FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2044965942> ?p ?o ?g. }

• W2044965942 endingPage "15644" @default.
• W2044965942 startingPage "15632" @default.
• W2044965942 abstract "We previously reported that the first epidermal growth factor-like (EGF1) domain in factor X (FX) or factor IX (FIX) plays an important role in the factor VIIa/tissue factor (FVIIa/TF)-induced coagulation. To assess the role of γ-carboxyglutamic acid (Gla) domains of FX and FIX in FVIIa/TF induced coagulation, we studied four new and two previously described replacement mutants: FXPCGla and FIXPCGla (Gla domain replaced with that of protein C), FXPCEGF1 and FIXPCEGF1 (EGF1 domain replaced with that of protein C), as well as FXPCGla/EGF1 and FIXPCGla/EGF1 (both Gla and EGF1 domains replaced with those of protein C). FVIIa/TF activation of each FX mutant and the corresponding reciprocal activation of FVII/TF by each FXa mutant were impaired. In contrast, FVIIa/TF activation of FIXPCGla was minimally affected, and the reciprocal activation of FVII/TF by FIXaPCGla was normal; however, both reactions were impaired for the FIXPCEGF1 and FIXPCGla/EGF1 mutants. Predictably, FXIa activation of FIXPCEGF1 was normal, whereas it was impaired for the FIXPCGla and FIXPCGla/EGF1 mutants. Molecular models reveal that alternate interactions exist for the Gla domain of protein C such that it is comparable with FIX but not FX in its binding to FVIIa/TF. Further, additional interactions exist for the EGF1 domain of FX, which are not possible for FIX. Importantly, a seven-residue insertion in the EGF1 domain of protein C prevents its interaction with FVIIa/TF. Cumulatively, our data provide a molecular framework demonstrating that the Gla and EGF1 domains of FX interact more strongly with FVIIa/TF than the corresponding domains in FIX. We previously reported that the first epidermal growth factor-like (EGF1) domain in factor X (FX) or factor IX (FIX) plays an important role in the factor VIIa/tissue factor (FVIIa/TF)-induced coagulation. To assess the role of γ-carboxyglutamic acid (Gla) domains of FX and FIX in FVIIa/TF induced coagulation, we studied four new and two previously described replacement mutants: FXPCGla and FIXPCGla (Gla domain replaced with that of protein C), FXPCEGF1 and FIXPCEGF1 (EGF1 domain replaced with that of protein C), as well as FXPCGla/EGF1 and FIXPCGla/EGF1 (both Gla and EGF1 domains replaced with those of protein C). FVIIa/TF activation of each FX mutant and the corresponding reciprocal activation of FVII/TF by each FXa mutant were impaired. In contrast, FVIIa/TF activation of FIXPCGla was minimally affected, and the reciprocal activation of FVII/TF by FIXaPCGla was normal; however, both reactions were impaired for the FIXPCEGF1 and FIXPCGla/EGF1 mutants. Predictably, FXIa activation of FIXPCEGF1 was normal, whereas it was impaired for the FIXPCGla and FIXPCGla/EGF1 mutants. Molecular models reveal that alternate interactions exist for the Gla domain of protein C such that it is comparable with FIX but not FX in its binding to FVIIa/TF. Further, additional interactions exist for the EGF1 domain of FX, which are not possible for FIX. Importantly, a seven-residue insertion in the EGF1 domain of protein C prevents its interaction with FVIIa/TF. Cumulatively, our data provide a molecular framework demonstrating that the Gla and EGF1 domains of FX interact more strongly with FVIIa/TF than the corresponding domains in FIX. Factor X (FX) 2The abbreviations used are: FVII, FIX, FX, and FXI, factors VII, IX, X, and XI, respectively; BSA, bovine serum albumin; PEG, polyethylene glycol 8000; EGF, epidermal growth factor; Gla, γ-carboxyglutamic acid; WT, wild type; FXWT and FIXWT, wild-type FX and FIX, respectively; FXPCGla and FIXPCGla, FX and FIX, respectively, wherein the Gla domain has been replaced with that of protein C; FXPCEGF1 and FIXPCEGF1, FX and FIX, respectively, wherein the EGF1 domain has been replaced with that of protein C; FIXPCGla/EGF1 and FIXPCGla/EGF1, FX and FIX, respectively, wherein both the Gla and EGF1 domains have been replaced with the corresponding domains from protein C; TF, tissue factor; sTF, soluble TF (residues 1–219); S-2222, benzoyl-Ile-Glu-Gly-Arg-p-nitroanilide; RVV, FX-activating enzyme from Russell's viper venom; PL, phospholipid; mAb, monoclonal antibody; dEGR-Xa, dansyl-Glu-Gly-Arg-Xa; dEGR-IXa, dansyl-Glu-Gly-Arg-IXa; RU, response units. and factor IX (FIX) are vitamin K-dependent glycoproteins that play key roles in blood coagulation (1Leytus S.P. Foster D.C. Kurachi K. Davie E.W. Biochemistry. 