATBamHI site in hCAT-1CTGAAGGACTTGGTCGACCTCATGTCCATTSalI site in hCAT-1GTCTTCTGGGATCCATGTTTCCTTBamHI site in hCAT-2ACTGAAGGCGCTTGTCGACATGATGTCCATTGSalI site in hCAT-2AGATTTCTTGCCAGAGTGAATAGTAAGAGGCAGTCACInsertion of Asp381 in hCAT-2ACTATGCCATGGCCGAGGATGGCTTACTGMutation of Arg369 to Glu in hCAT-2A Open table in a new tab Enhanced Green Fluorescent Protein (EGFP) Fusion Constructs—A construct encoding EGFP fused to the C terminus of hCAT-1 (hCAT-1/EGFP-pSP64T) has been described previously (13Wolf S. Janzen A. Vékony N. Martiné U. Strand D. Closs E.I. Biochem. J. 2002; 364: 767-775Crossref PubMed Scopus (41) Google Scholar). A construct encoding a fusion protein between hCAT-2A and EGFP (hCAT-2A/EGFP-pSP64T) was obtained as described previously for hCAT-2B (13Wolf S. Janzen A. Vékony N. Martiné U. Strand D. Closs E.I. Biochem. J. 2002; 364: 767-775Crossref PubMed Scopus (41) Google Scholar).Expression of cRNAs in X. laevis Oocytes—All cDNAs were inserted into the BglII site of pSP64T (14Melton D.A. Krieg P.A. Rebagliati M.R. Maniati R. Zinn K. Green M.R. Nucleic Acids Res. 1984; 12: 7035-7075Crossref PubMed Scopus (4048) Google Scholar). The plasmids were linearized, and cRNA was prepared by in vitro transcription from the SP6 promoter (mMessage mMachine in vitro transcription kit, Ambion, AMS Biotechnology Europe, Cambridgeshire, UK). 36 ng of cRNA (in 36 nl of H2O) were injected into each X. laevis oocyte (Dumont stages V and VI). Oocytes injected with 36 nl of water were used as controls.Transport Studies in X. laevis Oocytes—l-Arginine uptake was determined 2 days after injection of cRNA as previously described (8Closs E.I. Gräf P. Habermeier A. Cunningham J.M. Förstermann U. Biochemistry. 1997; 36: 6462-6468Crossref PubMed Scopus (124) Google Scholar). Briefly, oocytes were equilibrated for 2 h at 18 °C in uptake solution (100 mm NaCl, 2 mm KCl, 1 mm MgCl2, 1 mm CaCl2, 5 mm HEPES, and 5 mm Tris, pH 7.5) containing the indicated concentrations of unlabeled l-amino acids. The oocytes were then transferred to the same solution supplemented with l-[3H]arginine (5–10 μCi/ml; ICN, Eschwege, Germany). After a 15-min incubation (or 1–6-h incubation for steady-state experiments) at 20 °C, the oocytes were washed four times with ice-cold uptake solution and solubilized individually in 2% SDS. The incorporated radioactivity was determined in a liquid scintillation counter. For trans-stimulation experiments, cRNA-injected oocytes were each injected a second time with 3.6 nmol of l-[3H]arginine (3.6 nCi) in 36 nl of water. The oocytes were then immediately transferred into uptake solution containing either 1 mm l-arginine or no cationic amino acids. After a 30-min incubation at 20 °C, the l-[3H]arginine that had accumulated in the uptake solution was determined by liquid scintillation counting.Generation of an Immune Plasma Specific for hCAT-2—A cDNA fragment coding for the 57 C-terminal amino acids of hCAT-2 was cloned in-frame into pATH-1,3′ to the coding region of tryptophan E (15Koerner T.J. Hill J.E. Myers A.M. Tzagoloff A. Methods Enzymol. 1991; 194: 477-490Crossref PubMed Scopus (274) Google Scholar). The resulting plasmid was transfected into Escherichia coli XL-1 Blue (Stratagene). Expression of the tryptophan E/hCAT-2 fusion protein was induced by growth in tryptophan-free M9 medium containing 10 μg/ml 3-β-indoleacrylic acid (Sigma, Deisenhofen, Germany) for 4 h at 37 °C. Bacteria were lysed by sonication in buffer composed of 100 mm KCl, 25 mm HEPES, pH 7.6, 0.1 mm EDTA, 12 mm MgCl2, 10% glycerol, and 0.1% Nonidet P-40 containing 1 mm dithiothreitol, 2 μg/ml aprotinin, 1 μg/ml leupeptin, 1 μg/ml pepstatin, 0.1 mm phenylmethylsulfonyl fluoride, 0.2 mm NaHSO3, and 0.5 mg/ml lysozyme. The lysates were spun at 26,000 × g, and the supernatants (∼15 mg of protein) were separated by 12.5% SDS-PAGE. After Coomassie Blue staining, the gel portion containing the fusion protein was cut out and homogenized in 1 ml of H2O/g of gel using a 26-gauge needle. 