FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2045088907> ?p ?o ?g. }

• W2045088907 endingPage "5984" @default.
• W2045088907 startingPage "5975" @default.
• W2045088907 abstract "The Escherichia coli mazEF system is a chromosomal “addiction module” that, under starvation conditions in which guanosine-3′,5′-bispyrophosphate (ppGpp) is produced, is responsible for programmed cell death. This module specifies for the toxic stable protein MazF and the labile antitoxic protein MazE. Upstream from the mazEF module are two promoters, P2 and P3 that are strongly negatively autoregulated by MazE and MazF. We show that the expression of this module is positively regulated by the factor for inversion stimulation. What seems to be responsible for the negative autoregulation of mazEF is an unusual DNA structure, which we have called an “alternating palindrome.” The middle part, “a,” of this structure may complement either the downstream fragment, “b,” or the upstream fragment, “c”. When the MazE·MazF complex binds either of these arms of the alternating palindrome, strong negative autoregulation results. We suggest that the combined presence of the two promoters, the alternating palindrome structure and the factor for inversion stimulation-binding site, all permit the expression of the mazEF module to be sensitively regulated under various growth conditions. The Escherichia coli mazEF system is a chromosomal “addiction module” that, under starvation conditions in which guanosine-3′,5′-bispyrophosphate (ppGpp) is produced, is responsible for programmed cell death. This module specifies for the toxic stable protein MazF and the labile antitoxic protein MazE. Upstream from the mazEF module are two promoters, P2 and P3 that are strongly negatively autoregulated by MazE and MazF. We show that the expression of this module is positively regulated by the factor for inversion stimulation. What seems to be responsible for the negative autoregulation of mazEF is an unusual DNA structure, which we have called an “alternating palindrome.” The middle part, “a,” of this structure may complement either the downstream fragment, “b,” or the upstream fragment, “c”. When the MazE·MazF complex binds either of these arms of the alternating palindrome, strong negative autoregulation results. We suggest that the combined presence of the two promoters, the alternating palindrome structure and the factor for inversion stimulation-binding site, all permit the expression of the mazEF module to be sensitively regulated under various growth conditions. base pair(s) factor for inversion stimulation polymerase chain reaction isopropyl-1-thio-βd-galactopyranoside In Escherichia coli programmed cell death is mediated through unique genetic elements called “addiction modules.” These consist of two genes, where the second gene specifies for a stable toxin, and the first gene specifies for a labile antitoxin. Addiction modules were first discovered in a number of extra-chromosomal elements where they were found to be responsible for the post-segregational killing effect, that is, the death of cells from which these extra-chromosomal elements have been removed. In other words, these cells are “addicted” to the continuous presence of a labile antitoxic element. Among the best studied addiction modules of this kind are ccdAB borne on factor F, pemIK borne on plasmid R100, and phd-doc borne on bacteriophage P1 (reviewed in Refs. 1Couturier M. Bahassi el-M. Van Melderen L. Trends Microbiol. 1998; 6: 269-275Abstract Full Text Full Text PDF PubMed Scopus (112) Google Scholar, 2Engelberg-Kulka H. Glaser G. Annu. Rev. MicroBiol. 1999; 53: 43-70Crossref PubMed Scopus (311) Google Scholar, 3Jensen R.B. Gerdes K. Mol. Microbiol. 1995; 17: 205-210Crossref PubMed Scopus (277) Google Scholar, 4Yarmolinsky M.B. Science. 