1986; 25: 5098-5102Crossref PubMed Scopus (182) Google Scholar, 2Yoshitake S. Schach B.G. Foster D.C. Davie E.W. Kurachi K. Biochemistry. 1984; 24: 3736-3750Crossref Scopus (511) Google Scholar). They are synthesized in the liver as zymogens of the serine proteases FXa and FIXa, respectively. FX of Mr ∼ 59,000 circulates in plasma as a two-chain molecule with light and heavy chains of Mr ∼ 16,000 and ∼42,000 held together by a single disulfide bond, whereas FIX consists of a single chain polypeptide of Mr ∼ 57,000 (3Di Scipio R.G. Hermodson M.A. Yates S.G. Davie E.W. Biochemistry. 1977; 16: 698-706Crossref PubMed Scopus (415) Google Scholar). Both proteins are synthesized with an N-terminal γ-carboxyglutamic acid (Gla) domain followed by two epidermal growth factor-like domains (EGF1 and EGF2) and a C-terminal serine protease domain. This domain structure is similar to the single chain factor VII (FVII) and the two-chain anticoagulant protein C (1Leytus S.P. Foster D.C. Kurachi K. Davie E.W. Biochemistry. 1986; 25: 5098-5102Crossref PubMed Scopus (182) Google Scholar). In FX and protein C, the Gla and the two EGF domains make up the light chain, whereas the serine protease domain makes up the heavy chain of the molecule (1Leytus S.P. Foster D.C. Kurachi K. Davie E.W. Biochemistry. 1986; 25: 5098-5102Crossref PubMed Scopus (182) Google Scholar). FX is activated by cleavage of a single peptide bond (Arg194-Ile195), releasing a 52-residue activation peptide (4Di Scipio R.G. Hermodson M.A. Davie E.W. Biochemistry. 1977; 16: 5253-5260Crossref PubMed Scopus (115) Google Scholar). The resulting protease known as FXaα can undergo additional autocleavage at the C terminus to form a second FXa species referred to as FXaβ. On the other hand, FIX activation proceeds in a two-step process involving cleavage of the two internal peptide bonds. First the Arg-145–Ala-146 peptide bond is cleaved to yield FIXα. This is followed by cleavage of the Arg-180–Val-181 peptide bond to yield FIXaβ (or simply FIXa) with concomitant release of a 35-residue activation peptide (5Di Scipio R.G. Kurachi K. Davie E.W. J. Clin. Invest. 1978; 61: 1528-1538Crossref PubMed Scopus (177) Google Scholar). The activations of FX and FIX by FVIIa/tissue factor (TF) complex as well as feedback activation of FVII/TF by FXa and FIXa are among the initial enzymatic reactions that lead to fibrin formation during physiologic clotting (6Østerud B. Rapaport S.I. Proc. Natl. Acad. Sci. U. S. A. 1977; 74: 5260-5264Crossref PubMed Scopus (596) Google Scholar, 7Bajaj S.P. Rapaport S.I. Brown S.F. J. Biol. Chem. 1981; 256: 253-259Abstract Full Text PDF PubMed Google Scholar, 8Masys D.R. Bajaj S.P. Rapaport S.I. Blood. 1982; 60: 1143-1150Crossref PubMed Google Scholar, 9Davie E.W. Fujikawa K. Kisiel W. Biochemistry. 1991; 30: 10363-10370Crossref PubMed Scopus (1625) Google Scholar, 10Butenas S. Mann K.G. Biochemistry. 1996; 35: 1904-1910Crossref PubMed Scopus (93) Google Scholar). Earlier studies with the EGF1 domain mutants of FX and FIX revealed that this domain in each protein serves as an important recognition motif for binding to TF (11Zhong D. Smith K.J. Birktoft J.J. Bajaj S.P. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 3574-3578Crossref PubMed Scopus (58) Google Scholar, 12Zhong D. Bajaj M.S. Schmidt A.E. Bajaj S.P. J. Biol. Chem. 2002; 277: 3622-3631Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar). Recent biochemical investigations (13Ndonwi M. Broze G.J. Bajaj S.P. J. Thromb. Haemost. 2005; 3: 112-118Crossref PubMed Scopus (13) Google Scholar) as well as modeling studies (14Chen S.W. Pellequer J. Schved J. Giansily-Blaizot M. Thromb. Haemost. 2002; 88: 74-82Crossref PubMed Scopus (30) Google Scholar, 15Norledge B.V. Petrovan R.J. Ruf W. Olson A.J. Proteins Struct. Funct. Genet. 2003; 53: 640-648Crossref PubMed Scopus (55) Google Scholar, 16Venkateswarlu D. Duke R.E. Perera L. Darden T.A. Pedersen L.G. J. Thromb. Haemost. 