6-week-old rabbits were immunized with 300 μl of homogenate (250 μg of fusion protein) and an equal volume of complete Freund's adjuvant (Invitrogen, Eggenstein, Germany). The immune plasma was collected after boosting the rabbits three times (every 3 weeks) with 250 μg of fusion protein (in 300 μl) and 1 volume of incomplete Freund's adjuvant.Affinity Purification of Immune Plasma for hCAT-2—A cDNA fragment coding for the 57 C-terminal amino acids of hCAT-2 was cloned in-frame into pGEX-3X 3′ to the coding region of glutathione S-transferase (GST) (16Smith D.B. Johnson K.S. Gene (Amst.). 1988; 67: 31-40Crossref PubMed Scopus (5035) Google Scholar). The resulting plasmid was transfected into E. coli XL-1 Blue. Expression of the GST/hCAT-2 fusion protein was induced by growth in LB medium containing 0.1 mm isopropyl-β-d-thiogalactopyranoside (Roche Applied Science, Mannheim, Germany) for 5 h at 37 °C. Bacteria were lysed on ice by sonication in phosphate-buffered saline (PBS; 2.7 mm KCl, 140 mm NaCl, 1.8 mm KH2PO4, and 10 mm Na2HPO4). After addition of 0.1% Triton X-100, the lysates were spun at 7500 × g, and the fusion protein in the supernatants was purified using S-glutathione-Sepharose (17Simons P.C. Vander D.L. Methods Enzymol. 1981; 77: 235-237Crossref PubMed Scopus (117) Google Scholar). Immune plasma (2 ml) was heat-inactivated for 30 min at 56 °C, diluted 1:1 with PBS, and applied to a Poly-Prep chromatography column (Bio-Rad, Munich, Germany) containing 8 mg of GST/hCAT-2 fusion protein coupled to 4 ml of Affi-Gel 10 (Bio-Rad) at 4 °C for 15 h. After washing the column with 12 ml of PBS, antibodies were eluted with 0.1 m glycine HCl, pH 2.5, and 1 m NaCl; neutralized with 0.1 volume of 1 m Tris-HCl, pH 8; and dialyzed against PBS at 4 °C for 15 h.Western Blots—Oocytes were lysed by vortexing in radioimmune precipitation assay buffer (1% deoxycholate, 1% Triton X-100, 0.1% SDS, 150 mm NaCl, 2 mm MgCl2, 10 mm Tris-HCl, pH 7.2, and 1 mm phenylmethylsulfonyl fluoride) 2 days after injection with wild-type, mutant, or chimeric hCAT-2A cRNA or with water (five oocytes/25 μl of buffer). Lysates were then treated with N-glycosidase F (4 units/25 μl; Roche Applied Science) for 1 h at 37 °C. Radioimmune precipitation assay buffer (75 μl) containing 8 m urea was then added. The samples were spun at 14,000 × g. After determining the protein concentration of the supernatant (using the Bradford reaction, Bio-Rad), an equal volume of sample buffer (125 mm Tris-HCl, pH 6.8, 20% glycerol, 5% SDS, 2% 2-mercaptoethanol, 0.001% bromphenol blue, and 1 mm phenylmethylsulfonyl fluoride) was added.Lysates (20 μg of protein) were separated by 10% SDS-PAGE and then blotted onto nitrocellulose membranes (Protran 83, Schleicher & Schüll, Dassel, Germany). Staining for hCAT-2 proteins was achieved by sequential incubations in Blotto (50 mm Tris-HCl, pH 8, 2 mm CaCl2, 0.01% antifoam A (Sigma), 0.05% Tween 20, and 5% nonfat dry milk) containing 10% goat serum for 2 h at room temperature; a 1:100 dilution of anti-hCAT-2 polyclonal antibody in PBS containing 1% bovine serum albumin and 0.1% Tween 20 overnight at 4 °C; three times in Blotto for 15 min at room temperature; a 1:10,000 dilution of peroxidase-conjugated goat anti-rabbit IgG secondary antibody (Calbiochem, Bad Soden, Germany) in Blotto for1hat room temperature; three times in 10 mm Tris-HCl, pH 8, 150 mm NaCl, and 0.05% Tween 20; once in 10 mm Tris-HCl, pH 8, and 150 mm NaCl; and finally in chemiluminescence reagent (Renaissance, PerkinElmer Life Sciences, Bad Homburg, Germany) for 1 min. The membranes were then immediately exposed to x-ray films (Agfa, Leverkusen, Germany). For each experiment, two to four different exposure times were used for quantification. Rabbit anti-GFP peptide polyclonal antibodies (Clontech, Heidelberg, Germany) were used as primary antibodies (1:500) for the detection of EGFP fusion proteins. For standardization, membranes were stripped with 62.5 mm Tris-HCl, pH 6.8, 2% SDS, and 100 mm β-mercaptoethanol for 30 min at 50 °C and stained with anti-β-tubulin monoclonal antibody (1:1000; Sigma) and peroxidase-conjugated