1995; 267: 836-837Crossref PubMed Scopus (292) Google Scholar). All known extra-chromosomal addiction systems have been shown to be negatively autoregulated at the level of transcription. For example, such modules as ccdAB of the F factor (5de Feyter R. Wallace C. Lane D. Mol. Gen. Genet. 1989; 218: 481-486Crossref PubMed Scopus (50) Google Scholar, 6Tam J.E. Kline B.C. J. Bacteriol. 1989; 171: 2353-2360Crossref PubMed Google Scholar, 7Tam J.E. Kline B.C. Mol. Gen. Genet. 1989; 219: 26-32Crossref PubMed Scopus (70) Google Scholar),parD of the plasmid R1 (8Ruiz-Echevarria M.J. Berzal-Herranz A. Gerdes K. Diaz-Orejas R. Mol. Microbiol. 1991; 5: 2685-2693Crossref PubMed Scopus (71) Google Scholar), pemIK of the plasmid R100 (9Tsuchimoto S. Ohtsubo E. Mol. Gen. Genet. 1993; 237: 81-88Crossref PubMed Scopus (36) Google Scholar), or phd-doc of the plasmid P1 (10Magnuson R. Lehnherr H. Mukhopadhyay G. Yarmolinsky M.B. J. Biol. Chem. 1996; 271: 18705-18710Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar, 11Magnuson R. Yarmolinsky M.B. J. Bacteriol. 1998; 180: 6342-6351Crossref PubMed Google Scholar). Magnuson and Yarmolinsky (11Magnuson R. Yarmolinsky M.B. J. Bacteriol. 1998; 180: 6342-6351Crossref PubMed Google Scholar) suggested that the autoregulation of addiction modules might prevent fluctuations in the levels of the antidote and the toxin that would result in the activation of the toxin. During autoregulation, both the toxin and the antidote bind to a palindrome sequence in their own promoter region thereby decreasing their own transcription. In a few cases, the binding of antitoxin by itself resulted in a low level of autoregulation; the concomitant binding of the toxic element increased the level of binding (8Ruiz-Echevarria M.J. Berzal-Herranz A. Gerdes K. Diaz-Orejas R. Mol. Microbiol. 1991; 5: 2685-2693Crossref PubMed Scopus (71) Google Scholar, 10Magnuson R. Lehnherr H. Mukhopadhyay G. Yarmolinsky M.B. J. Biol. Chem. 1996; 271: 18705-18710Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar). In more complicated cases, as has been found for the pemIK (9Tsuchimoto S. Ohtsubo E. Mol. Gen. Genet. 1993; 237: 81-88Crossref PubMed Scopus (36) Google Scholar) andphd-doc (11Magnuson R. Yarmolinsky M.B. J. Bacteriol. 1998; 180: 6342-6351Crossref PubMed Google Scholar) modules, the promoter region of addiction module contains two separate palindrome sequences. Based on the stoichiometry and dynamics of binding, Magnuson and Yarmolinsky (11Magnuson R. Yarmolinsky M.B. J. Bacteriol. 1998; 180: 6342-6351Crossref PubMed Google Scholar) suggested a model in which the palindrome sequence binds the antidote dimer independently but cannot bind the toxin. When the toxin interacts with the antidote it increases the binding affinity of the antidote to the palindrome sequence, and thus increases half-life of the complex. Pairs of genes homologous to some of the extra-chromosomal addiction modules have also been found on the E. coli chromosome (12Aizenman E. Engelberg-Kulka H. Glaser G. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 6059-6063Crossref PubMed Scopus (499) Google Scholar, 13Gotfredsen M. Gerdes K. Mol. Microbiol. 1998; 29: 1065-1076Crossref PubMed Scopus (257) Google Scholar, 14Masuda Y. Miyakawa K. Nishimura Y. Ohtsubo E. J. Bacteriol. 1993; 175: 6850-6856Crossref PubMed Google Scholar, 15Masuda Y. Ohtsubo E. J. Bacteriol. 1994; 176: 5861-5863Crossref PubMed Google Scholar, 16Metzger S. Dror I.B. Aizenman E. Schreiber G. Toone M. Friesen J.D. Cashel M. Glaser G. J. Biol. Chem. 1988; 263: 15699-15704Abstract Full Text PDF PubMed Google Scholar). As we have reported previously, the E. coli mazEFsystem is the first known regulatable prokaryotic chromosomal addiction module (12Aizenman E. Engelberg-Kulka H. Glaser G. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 6059-6063Crossref PubMed Scopus (499) Google Scholar). This system consists of the two genes, mazE andmazF, that are located in the rel operon downstream from the relA gene (16Metzger S. Dror I.B. Aizenman E. Schreiber G. Toone M. Friesen J.D. Cashel M. Glaser G. J. Biol. Chem. 1988; 263: 15699-15704Abstract Full Text PDF PubMed Google Scholar). We found (12Aizenman E. Engelberg-Kulka H. Glaser G. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 6059-6063Crossref PubMed Scopus (499) Google Scholar) that themazEF gene pair has all the properties required for an addiction module. MazF is toxic and long lived, while MazE is antitoxic and short lived. MazE and MazF are coexpressed and they interact. In addition, the mazEF system has a unique property: its expression is regulated by guanosine-3′,5′-bispyrophosphate (ppGpp), which is synthesized by the RelA protein under conditions of amino acid starvation (17Cashel M. Gentry D.R. Hernandez V.Z. Vinella D. Escherichia coli and Salmonella: Cellular and Molecular Biology. 2nd Ed. ASM Press, Washington, D. C.1996: 1458-1496Google Scholar). Furthermore, overproduction of ppGpp inducesmazEF-mediated cell death (12Aizenman E. Engelberg-Kulka H. Glaser G. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 6059-6063Crossref PubMed Scopus (499) Google Scholar, 18Engelberg-Kulka H. Reches M. Narasimhan S. Schoulaker-Schwarz R. Klemes Y. Aizenman E. Glaser G. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 15481-15486Crossref PubMed Scopus (88) Google Scholar). These properties suggest that the mazEF module may be responsible for programmed cell death under conditions of nutrient starvation (12Aizenman E. Engelberg-Kulka H. Glaser G. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 6059-6063Crossref PubMed Scopus (499) Google Scholar). Here we studied the regulation of the expression of themazEF system. The promoter region of the chromosomally bornemazEF addiction module is partially homologous to that of the promoter of the pemIK plasmid borne addiction module (14Masuda Y. Miyakawa K. Nishimura Y. Ohtsubo E. J. Bacteriol. 1993; 175: 6850-6856Crossref PubMed Google Scholar). The promoters of both modules contain similar palindrome sequences, although, like the promoter of the phd-doc module (11Magnuson R. Yarmolinsky M.B. J. Bacteriol. 1998; 180: 6342-6351Crossref PubMed Google Scholar), the pemIK promoter includes two separated palindromes (9Tsuchimoto S. Ohtsubo E. Mol. Gen. Genet. 1993; 237: 81-88Crossref PubMed Scopus (36) Google Scholar) and the mazEF promoter was found to include only one (14Masuda Y. Miyakawa K. Nishimura Y. Ohtsubo E. J. Bacteriol. 1993; 175: 6850-6856Crossref PubMed Google Scholar). Since pemIK is autoregulated, Masuda and colleagues (14Masuda Y. Miyakawa K. Nishimura Y. Ohtsubo E. J. Bacteriol. 1993; 175: 6850-6856Crossref PubMed Google Scholar) hypothesized that mazEF might also be autoregulated. Results of our previous in vitro work (12Aizenman E. Engelberg-Kulka H. Glaser G. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 6059-6063Crossref PubMed Scopus (499) Google Scholar) revealed that the chromosomal addiction module mazEF can be expressed from two promoters, P2 and P3, which are located 13 bp1 apart. In in vivo studies, we found that, P2, the upstream promoter, was active in exponentially growing cells. Here we showed that the in vivo activity of the P3 promoter is only one-tenth of that of the P2 promoter. We found that the mazEF system is weakly autoregulated by the antitoxic component MazE, and efficiently autoregulated by the combined action of the antitoxic component MazE and the toxic component MazF. In this respect, the chromosomal promoter of the mazEFsystem is regulated as are most of the previously studied promoters of extra-chromosomal addiction modules. However, the mazEFpromoter has two unique properties: it has an unusual DNA structure that we call an “alternating palindrome,” and it carries a binding site for the factor for inversion stimulation (FIS). In the following discussion, we shall consider the relevance to mazEFregulation of these two sites. The media used were LB broth or LB agar (Bio 101, Inc.) supplemented with the appropriate antibiotics at the following final concentrations: 100 μg/ml ampicillin, 34 μg/ml chloramphenicol, 50 μg/ml kanamycin, or 20 μg/ml tetracycline. The bacterial strains used in this work are listed in TableI. The bacterial strain MC4100 and its derivatives bearing either the mazEF null allele or afis − allele were constructed by P1 transduction using strains bearing corresponding mutations as we have described previously (12Aizenman E. Engelberg-Kulka H. Glaser G. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 6059-6063Crossref PubMed Scopus (499) Google Scholar, 19Aviv M. Giladi H. Oppenheim A.B. Glaser G. FEMS Microbiol. Lett. 1996; 140: 71-76Crossref PubMed Google Scholar).Table IBacterial strains and plasmidsStrain/plasmidRelevant genotype/constructionSource/Ref.E. coli strainMC4100araD139(argF-lac)205 flbB5301 ptsF25 rpsL150 deoC1 relA133Casadaban M.J. Cohen S.N. Proc. Natl. Acad. Sci. U. S. A. 1979; 76: 4530-4533Crossref PubMed Scopus (585) Google ScholarMC4100ΔmazEFa ΔmazEF derivative ofMC4100, kanR12Aizenman E. Engelberg-Kulka H. Glaser G. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 6059-6063Crossref PubMed Scopus (499) Google ScholarMC4100fis−afis − derivative of MC4100, kanRThis workN99GalK2 strANIH collectionMG474A hu − derivative of N99, kanRLaboratory collectionMG475Aihf − derivative of N99, tetRLaboratory collectionMG487A kutF rpoS − derivative of N99, kanR19Aviv M. Giladi H. Oppenheim A.B. Glaser G. FEMS Microbiol. Lett. 1996; 140: 71-76Crossref PubMed Google ScholarMG521A hns −derivative of N99, tetR19Aviv M. Giladi H. Oppenheim A.B. Glaser G. FEMS Microbiol. Lett. 1996; 140: 71-76Crossref PubMed Google ScholarMG524Afis − derivative of N99, kanR19Aviv M. Giladi H. Oppenheim A.B. Glaser G. FEMS Microbiol. Lett. 1996; 140: 71-76Crossref PubMed Google ScholarMG533A gyrase − derivative of N99, tetR, temperature sensitiveLaboratory collectionPlasmidpKK223–3Expression vector with strongtac promoter, AmpRAmersham Pharmacia BiotechpKK-mazEA pKK223-3 derivative carrying themazE geneThis workpKK-mazEFA pKK223-3 derivative carrying the mazE and mazFgenesThis workMC1403A lacYZ gene fusion vector34Casadaban M.J. Chou J. Cohen S.N. J. Bacteriol. 1980; 143: 971-980Crossref PubMed Google ScholarpSK10Δ6A MC1403 derivative lackinglacY through partial cleavage by AvaIpSK10Δ6-pefA pSK10Δ6 derivative carrying the gene lac′Z fusion of the mazEF promoter from the end of relA to the 17th codon ofmazEThis workpLex1Vector for the construction of compatible with pSK10Δ6 plasmid set20Diederich L. Roth A. Messer W. BioTechniques. 1994; 16: 916-923PubMed Google ScholarpLex-mazEA pLex1 derivative carrying themazE gene under the tac promoter, camRThis workpLex-mazEFA pLex1 derivative carrying the mazE and mazF genes under thetac promoter, camRThis work Open table in a new tab Using the EF-1 and EG-3 oligomer primers (TableII), we synthesized a PCR fragment bearing the mazEF promoter. This fragment contained the end of the relA gene, the mazEF promoter, and the first 17 codons of the mazE gene. After cutting withBamHI, we cloned this fragment into theSmaI-BamHI sites of plasmid pSK10Δ6 that bears the lacZ gene lacking both its promoter and its first eight codons, that is lac'Z. We called this new plasmid pSK10Δ6-pef. Clones of pSK10Δ6-pef were selected on 5-bromo-4-chloro-3-indolyl β-d-galactopyranoside (X-gal) plates to which ampicillin had been added. Plasmids from the selected clones were purified and sequenced.Table IIOligonucleotides used in this studyNameSequence (5′-3′)Orientation and localizationPurposeEE-1GCGCCGAGATCTGAAGGAGATATACATATGATCCACAGTAGCGTAAAG+(+29 to +50)cl2-aCloning.TFPEGACGCGTCGACAAACCGCTATCATATG−(+17 to +2)cl2-aCloning.FG-1GCGACGAAGCTTCTACCCAATCAGTACGTTAA−(+594 to +613)cl2-aCloning.EF-1CCGGAATTCGTCGACGGGAGTTAGGCCGAA+(−73 to −43)cl2-aCloning.EF-2GCGACGAAGCTTTTACCAGACTTCCTTATCT−(+260 to +278)cl2-aCloning.EG-3ATCATCAATATTCAGATTGA−(+128 to +118)cl2-aCloning.EF-4GCTCGTATCTACAATGTAGA+(−38 to −19)cl2-aCloning. and gms2-bGel mobility shift.EF-5TCTACATTGTAGATACGAGC−(−19 to −38)cl2-aCloning. and gms2-bGel mobility shift.EF-6GTATCTACAATGTAGATTGATATATAC+(−33 to −7)gms2-bGel mobility shift.EF-7GTATATATCAATCTACATTGTAGATAC−(−7 to −33)gms2-bGel mobility shift.EF-8GATTGATATATACTGTATCTACATATG+(−20 to +7)gms2-bGel mobility shift.EF-9CATATGTAGATACAGTATATATCAATC−(+7 to −20)gms2-bGel mobility shift.EF-10GTAGATTGATATATACT+(−23 to −7)gms2-bGel mobility shift.EF-11AGTATATATCAATCTAC−(−7 to −23)gms2-bGel mobility shift.EF-12GCTCGTCTCTACAATGTAGA+(−39 to −20)mut2-cIntroduce mutation; the bold letters show the mutated nucleotides. (−32)EF-13TCTACATTGTAGAGACGAGC−(−20 to −39)mut2-cIntroduce mutation; the bold letters show the mutated nucleotides. (−32)EF-14GCTCGTCTCTACAATGTAGATTGATATAGACTGTATCTACATAT+(−38 to +6)muts2-cIntroduce mutation; the bold letters show the mutated nucleotides. (−32) and (−10)EF-15ATATGAAGATACAGTCTATATCAATCTACATTGTAGAGACGAGC−(+6 to −38)muts2-cIntroduce mutation; the bold letters show the mutated nucleotides. (−32) and (−10)EF-16GCTCGTCTCTACAATGTAGAGTGAT+(−38 to −14)muts2-cIntroduce mutation; the bold letters show the mutated nucleotides.(−32) and (−18)EF-17ATCACTCTACATTGTAGAGACGAGC−(−14 to −38)muts2-cIntroduce mutation; the bold letters show the mutated nucleotides. (−32) and (−18)EF-18CAATGTAGAGTGATATATAC+(−27 to −8)mut2-cIntroduce mutation; the bold letters show the mutated nucleotides. (−18)EF-19GTATATATCACTCTACATTG−(−8 to −27)mut2-cIntroduce mutation; the bold letters show the mutated nucleotides. (−18)EF-20TTTGCTCGTATCTATGCTGTAGATTGATATA+(−41 to −11)muts2-cIntroduce mutation; the bold letters show the mutated nucleotides. (−25, −26, −27)EF-21TATATCAATCTACAGCATAGATACGAGCAAA−(−11 to −41)muts2-cIntroduce mutation; the bold letters show the mutated nucleotides. (−25, −26, −27)EF-22GGCCGAAATGTGCTCGTATC+(−49 to −30)mut2-cIntroduce mutation; the bold letters show the mutated nucleotides. (−40)EF-23GATACGAGCACATTTCGGCC−(−30 to −49)mut2-cIntroduce mutation; the bold letters show the mutated nucleotides. (−40)2-a Cloning.2-b Gel mobility shift.2-c Introduce mutation; the bold letters show the mutated nucleotides. Open table in a new tab Using appropriate DNA primers (EE-1 and EF-2 for mazE gene, or EE-1 and FG-1 for mazEF genes, see Table II), we synthesized PCR fragments bearing the open reading frame of the mazE or the mazEF genes. These PCR products were used for cloning the corresponding genes under thetac promoter present on the expression vector pKK223-3. We called the resulting plasmids pKK-mazE and pKK-mazEF (Table I). We also cloned these PCR fragments into the modified pSK10Δ6 compatible plasmid pLex1 that bears the IPTG inducible promoter ptac (20Diederich L. Roth A. Messer W. BioTechniques. 1994; 16: 916-923PubMed Google Scholar). We could not use the plasmids of the pKK set for testing the influence of MazE and MazF proteins on their promoter because both pKK223-3 and pSK10Δ6 are derivatives of the plasmid pBR322 and they are not compatible. Using pLex1 as our parent plasmid, we constructed the plasmids pLex-mazE and pLex-mazEF by introducing the promoter ptac, the chloramphenicol resistance gene, the p15A replication origin, and either mazE or mazEF such that they were under control of the ptac promoter. We used these plasmids to study the influence of the proteins MazE and MazE-MazF on themazEF promoter when it was present on the pSK10Δ6-pef plasmid. With the exception of the wild type N99 strain, we made crude cell extracts of all E. coli strains mentioned in Table I. We grew all of the strains at 37 °C to A 6000.2 in LB medium supplemented