2003; 1: 2577-2588Crossref PubMed Scopus (19) Google Scholar, 17Carlsson K. Freskgård P. Persson E. Sralsson U. Svensson M. Eur. J. Biochem. 2003; 270: 2576-2582Crossref PubMed Scopus (19) Google Scholar) of the ternary complexes of FX and FIX with FVIIa/TF have corroborated these findings. The Gla domains of FX and FIX have also been implicated to interact with FVIIa as well as with TF (14Chen S.W. Pellequer J. Schved J. Giansily-Blaizot M. Thromb. Haemost. 2002; 88: 74-82Crossref PubMed Scopus (30) Google Scholar, 15Norledge B.V. Petrovan R.J. Ruf W. Olson A.J. Proteins Struct. Funct. Genet. 2003; 53: 640-648Crossref PubMed Scopus (55) Google Scholar, 16Venkateswarlu D. Duke R.E. Perera L. Darden T.A. Pedersen L.G. J. Thromb. Haemost. 2003; 1: 2577-2588Crossref PubMed Scopus (19) Google Scholar, 17Carlsson K. Freskgård P. Persson E. Sralsson U. Svensson M. Eur. J. Biochem. 2003; 270: 2576-2582Crossref PubMed Scopus (19) Google Scholar, 18Ruf W. Shobe J. Rao S.M. Dickinson C.D. Olson A. Edgington T.S. Biochemistry. 1999; 38: 1957-1966Crossref PubMed Scopus (49) Google Scholar, 19Kirchhofer K. Lipari M.T. Moran P. Eigenbrot C. Kelley R.F. Biochemistry. 2000; 39: 7380-7387Crossref PubMed Scopus (68) Google Scholar). FVII has also been proposed to interact with TF using similar regions as FVIIa, and it has been proposed that the FXa uses the same regions in TF as FX to activate FVII/TF (20Kelley R.F. Yang J. Eigenbrot C. Moran P. Peek M. Lipari M.T. Kirchhofer D. Biochemistry. 2004; 43: 1223-1229Crossref PubMed Scopus (19) Google Scholar, 21Kirchhofer K. Eigenbrot C. Lipari M.T. Moran P. Peek M. Kelley R.F. Biochemistry. 2001; 40: 675-682Crossref PubMed Scopus (50) Google Scholar). On the other hand, it has been reported that replacing the Gla or the EGF1 domain of FX with the corresponding domain from FIX results in diminished interactions of the chimeric proteins with FVIIa/TF (22Thiec F. Cherel G. Christophe O.D. J. Biol. Chem. 2003; 278: 10393-10399Abstract Full Text Full Text PDF PubMed Scopus (22) Google Scholar). In light of the earlier studies (11Zhong D. Smith K.J. Birktoft J.J. Bajaj S.P. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 3574-3578Crossref PubMed Scopus (58) Google Scholar, 12Zhong D. Bajaj M.S. Schmidt A.E. Bajaj S.P. J. Biol. Chem. 2002; 277: 3622-3631Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar, 13Ndonwi M. Broze G.J. Bajaj S.P. J. Thromb. Haemost. 2005; 3: 112-118Crossref PubMed Scopus (13) Google Scholar, 14Chen S.W. Pellequer J. Schved J. Giansily-Blaizot M. Thromb. Haemost. 2002; 88: 74-82Crossref PubMed Scopus (30) Google Scholar, 15Norledge B.V. Petrovan R.J. Ruf W. Olson A.J. Proteins Struct. Funct. Genet. 2003; 53: 640-648Crossref PubMed Scopus (55) Google Scholar, 16Venkateswarlu D. Duke R.E. Perera L. Darden T.A. Pedersen L.G. J. Thromb. Haemost. 2003; 1: 2577-2588Crossref PubMed Scopus (19) Google Scholar, 17Carlsson K. Freskgård P. Persson E. Sralsson U. Svensson M. Eur. J. Biochem. 2003; 270: 2576-2582Crossref PubMed Scopus (19) Google Scholar, 18Ruf W. Shobe J. Rao S.M. Dickinson C.D. Olson A. Edgington T.S. Biochemistry. 1999; 38: 1957-1966Crossref PubMed Scopus (49) Google Scholar, 19Kirchhofer K. Lipari M.T. Moran P. Eigenbrot C. Kelley R.F. Biochemistry. 2000; 39: 7380-7387Crossref PubMed Scopus (68) Google Scholar, 21Kirchhofer K. Eigenbrot C. Lipari M.T. Moran P. Peek M. Kelley R.F. Biochemistry. 2001; 40: 675-682Crossref PubMed Scopus (50) Google Scholar), this was an unexpected finding, especially when both FX and FIX are activated by FVIIa/TF in vivo (9Davie E.W. Fujikawa K. Kisiel W. Biochemistry. 1991; 30: 10363-10370Crossref PubMed Scopus (1625) Google Scholar). Nonetheless, these studies support a paradigm in which the Gla and EGF1 domains of FX and FIX differ in their interactions with FVIIa/TF. However, the biochemical and structural basis for these observations is not known. In this report, we employed a different strategy to investigate the differential contributions of the Gla and EGF1 domains of FX and FIX during activation by FVIIa/TF. We expressed and purified four new replacement mutants: 1) FX in which its Gla domain is replaced with that of protein C (FXPCGla); 2) FX in which both of its Gla and EGF1 domains are replaced with those of protein C (FXPCGla/EGF1); 3) FIX in which its Gla domain is replaced with that of protein C (FIXPCGla); and 4) FIX in which both of its Gla and EGF1 domains are replaced with those of protein C (FIXPCGla/EGF1). Biochemical properties of these mutants were compared with the wild-type (WT) FX and FIX as well as with FXPCEGF1 (EGF1 domain replaced with that of protein C) and FIXPCEGF1 studied previously (11Zhong D. Smith K.J. Birktoft J.J. Bajaj S.P. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 3574-3578Crossref PubMed Scopus (58) Google Scholar, 12Zhong D. Bajaj M.S. Schmidt A.E. Bajaj S.P. J. Biol. Chem. 2002; 277: 3622-3631Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar, 13Ndonwi M. Broze G.J. Bajaj S.P. J. Thromb. Haemost. 2005; 3: 112-118Crossref PubMed Scopus (13) Google Scholar). These biochemical data combined with the molecular models reveal that the Gla and EGF1 domains of FX interact more strongly with FVIIa/TF than the corresponding domains in FIX. Further, the Gla domain of protein C can interact with FVIIa/TF, comparable with the Gla domain of FIX but not with that of FX. However, a seven-residue insert in the EGF1 domain of protein C prevents its interaction with TF in the FVIIa/TF complex. Benzoyl-Ile-Glu-Gly-Arg-p-nitroanilide (S-2222) and H-d-Ile-Pro-Arg-p-nitroanilide (S-2288) were obtained from Diapharma Inc. (West Chester, OH). Polyethylene glycol 8000 (PEG), bovine serum albumin (BSA), bovine brain phosphatidylcholine, and phosphatidylserine were purchased from Sigma. FVII-depleted plasma was from George King-Biomedical, Inc. (Overland Park, KS). Neoplastine was purchased from Diagnostica Stago (Asnières, France). Phospholipid (PL) vesicles (75% phosphatidylcholine and 25% phosphatidylserine) were prepared by the method of Smith and Morrissey (23Smith S.A. Morrissey J.H. J. Thromb. Haemost. 2004; 2: 1155-1162Crossref PubMed Scopus (60) Google Scholar). Normal plasma FIX and FX, factor XIa, FX-activating enzyme from Russell's viper venom (RVV), and protein C and activated protein C were from Enzyme Research Laboratory (South Bend, IN). Soluble TF (sTF; residues 1–219 of TF lacking the transmembrane region) was a gift from Tom Girard of Pfizer Corp. (St. Louis, MO). TF containing the transmembrane region (residues 1–243) was a gift from Genentech, Inc. (South San Francisco, CA). Relipidation of TF (residues 1–243) was performed as described by Smith and Morrissey (23Smith S.A. Morrissey J.H. J. Thromb. Haemost. 2004; 2: 1155-1162Crossref PubMed Scopus (60) Google Scholar). FVII and FVIIa were prepared as previously described (12Zhong D. Bajaj M.S. Schmidt A.E. Bajaj S.P. J. Biol. Chem. 2002; 277: 3622-3631Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar). The Ca2+-dependent monoclonal antibodies (mAbs) to the Gla domain of protein C (CaC-11) and FX (CaFX-50) used for the purification of FX and FIX mutants were obtained from Dr. Walter Kisiel (University of New Mexico). SDS-PAGE was performed as described by Laemmli (24Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207159) Google Scholar). The acrylamide concentration was 12%, and the gels were stained with Coomassie Brilliant Blue dye. For disulfide reduction, samples were treated with 5% 2-mercaptoethanol. A pMon3360b expression vector for FXWT has been previously described (12Zhong D. Bajaj M.S. Schmidt A.E. Bajaj S.P. J. Biol. Chem. 2002; 277: 3622-3631Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar). The preproleader sequence of FXWT in this construct was replaced with that of prothrombin as described by Camire et al. (25Camire R.M. Larson P.J. Stafford D.W. High K.A. Biochemistry. 2000; 39: 14322-14329Crossref PubMed Scopus (60) Google Scholar). The expression and purification of FXWT and FXPCEGF1 using this modified construct have been described (12Zhong D. Bajaj M.S. Schmidt A.E. Bajaj S.P. J. Biol. Chem. 2002; 277: 3622-3631Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar). Constructs for FXPCGla and FXPCGla/EGF1 were each made by linking the products of the two PCRs, bearing protein C and FX sequences, respectively. The sequences of the primers used to make these constructs are shown in Table 1. To construct FXPCGla, the protein C prepro/Gla sequence was amplified using the primer pair A/B and the protein C cDNA in plasmid pCMV-SPORT6 (MGC-34565; ATCC, Manassas, VA) as the template. The EGF1/EGF2/protease sequence of FX was amplified using pMON-FX and the primer pair D/F. Similarly, to construct FXPCGla/EGF1, the prepro/Gla/EGF1 sequence of protein C was amplified using pCMV-SPORT6 as the template and the primer pair A/C. The EGF2/protease region of FX was amplified from pMON-FX using the primer pair E/F. Primer pair A/F was then used to link the two PCR products for each construct by the overlap extension using a combination of the methods of Ho et al. (26Ho S.N. Hunt H.D. Horton M.R. Pullen J.K. Pease L.R. Gene (Amst.). 