goat anti-mouse IgG secondary antibody (1:3000; Sigma).Biotinylation of Cell Surface Proteins—Oocytes were rinsed with ice-cold modified PBS (1.76 mm KH2PO4, 2 mm KCl, 10.1 mm Na2HPO4, and 0.1 m NaCl,) containing 0.1 mm CaCl2 and 1 mm MgCl2 and incubated in this same solution supplemented with 1 mg/ml sulfosuccinimidobiotin (EZ-Link™ sulfosuccinimidyl-2-(biotinamido)ethyl 1,3′-dithiopropionate, Pierce) for 30 min at room temperature. Oocytes were then rinsed four times with modified calcium/magnesium/PBS containing 50 mm NH4Cl and incubated in this buffer for 10 min at 4 °C to quench the unreacted biotin. Oocytes were lysed in radioimmune precipitation assay buffer containing protease inhibitors. After removal of the cell debris by centrifugation, biotinylated proteins were batch-extracted using avidin-coated Sepharose beads (immobilized NeutrAvidin™, Pierce). Biotinylated proteins were released from the beads by incubation in sample buffer containing 8 m urea for 10 min at 37 °C and analyzed by Western blotting.RESULTSApparent Substrate Affinity—To elucidate which amino acid residues are responsible for the distinct transport properties of hCAT-2A, we first replaced peptide fragments of different lengths in hCAT-2A with the corresponding fragments in hCAT-1 (Fig. 1). To this end, we introduced a BamHI and a SalI recognition site in the hCAT-1 and -2A cDNAs without changing the reading frame. We used these sites as well as the conserved NcoI and KpnI sites to exchange fragments of 80 (BamHI/KpnI), 57 (BamHI/SalI), and 46 (NcoI/SalI) amino acids, resulting in the chimeras hCAT-2A/1.BK, hCAT-2A/1.BS, and hCAT-2A/1.NS, respectively. The 80- and 57-amino acid fragments contain the entire region that is divergent between hCAT-2A and -2B, whereas the 46-amino acid fragment lacks the first nine amino acids of the divergent region. The apparent substrate affinity of the chimeras was determined by expression in X. laevis oocytes and by measurement of the uptake of 0.01, 0.03, 0.1, 0.3, 1, 3, and 10 mm l-[3H]arginine over 15 min. The apparent half-saturating l-arginine concentrations (Km) were determined by fitting the data according to the Eadie-Hofstee equation after subtraction of the values obtained with water-injected oocytes. All three chimeras exhibited Km values significantly smaller than the Km of hCAT-2A and statistically not different from the Km of hCAT-1 (Fig. 2).Fig. 2Apparent Km values for l-arginine of wild-type, chimeric, and mutant hCAT-2A proteins in comparison with those of hCAT-1.X. laevis oocytes were injected with 36 ng of cRNA (in 36 nl of water) encoding the respective wild-type, chimeric, or mutant hCAT-2A or with 36 nl of water alone. 2 days later, uptake of 0.01, 0.03, 0.1, 0.3, 1, 3, and 10 mm l-[3H]arginine was measured over 15 min at 20 °C. The apparent Km values were determined using the Eadie-Hofstee equation (after subtraction of the values obtained with water-injected oocytes). Bars represent means ± S.E. (n = 4–8), with four to six replicates each. Statistical analysis was performed using analysis of variance with Bonferroni's post-hoc test. ***, **, and *, p < 0.001, 0.01, and 0.05, respectively; ns (not significant), p > 0.05.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Comparison of the CAT proteins in the exchanged region revealed two striking differences in the amino acid sequences of hCAT-2A and the high affinity CAT isoforms: an arginine residue (carrying a positive charge) at position 369 of hCAT-2A, where the high affinity isoforms have a negatively charged glutamic acid; and a missing amino acid residue at position 381 of hCAT-2A, where the high affinity isoforms contain an asparagine or histidine residue (Fig. 1B). Therefore, Arg369 in hCAT-2A was mutated to Glu, and Asn was inserted in position 381 (hCAT-2A(R369E/N381i)). Transport studies in X. laevis oocytes revealed Km values intermediate between those of hCAT-2A and -1 for the hCAT-2A proteins carrying either single mutation (Fig. 2). The hCAT-2A double mutant exhibited Km values indistinguishable from those of hCAT-1.In a previous study, we established that, also at the inner side of the membrane, hCAT-2A exhibits a significantly lower apparent substrate affinity than hCAT-1 (8Closs E.I. Gräf P. Habermeier A. Cunningham J.M. Förstermann U. Biochemistry. 