1989; 77: 51-59Crossref PubMed Scopus (6832) Google Scholar) and Zhong and Bajaj (27Zhong D. Bajaj S.P. BioTechniques. 1993; 15: 874-878PubMed Google Scholar). The resulting chimeric DNA constructs (FXPCGla and FXPCGla/EGF1) were then digested with AflII and XhoI and ligated into the pMON3360b expression vector. Sequencing of all the DNA constructs revealed no PCR errors. Stable cell lines expressing FXPCGla or FXPCGla/EGF1 were then established as described for FXWT (12Zhong D. Bajaj M.S. Schmidt A.E. Bajaj S.P. J. Biol. Chem. 2002; 277: 3622-3631Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar). FXWT, FXPCGla, FXPCEGF1, and FXPCGla/EGF1 were purified from conditioned medium collected in the presence of 10 μgml-1 vitamin K as described earlier (12Zhong D. Bajaj M.S. Schmidt A.E. Bajaj S.P. J. Biol. Chem. 2002; 277: 3622-3631Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar). The mutants were immunopurified as described for FXWT (12Zhong D. Bajaj M.S. Schmidt A.E. Bajaj S.P. J. Biol. Chem. 2002; 277: 3622-3631Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar), except that for FXPCGla and FXPCGla/EGF1, a Ca2+-dependent monoclonal antibody to the Gla domain of protein C was used.TABLE 1Sequence of synthetic oligonucleotide primers for the construction of FXPCGla and FXPCGla/EGF1 Primers A and F contain an AflII site, and primer F contains an XhoI site. The restriction site sequences are underlined. Primer pairs A/B and A/C were used for PCR of the protein C fragments for the construction of FXPCGla and FXPCGla/EGF1, respectively, from the protein C plasmid pCMV-SPORT6. Similarly, primer pairs D/F and E/F were used for PCR of the FX fragments for the construction of FXPCGla and FXPCGla/EGF1, respectively, from plasmid pMON-FXII prepro. Primers B–E are hybrid primers containing both protein C and FX sequences. Protein C sequences are in parentheses, whereas FX sequences are in boldface type.PrimerSequenceA5′-CGGATCCTTAAGCTTCCAC (ATGTGGCAGCTCACAAGCCTCCTCC)B5′-(GGTCTCACACTGGTCGCCATC) GACGTGCTTGGACCAGAAGGCCAGC5′-(GGCTGCAGAGCTTCCGTGT) CTCCCGCTGGCAGAAGCGGCCCTCCD5′-(CCTTCTGGTCCAAGCACGTC) GATGGCGACCAGTGTGAGACCAGTCE5′-(GAGGGCCGCTTCTGCCAGCGGGAG) ACACGGAAGCTCTGCAGCCTGF5′-CGGACCCTCGAGTCACTTTAATGGAGAGGACGTTATG Open table in a new tab The generation of human embryonic kidney 293 cell lines expressing recombinant FIXWT and FIXPCEGF1 have been previously described (11Zhong D. Smith K.J. Birktoft J.J. Bajaj S.P. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 3574-3578Crossref PubMed Scopus (58) Google Scholar, 27Zhong D. Bajaj S.P. BioTechniques. 1993; 15: 874-878PubMed Google Scholar). In this system, FIXWT cDNA is cloned into the polylinker (HindIII and XbaI) site of pRc/CMV vector (Invitrogen). A construct for FIXPCEGF1 has been previously made in this vector (11Zhong D. Smith K.J. Birktoft J.J. Bajaj S.P. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 3574-3578Crossref PubMed Scopus (58) Google Scholar). As described above for FX mutants, FIXPCGla and FIXPCGla/EGF1 were each generated from the products of two PCRs. The primers for the construction of FIXPCGla and FIXPCGla/EGF1 are shown in Table 2. For FIXPCGla, the protein C prepro/Gla sequence was amplified using pCMV-SPORT6 and the primer pair A/B. The EGF1/EGF2/protease sequence of FIX was amplified using pRc/CMV-FIXWT and the primer pair D/F. Similarly, for FIXPCGla/EGF1, primer pair A/C was used to amplify the prepro/Gla/EGF1 sequence of protein C, whereas primer pair E/F was used to amplify the EGF2/protease sequence of FIX. The two PCR products for each construct were then linked by the overlap extension using primer pair A/F. The chimeric DNA constructs with either the Gla or Gla/EGF1 domains of FIX replaced with those of protein C were then digested with HindIII and XbaI and ligated into pRc/CMV expression vector. Stable cell lines expressing FIXPCGla or FIXPCGla/EGF1 were established as described for FIXWT (11Zhong D. Smith K.J. Birktoft J.J. Bajaj S.P. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 3574-3578Crossref PubMed Scopus (58) Google Scholar, 27Zhong D. Bajaj S.P. BioTechniques. 1993; 15: 874-878PubMed Google Scholar). FIXWT and FIXPCEGF1 were purified from conditioned medium collected in the presence of 10 μgml-1 vitamin K as described earlier (11Zhong D. Smith K.J. Birktoft J.J. Bajaj S.P. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 3574-3578Crossref PubMed Scopus (58) Google Scholar, 12Zhong D. Bajaj M.S. Schmidt A.E. Bajaj S.P. J. Biol. Chem. 2002; 277: 3622-3631Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar, 26Ho S.N. Hunt H.D. Horton M.R. Pullen J.K. Pease L.R. Gene (Amst.). 1989; 77: 51-59Crossref PubMed Scopus (6832) Google Scholar). FIXPCGla and FIXPCGla/EGF1 were purified as described for FIXWT (27Zhong D. Bajaj S.P. BioTechniques. 1993; 15: 874-878PubMed Google Scholar), except that a Ca2+-dependent monoclonal antibody to the Gla domain of protein C was used.TABLE 2Sequence of synthetic oligonucleotide primers for the construction of FIXPCGla and FIXPCGla/EGF1 Primer A contains a HindIII site, and primer F contains an XbaI site. The restriction site sequences are underlined. Primer pairs A/B and A/C were used for PCR of the protein C fragments from plasmid pCMV-SPORT6 for the construction of FIXPCGla and FIXPCGla/EGF1, respectively. Similarly, primer pairs D/F and E/F were used for PCR of the FIX fragments for the construction of FIXPCGla and FIXPCGla/EGF1, respectively, from pRc/CMV vector containing FIXWT cDNA. Primers B–E are hybrid primers containing both protein C and FIX sequences. Protein C sequences are in parentheses, whereas FIX sequences are in boldface type.PrimerSequenceA5′-CGGATCCTTAAGCTTCCAC (ATGTGGCAGCTCACAAGCCTCCTCC)B5′-(GGACTCACACTGATCTCCATC) GACGTGCTTGGACCAGAAGGCCAGC5′-(CATTCTTAATGTTACATGTTAC) CTCCCGCTGGCAGAAGCGGCCCD5′-(CCTTCTGGTCCAAGCACGTC) GATGGAGATCAGTGTGAGTCCAATCE5′-(GGCCGCTTCTGCCAGCGGGAG) GTAACATGTAACATTAAGAATGGCF5′-GCGGCCTCTAGATTAAGTGAGCTTTGTTTTTTCCTTAATCC Open table in a new tab Final purification of each FX and FIX protein was performed by FPLC, employing a Resource Q anion exchange column and a 0.1–1 m NaCl gradient in 50 mm Tris, pH 7.5. Two different methods were used to determine the protein concentrations. The first method employed measurement of the absorbance at 280 nm using extinction coefficients of 1.16 ml mg-1 cm-1 and 1.32 ml mg-1 cm-1 for FXWT and FIXWT, respectively (3Di Scipio R.G. Hermodson M.A. Yates S.G. Davie E.W. Biochemistry. 1977; 16: 698-706Crossref PubMed Scopus (415) Google Scholar). These values were also used for the mutant proteins. The second method employed the protein assay kit from Bio-Rad. For this method, known concentrations of plasma-derived FX or FIX were used as standards. The protein concentrations correlated between the two methods within ±5%. FXa proteases were prepared as described (28Fujikawa K. Legaz M.E. Davie E.W. Biochemistry. 1972; 11: 4892-4899Crossref PubMed Scopus (138) Google Scholar). Briefly, each FX protein (2 μm) was incubated with RVV (28 nm) for 4 h in TBS, pH 7.5 (50 mm Tris, 150 mm NaCl, pH 7.5) containing 5 mm CaCl2. FIX proteins (9 μm) were activated by incubating with FXIa (35 nm) for 12 h at room temperature. Full activation without significant degradation (<5%) was verified by SDS-PAGE under nonreducing and reducing conditions. Different concentrations of each FXa protein (0.02–2 nm) obtained by RVV activation were added to S-2222 (500 μm, final concentration) in TBS, pH 7.5, containing 0.1% BSA (TBS/BSA) in a final volume of 160 μl in 96-well plates. S-2222 hydrolysis was followed by continuous measurement of the p-nitroaniline release (Δ405/min) for 5–20 min. A standard curve for S-2222 hydrolysis for each FXa protein was generated and was used to estimate FXa formed during activation by FVIIa/TF. Three sets of conditions were used for these experiments. FVIIa and Relipidated TF—The FVIIa/relipidated TF complex was first made by mixing a 1:1 molar ratio of FVIIa with relipidated TF in TBS/BSA containing 5 mm CaCl2 (TBS/BSA/Ca2+). This preformed complex was then added to FX in the same buffer to initiate the reaction. Final concentrations were 100 nm FX, 0.5 nm FVIIa, 0.5 nm relipidated TF, and 10 μm PL. FVIIa/sTF without PL—As above, the FVIIa/sTF complex was first prepared by mixing a 1:1 molar ratio of FVIIa with sTF in TBS/BSA/Ca2+. FX was then added to initiate the reaction. Final concentrations were 4 μm FX and 0.16 μm FVIIa/sTF complex. FVIIa/PL without TF—FVIIa was first mixed with PL in TBS/BSA/Ca2+, and FX was then added to initiate the reaction. Final concentrations were 50 nm FVIIa, 50 μm PL, and 1 μm FX. For each condition outlined above, an aliquot of the reaction was removed at different times and quenched in EDTA (20 mm, final concentration). The FXa generated was measured by S-2222 hydrolysis. The reaction was performed in TBS, pH 7.5, containing 0.1% PEG and 5 mm CaCl2. In this reaction, PEG was used (instead of BSA) to allow for subsequent analysis by SDS-PAGE. The concentration of each FIX was 2 μm, and that of FVIIa/relipidated TF was 10 nm. Twenty-μl aliquots were withdrawn at different times, quenched in SDS-gel loading buffer containing 5% 2-mercaptoethanol, and analyzed by SDS-PAGE. Three different experimental conditions were used. Under each condition, FVII was first mixed with the desired reaction constituents in TBS, pH 7.5, containing 5 mm CaCl2 (TBS/Ca2+). FXa or FIXa was then added to initiate the reaction. For FVIIa and relipidated TF, the reaction mixture contained 100 nm FVII/relipidated TF and 1 nm FXa or 20 nm FIXa; for sTF and PL, the reaction mixture contained 1 μm FVII/sTF, 50 μm PL, and 5 nm FXa or 100 nm FIXa; and for PL only, the reaction mixture contained 1 μm FVII, 50 μm PL, 5 nm FXa, or 100 nm FIXa. At different times, an aliquot was removed and quenched in TBS/BSA containing 10 mm EDTA (final concentration). After a further dilution (20–1000-fold) in TBS/BSA without EDTA, the FVIIa/FVII ratio in the quenched mixture was determined by a one-stage clotting assay as described by Rao et al. (29Rao L.V. Bajaj S.P. Rapaport S.I. Blood. 1985; 65: 218-226Crossref PubMed Google Scholar) and recently modified by Ndonwi et al. (13Ndonwi M. Broze G.J. Bajaj S.P. J. Thromb. Haemost. 2005; 3: 112-118Crossref PubMed Scopus (13) Google Scholar). Briefly, 50 μl of FVII-depleted plasma was incubated with 50 μl of Neoplastine reagent for 3 min at 37 °C. Next, 25 μl of the diluted test sample and 50 μl of 35 mm CaCl2 (prewarmed to 37 °C) were added, and the clotting time was recorded. Citrated pooled normal plasma arbitrarily assigned to contain 1 unit ml-1 of FVII activity was used to construct a standard curve. The clotting activities (units mg-1) of purified FVII, FVIIa, and mixtures of FVIIa/FVII were then measured under each experimental condition of relipidated TF, PL/sTF, or PL without TF. Reference curves were generated as outlined (13Ndonwi M. Broze G.J. Bajaj S.P. J. Thromb. Haemost. 2005; 3: 112-118Crossref PubMed Scopus (13) Google Scholar), which were used to obtain the ratio of FVIIa/FVII present at a given time during the activation. Each reaction was carried out at 37 °C in TBS/Ca2+ as described (11Zhong D. Smith K.J. Birktoft J.J. Bajaj S.P. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 3574-3578Crossref PubMed Scopus (58) Google Scholar, 30Aktimur A. Gabriel M.A. Gailani D. Toomey J.R. J. Biol. Chem. 2003; 278: 7981-7987Abstract Full Text Full Text PDF PubMed Scopus (42) Google Scholar). The concentration of FIX was 3.6 μm, and that of FXIa was 12.5 nm. Aliquots were withdrawn at different times, quenched in SDS-gel loading buffer containing 5% 2-mercaptoethanol, and analyzed by SDS-PAGE. Binding of FVIIa-S344A/sTF to FX or FIX was studied on a Biacore T100 (Biacore, Inc., Uppsala, Sweden). Active site serine point mutant of FVIIa (S344A) was obtained by standard mutagenesis techniques, expressed, purified, and activated to FVIIa as described (12Zhong D. Bajaj M.S. Schmidt A.E. Bajaj S.P. J. Biol. Chem. 2002; 277: 3622-3631Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar). FVIIa-S344A was used in these experiments to prevent hydrolysis o" @default.
• W2044965942 created "2016-06-24" @default.
• W2044965942 creator A5040090678 @default.
• W2044965942 creator A5059846507 @default.