1997; 36: 6462-6468Crossref PubMed Scopus (124) Google Scholar). At saturating extracellular substrate concentrations (Vmax for influx), an apparent steady state is reached when the intracellular substrate-binding sites are also saturated (Vmax for efflux). Cells will therefore accumulate more substrate when expressing a transporter with low substrate affinity at the cytoplasmic side compared with a transporter with high substrate affinity at the cytoplasmic side. The apparent steady-state accumulation under saturating extracellular substrate concentrations thus represents an indirect measurement of the substrate affinity at the intracellular side. To this end, we measured the accumulation of tritiated l-arginine over 6 h in oocytes incubated in isotonic salt solution containing 10 mm l-[3H]arginine (Fig. 3). As observed previously (8Closs E.I. Gräf P. Habermeier A. Cunningham J.M. Förstermann U. Biochemistry. 1997; 36: 6462-6468Crossref PubMed Scopus (124) Google Scholar), hCAT-2A-expressing oocytes accumulated considerably more l-arginine over the 6-h incubation time than hCAT-1-expressing oocytes (7.2 ± 0.27 versus 1.7 ± 0.13 nmol/oocyte, n = 45). Oocytes expressing the double mutant hCAT-2A(R369E/N381i) accumulated also significantly less l-arginine (3.8 ± 0.23 nmol/oocyte, n = 45) than oocytes expressing hCAT-2A.Fig. 3Accumulation of l-arginine in oocytes exposed to 10 mm extracellular l-arginine. Transporters were expressed in Xenopus oocytes as described in the legend to Fig. 2. 2 days after injection of cRNA, the accumulation of l-[3H]arginine was measured over 1–6 h in oocytes incubated in uptake solution containing 10 mm l-[3H]arginine. ▪, hCAT-1; □, hCAT-2A; •, hCAT-2A(R369E/N381i). Values obtained with water-injected oocytes were subtracted. Data points represent means ± S.E. (n = 25–40).View Large Image Figure ViewerDownload Hi-res image Download (PPT)Maximal Transport Activity—We routinely observe a higher maximal transport activity in oocytes expressing hCAT-2A compared with those expressing hCAT-1 (5.1 ± 0.88 versus 1.8 ± 0.19 nmol/oocyte/h; p < 0.001). However, it had not been elucidated if this difference between the two proteins is due to differences in the specific activity or rather in the expression level in the plasma membrane. To address this point, we fused EGFP to the C terminus of hCAT-1 and -2A and determined the transport activities and expression levels of the two proteins in X. laevis oocytes. Both proteins were predominantly localized to the plasma membrane (Fig. 4, A and B). However, compared with hCAT-1/EGFP, hCAT-2A/EGFP demonstrated a 3-fold higher maximal transport activity (determined at 10 mm l-arginine) in relation to its total and cell surface protein expression (determined in Western blot analyses using anti-GFP antibody) (Fig. 4C). These data indicate that hCAT-2A has indeed a higher maximal transport activity compared with hCAT-1.Fig. 4Comparison of the maximal transport activities of hCAT-1/EGFP and hCAT-2A/EGFP.X. laevis oocytes were injected with cRNA encoding hCAT-1 or hCAT-2A with EGFP fused to the C terminus (or with water alone) and analyzed 2 days later. A and B, shown are fluorescent micrographs of cryostat sections (12 μm) from oocytes expressing hCAT-1/EGFP and hCAT-2A/EGFP, respectively. C, the uptake of 10 mm l-[3H]arginine over 15 min at 20 °C was measured, and the values obtained with water-injected oocytes were subtracted. To determine the cell surface expression of the transporters, oocytes were exposed to biotin prior to lysis, and the biotinylated proteins were isolated with streptavidin. The total and cell surface protein expression of each transporter were quantified by Western blotting using a commercial anti-GFP-antibody. The values for l-arginine transport were then divided by the respective protein values and expressed as the percentage of the values obtained for hCAT-1 (100%). Bars represent means ± S.E. (n = 3–5).View Large Image Figure ViewerDownload Hi-res image Download (PPT)We then wondered whether the same protein domain that determines the apparent substrate affinity of hCAT-2A also determines its maximal transport activity. To quantify the protein expression levels of wild-type and mutant hCAT-2A proteins, we generated immune plasma against the C terminus of hCAT-2. This plasma recognized a protein band of ∼70 kDa in N-glycosidase-treated lysates from X. laevis oocytes expressing wild-type or any mutant hCAT-2A, but not in lysates from control oocytes (Fig. 5A). (The calculated molecular mass of hCAT-2A is 72 kDa.) When the lysates were not treated with N-glycosidase, the antibody stained a broad protein band of 100–150 kDa (Fig. 5B). The maximal transport activities of wild-type and mutant hCAT-2A proteins were calculated from the respective Eadie-Hofstee plots described above. Only oocytes expressing the single mutant hCAT-2A(N381i) and the double mutant hCAT-2A(R369E/N381i) had significantly reduced transport activities compared with oocytes expressing hCAT-2A (Fig. 6A). The specific activity of each transporter was then calculated by dividing the Vmax values by the respective protein values obtained by densitometry of several Western blots (Fig. 6, B and C). The chimeras hCAT-2/1.BS and hCAT-2/1.NS showed specific activities indistinguishable from that of hCAT-2A. This indicates that the hCAT-1 fragment introduced into the hCAT-2 backbone does not determine the specific activity. Also, the specific activity of the single mutant hCAT-2A(R369E) was equal to that of hCAT-2A. The chimera hCAT-2/1.BK and the single mutant hCAT-2A(N381i) had slightly reduced specific activities. A larger reduction was observed for the double mutant.Fig. 5Protein expression of wild-type, chimeric, and mutant hCAT-2A proteins. Western blotting was performed with lysates from oocytes prepared 2 days after injection of cRNA from one of the indicated transporters or of water alone. Protein (20 μg/lane) was separated by 10% SDS-PAGE and blotted onto a membrane, and the membrane was incubated with affinity-purified anti-hCAT-1 antibody (A and B, upper panels). Lysates in A were treated with N-glycosidase F. Black and white arrows indicate the glycosylated and deglycosylated hCAT-2A proteins, respectively. The blots were then stripped and incubated with anti-β-tubulin monoclonal antibody for standardization (A and B, lower panels).View Large Image Figure ViewerDownload Hi-res image Download (PPT)Fig. 6Assessment of the specific transport activities of wild-type, chimeric, and mutant hCAT-2A proteins.A, the maximal transport activity of each transporter was calculated from the experiments described in the legend to Fig. 2. Bars represent means ± S.E. (n = 4–8), with four to six replicates each. B, protein expression was quantified by densitometry of several Western blots. For standardization, values obtained for each transporter were divided by the respective values for tubulin. The values obtained for h" @default.
• W2044079355 created "2016-06-24" @default.
• W2044079355 creator A5014783499 @default.
• W2044079355 creator A5032507031 @default.
• W2044079355 creator A5044170423 @default.
• W2044079355 creator A5068677676 @default.
• W2044079355 creator A5087850063 @default.
• W2044079355 date "2003-05-01" @default.
• W2044079355 modified "2023-10-12" @default.
• W2044079355 title "Two Amino Acid Residues Determine the Low Substrate Affinity of Human Cationic Amino Acid Transporter-2A" @default.
• W2044079355 cites W1019447032 @default.
• W2044079355 cites W1575097947 @default.
• W2044079355 cites W1589668237 @default.
• W2044079355 cites W1607148144 @default.
• W2044079355 cites W1927805387 @default.
• W2044079355 cites W1956322496 @default.
• W2044079355 cites W1964682134 @default.
• W2044079355 cites W1977638337 @default.
• W2044079355 cites W2010852858 @default.
• W2044079355 cites W2018885135 @default.