• W2044965942 creator A5064068211 @default.
• W2044965942 creator A5077724488 @default.
• W2044965942 creator A5090623668 @default.
• W2044965942 date "2007-05-01" @default.
• W2044965942 modified "2023-10-18" @default.
• W2044965942 title "Substitution of the Gla Domain in Factor X with That of Protein C Impairs Its Interaction with Factor VIIa/Tissue Factor" @default.
• W2044965942 cites W1410653340 @default.
• W2044965942 cites W1566324809 @default.
• W2044965942 cites W1581427725 @default.
• W2044965942 cites W1586167221 @default.
• W2044965942 cites W1604120362 @default.
• W2044965942 cites W1692778448 @default.
• W2044965942 cites W1849352096 @default.
• W2044965942 cites W1872915373 @default.
• W2044965942 cites W1902617097 @default.
• W2044965942 cites W193982181 @default.
• W2044965942 cites W1966875441 @default.
• W2044965942 cites W1971784860 @default.
• W2044965942 cites W1983039886 @default.
• W2044965942 cites W1983294129 @default.
• W2044965942 cites W1985407614 @default.
• W2044965942 cites W1986493103 @default.
• W2044965942 cites W1992763777 @default.
• W2044965942 cites W1997904070 @default.
• W2044965942 cites W2002893321 @default.
• W2044965942 cites W2006882959 @default.
• W2044965942 cites W2009061316 @default.
• W2044965942 cites W2011737569 @default.
• W2044965942 cites W2013083986 @default.
• W2044965942 cites W2019151399 @default.
• W2044965942 cites W2024315929 @default.
• W2044965942 cites W2026360066 @default.
• W2044965942 cites W2028897053 @default.
• W2044965942 cites W2032279957 @default.
• W2044965942 cites W2036503834 @default.
• W2044965942 cites W2037876981 @default.
• W2044965942 cites W2038670247 @default.
• W2044965942 cites W2049234188 @default.
• W2044965942 cites W2049826824 @default.
• W2044965942 cites W2050559195 @default.
• W2044965942 cites W2050591157 @default.
• W2044965942 cites W2060475676 @default.
• W2044965942 cites W2060913542 @default.
• W2044965942 cites W2065789283 @default.
• W2044965942 cites W2074631079 @default.
• W2044965942 cites W2079756409 @default.
• W2044965942 cites W2081636805 @default.
• W2044965942 cites W2082738576 @default.
• W2044965942 cites W2084142790 @default.
• W2044965942 cites W2086883128 @default.
• W2044965942 cites W2087587905 @default.
• W2044965942 cites W2093457400 @default.
• W2044965942 cites W2100837269 @default.
• W2044965942 cites W2123259277 @default.
• W2044965942 cites W2125943680 @default.
• W2044965942 cites W2146106891 @default.
• W2044965942 cites W2295080980 @default.
• W2044965942 cites W243299273 @default.
• W2044965942 doi "https://doi.org/10.1074/jbc.m701908200" @default.
• W2044965942 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17387172" @default.
• W2044965942 hasPublicationYear "2007" @default.
• W2044965942 type Work @default.
• W2044965942 sameAs 2044965942 @default.
• W2044965942 citedByCount "14" @default.
• W2044965942 countsByYear W20449659422012 @default.
• W2044965942 countsByYear W20449659422013 @default.
• W2044965942 countsByYear W20449659422015 @default.
• W2044965942 countsByYear W20449659422016 @default.
• W2044965942 countsByYear W20449659422019 @default.
• W2044965942 countsByYear W20449659422021 @default.
• W2044965942 countsByYear W20449659422023 @default.
• W2044965942 crossrefType "journal-article" @default.
• W2044965942 hasAuthorship W2044965942A5040090678 @default.
• W2044965942 hasAuthorship W2044965942A5059846507 @default.
• W2044965942 hasAuthorship W2044965942A5064068211 @default.
• W2044965942 hasAuthorship W2044965942A5077724488 @default.
• W2044965942 hasAuthorship W2044965942A5090623668 @default.
• W2044965942 hasBestOaLocation W20449659421 @default.
• W2044965942 hasConcept C126322002 @default.
• W2044965942 hasConcept C134306372 @default.
• W2044965942 hasConcept C185592680 @default.
• W2044965942 hasConcept C186738567 @default.
• W2044965942 hasConcept C199360897 @default.
• W2044965942 hasConcept C2778220771 @default.
• W2044965942 hasConcept C2778382381 @default.
• W2044965942 hasConcept C2781039887 @default.
• W2044965942 hasConcept C2908626413 @default.
• W2044965942 hasConcept C33923547 @default.
• W2044965942 hasConcept C36503486 @default.
• W2044965942 hasConcept C41008148 @default.
• W2044965942 hasConcept C55493867 @default.
• W2044965942 hasConcept C71924100 @default.
• W2044965942 hasConceptScore W2044965942C126322002 @default.
• W2044965942 hasConceptScore W2044965942C134306372 @default.

• next