• W2044079355 cites W2020972755 @default.
• W2044079355 cites W2046123039 @default.
• W2044079355 cites W2068446924 @default.
• W2044079355 cites W2078119356 @default.
• W2044079355 cites W2120684043 @default.
• W2044079355 doi "https://doi.org/10.1074/jbc.m210254200" @default.
• W2044079355 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12637504" @default.
• W2044079355 hasPublicationYear "2003" @default.
• W2044079355 type Work @default.
• W2044079355 sameAs 2044079355 @default.
• W2044079355 citedByCount "29" @default.
• W2044079355 countsByYear W20440793552012 @default.
• W2044079355 countsByYear W20440793552013 @default.
• W2044079355 countsByYear W20440793552015 @default.
• W2044079355 countsByYear W20440793552017 @default.
• W2044079355 countsByYear W20440793552018 @default.
• W2044079355 countsByYear W20440793552020 @default.
• W2044079355 crossrefType "journal-article" @default.
• W2044079355 hasAuthorship W2044079355A5014783499 @default.
• W2044079355 hasAuthorship W2044079355A5032507031 @default.
• W2044079355 hasAuthorship W2044079355A5044170423 @default.
• W2044079355 hasAuthorship W2044079355A5068677676 @default.
• W2044079355 hasAuthorship W2044079355A5087850063 @default.
• W2044079355 hasBestOaLocation W20440793551 @default.
• W2044079355 hasConcept C104317684 @default.
• W2044079355 hasConcept C149011108 @default.
• W2044079355 hasConcept C167625842 @default.
• W2044079355 hasConcept C178790620 @default.
• W2044079355 hasConcept C181199279 @default.
• W2044079355 hasConcept C183882617 @default.
• W2044079355 hasConcept C185592680 @default.
• W2044079355 hasConcept C18903297 @default.
• W2044079355 hasConcept C2777289219 @default.
• W2044079355 hasConcept C2781313199 @default.
• W2044079355 hasConcept C2994376932 @default.
• W2044079355 hasConcept C2994592520 @default.
• W2044079355 hasConcept C515207424 @default.
• W2044079355 hasConcept C55493867 @default.
• W2044079355 hasConcept C71240020 @default.
• W2044079355 hasConcept C86803240 @default.
• W2044079355 hasConceptScore W2044079355C104317684 @default.
• W2044079355 hasConceptScore W2044079355C149011108 @default.
• W2044079355 hasConceptScore W2044079355C167625842 @default.
• W2044079355 hasConceptScore W2044079355C178790620 @default.
• W2044079355 hasConceptScore W2044079355C181199279 @default.
• W2044079355 hasConceptScore W2044079355C183882617 @default.
• W2044079355 hasConceptScore W2044079355C185592680 @default.
• W2044079355 hasConceptScore W2044079355C18903297 @default.
• W2044079355 hasConceptScore W2044079355C2777289219 @default.
• W2044079355 hasConceptScore W2044079355C2781313199 @default.
• W2044079355 hasConceptScore W2044079355C2994376932 @default.
• W2044079355 hasConceptScore W2044079355C2994592520 @default.
• W2044079355 hasConceptScore W2044079355C515207424 @default.
• W2044079355 hasConceptScore W2044079355C55493867 @default.
• W2044079355 hasConceptScore W2044079355C71240020 @default.
• W2044079355 hasConceptScore W2044079355C86803240 @default.
• W2044079355 hasIssue "21" @default.
• W2044079355 hasLocation W20440793551 @default.
• W2044079355 hasOpenAccess W2044079355 @default.
• W2044079355 hasPrimaryLocation W20440793551 @default.
• W2044079355 hasRelatedWork W188155302 @default.
• W2044079355 hasRelatedWork W1974467523 @default.
• W2044079355 hasRelatedWork W1978511976 @default.
• W2044079355 hasRelatedWork W2137375917 @default.
• W2044079355 hasRelatedWork W2170754052 @default.
• W2044079355 hasRelatedWork W2735772020 @default.
• W2044079355 hasRelatedWork W3046468024 @default.
• W2044079355 hasRelatedWork W3115979224 @default.
• W2044079355 hasRelatedWork W3140101239 @default.
• W2044079355 hasRelatedWork W4313503451 @default.
• W2044079355 hasVolume "278" @default.
• W2044079355 isParatext "false" @default.
• W2044079355 isRetracted "false" @default.
• W2044079355 magId "2044079355" @default.
• W2044079355 workType "article" @default.