with appropriate antibiotics. We transformed strain MC4100ΔmazEF with plasmids pKK-mazE or pKK-mazEF. We induced the expression of the genes cloned under the ptac promoter by adding 1 mm IPTG, and then allowing growth to continue for 1 more hour. No plasmids were added to the control bacteria that were also grown to A 600 0.2. Cells were harvested, sonicated, and centrifuged, and the supernatants were dialyzed overnight against 10 mm HEPES, 50 mm NaCl, 1 mm dithiothreitol, and 50% glycerol at pH 8.0. The amount of protein in the samples was estimated by use of the Bradford assay (Bio-Rad). Dialyzed supernatants were stored at −80 °C. Proteins expressed either from the ptac promoter bearing plasmid pKK223 or from the chromosome of E. colistrain MC4100 were analyzed by electrophoresis on denaturing and native gels and by Western blot analysis using antibodies raised against MazE (Fig. 1, A and C) and MazF (Fig. 1 B). As a control, we tested the proteins expressed from the chromosome of MC4100ΔmazEF. As we found previously (12Aizenman E. Engelberg-Kulka H. Glaser G. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 6059-6063Crossref PubMed Scopus (499) Google Scholar), we also found here that MazE and MazF interact directly. We observed no bands of the proteins from the cell extracts of the addiction modulemazEF expressed from the cell chromosome, presumably because under such conditions these proteins were expressed at very low physiological concentrations. When both MazE and MazF were present on native gels, we observed a complex between the toxin and its antidote (indicated by an arrow on the Fig. 1 C). We used these crude protein extracts to study the influence of MazE and MazF on their own promoter. DNA fragments for the gel mobility shift assays and DNase I footprint analysis were obtained by PCR with appropriate primers (TableII) and purified with a gel extraction kit (Qiagen). Short fragments (about 20–30 bp) were obtained by slow annealing of complementary primers in the presence of 100 mm NaCl and 1 mmEDTA. The primers that were used are listed in Table II. The fragments obtained were end labeled by polynucleotide kinase (New England Biolabs, Inc.) with [γ-32P]ATP (Amersham Pharmacia Biotech) and purified on the Sephadex G-50 columns (Roche Molecular Biochemicals, Germany). DNA sequencing was done by the dideoxy method (21Sanger F. Nicklen S. Coulson A.R. Proc. Natl. Acad. Sci. U. S. A. 1977; 80: 7010-7013Google Scholar) using the Thermo Sequenase Radiolabeled Terminator Cycle Sequencing kit (Amersham Pharmacia Biotech). Ten-microgram samples of crude protein extracts were diluted with the binding buffer (0.1 m Tris HCl, pH 7.4, 2 mm EDTA, 1 mm dithiothreitol, 5 mmMgCl2, 5% glycerol) to a final volume of 10 μl. To inactivate the nucleases, the samples were then heated at 65 °C for 3 min. When the mixtures had cooled to room temperature, 2 μg of poly(dI-dC) (Roche Molecular Biochemicals) and 2 μl of labeled DNA fragments were added. The binding reactions were conducted at room temperature for 10 min, after which they were loaded onto 6% native polyacrylamide gels and run in TAE buffer (22Maniatis T. Fritsch E.F. Sambrook J. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1982Google Scholar) at 200 V. DNase I footprinting analyses were done according to Giladi et al. (23Giladi H. Koby S. Gottesman M.E. Oppenheim A.B. J. Mol. Biol. 1992; 224: 937-948Crossref PubMed Scopus (55) Google Scholar). β-Galactosidase assays were done according to Miller (24Miller J.H. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1972Google Scholar). Crude cellular extract of E. coliMC4100ΔmazEF strain was loaded on Sephadex G-100 (Amersham Pharmacia Biotech) column (1.5 × 75 cm, Bio-Rad) equilibrated with binding buffer, and supplemented with 0.4 m NaCl to prevent unspecific adsorption. The column was initially calibrated with standard proteins having established molecular weights. Collected fractions were analyzed by the gel mobility shift assay. RNA extraction was carried out using the RNeasy Mini kit (Qiagen). Primer extension experiments were carried out with avian myeloblastosis virus reverse transcriptase (U. S. Biochemical Corp.) according to Gafny and colleagues (25Gafny R. Hyman H.C. Razin S. Glaser G. Nucleic Acids Res. 1988; 16: 61-76Crossref PubMed Scopus (14) Google Scholar). The oligonucleotide primer used for the pSK10Δ6-pef construct and its mutant derivatives was “−40 M13 forward” (Amersham Pharmacia Biotech) from the lacZ gene to the transcription start sites of themazEF promoter. The primer was end labeled as a DNA fragments (see above). Reaction products were resolved on a 6% sequencing gel. A DNA sequencing reaction was performed with the same primer and run on the gel parallel to the primer extension reaction. To quantify the RNA levels, the gels were analyzed and the bands were quantified using the Fujix BAS100 PhosphorImager. Point mutations were introduced into mazEF promoter region by PCR-based site-directed overlap extension mutagenesis (26Ho S.N. Hunt H.D. Horton R.M. Pullen J.K. Pease L.R. Gene (Amst.). 1989; 77: 51-59Crossref PubMed Scopus (6810) Google Scholar) using appropriate primers (Table II). All introduced mutational changes were verified by DNA sequence determination. Like most addiction modules, sequence analysis of the promoter region ofmazEF suggests that it is autoregulated at the transcriptional level (15Masuda Y. Ohtsubo E. J. Bacteriol. 1994; 176: 5861-5863Crossref PubMed Google Scholar). To test whether mazEF was indeed autoregulated we chose lac'Z as a reporter gene and fused it to the mazEF promoter region, where the beginning ofmazE is fused to the eighth codon of lacZ. We introduced this gene fusion into plasmid pSK10Δ6-pef. We used pSK10Δ6-pef to transform the MC4100ΔmazEF strain and then measured the cellular levels of β-galactosidase (Fig. 2 A). Under optimal growth conditions at A 600 0.2–0.3, we found cellular levels of β-galactosidase around 7000–8000 Miller units. This high level of lac'Z expression suggests that themazEF promoter is very strong, similar to the promoters of other addiction modules that have been studied (5de Feyter R. Wallace C. Lane D. Mol. Gen. Genet. 1989; 218: 481-486Crossref PubMed Scopus (50) Google Scholar, 8Ruiz-Echevarria M.J. Berzal-Herranz A. Gerdes K. Diaz-Orejas R. Mol. Microbiol. 1991; 5: 2685-2693Crossref PubMed Scopus (71) Google Scholar, 9Tsuchimoto S. Ohtsubo E. Mol. Gen. Genet. 1993; 237: 81-88Crossref PubMed Scopus (36) Google Scholar, 10Magnuson R. Lehnherr H. Mukhopadhyay G. Yarmolinsky M.B. J. Biol. Chem. 1996; 271: 18705-18710Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar). Strain MC4100ΔmazEF, already harboring pSK10Δ6-pef, was transformed with the compatible plasmids pLex-mazE or pLex-mazEF in which themazE or mazEF genes were under control of the IPTG inducible tac promoter. The levels of β-galactosidase activity were measured at mid-log phase. Inducing plasmid pLex-mazE to produce MazE led to moderate inhibition (about 40%) of mazEF promoter activity, as reflected by the reduction in β-galactosidase activity; however, inducing pLex-mazEF to produce both MazE and MazF led to a much higher level (up to 90%) of inhibition (Fig. 2 A). Using Western blot analysis, we found increased cellular levels of protein MazE when plasmid pLex-mazE was induced, and similarly, increased cellular levels of MazE and MazF when pLex-mazEFwas induced (data not shown). Thus, the activity of mazEFpromoter is about five times more inhibited by the combination of MazE and MazF then by MazE alone. To verify that the regulation of the mazEF promoter took place at the transcriptional level, we performed a series of primer extension experiments using plasmid pSK10Δ6-pef as the template. Using RNA extracted from cells carrying this plasmid, we estimated the relative efficiency of transcription from the two promoters P2 and P3 (Fig. 2 B). Transcription initiated from promoter P3 was about 10-fold weaker then that from P2, located 13 bp upstream (Fig.2 B). This explains why we were unable to observe initiation from P3 by primer extension on RNA transcribed from a chromosome borne mazEF module, which is present in only one copy per cell (12Aizenman E. Engelberg-Kulka H. Glaser G. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 6059-6063Crossref PubMed Scopus (499) Google Scholar). Primer extension experiments under the same experimental conditions revealed that induction by IPTG led to repression of transcription from both P2 and P3 by MazE or by the MazE·MazF complex. Twenty minutes after induction, MazE repressed P2expression by 53% compared with the activity of the unrepressed promoter; MazE·MazF complex repressed P2 by 92% (Fig. 2,B and C). We believe that these two promoters are inhibited similarly; however, after repression, the levels of the P3 transcript may have been so low that we could not measure them (Fig. 2 B). These results from our primer extension experiments (Fig. 1,B and C) confirmed the data that we obtained in our assays for β-galactosidase activity (Fig.2 A). Thus, we concluded that the mazEF addiction module is autoregulated at the transcriptional level. To further investigate the mechanism of the action of MazE-MazF on the promoters, we studied how MazE and MazF bind to the promoter region of the mazEFmodule (see map in Fig. 3 A). As the source of proteins for these assays we used crude cell extracts enriched for either MazE or MazE and MazF (Fig. 1). For our electrophoretic mobility shift assay we used the 74-bp fragment of themazEF promoter that extends from the multi-linker to the residue +2 of the P2 promoter (Fig. 3 A). This DNA fragment was labeled and exposed to every one of the cell extracts that we had prepared (defined in the legend to Fig. 1). We found that the mazEF promoter was bound by the MazE·MazF complex (Fig. 4 A, lane 4), confirming our hypothesis that mazEF is negatively autoregulated (Fig. 2). The crude extract containing only MazE but lacking MazF also bound the promoter fragment (Fig. 4 A,lane 3). Although MazE was present in approximately equal amounts when by itself or in the presence of MazF, here the shift was much weaker (Fig. 1 A, compare lanes 3 and4). Thus, MazE could bind to its own promoter, but, like the antidotes from most other addiction modules of plasmid origin, the binding affinity of MazE to its promoter was very low. The cooperative binding of the toxic protein, here MazF, greatly enhanced the binding of MazE" @default.
• W2045088907 created "2016-06-24" @default.
• W2045088907 creator A5034199051 @default.
• W2045088907 creator A5054967126 @default.
• W2045088907 creator A5069661431 @default.
• W2045088907 creator A5071614848 @default.
• W2045088907 date "2001-02-01" @default.
• W2045088907 modified "2023-10-12" @default.
• W2045088907 title "The Regulation of the Escherichia coli mazEF Promoter Involves an Unusual Alternating Palindrome" @default.
• W2045088907 cites W1480097114 @default.
• W2045088907 cites W1490220406 @default.
• W2045088907 cites W1540686772 @default.
• W2045088907 cites W1948918571 @default.
• W2045088907 cites W1949490448 @default.
• W2045088907 cites W1991747510 @default.
• W2045088907 cites W1997693788 @default.
• W2045088907 cites W2004968410 @default.
• W2045088907 cites W2017550427 @default.
• W2045088907 cites W2030094346 @default.
• W2045088907 cites W2030487594 @default.
• W2045088907 cites W2034256916 @default.
• W2045088907 cites W2034367374 @default.
• W2045088907 cites W2050406602 @default.
• W2045088907 cites W2059064726 @default.
• W2045088907 cites W2060913542 @default.
• W2045088907 cites W2066308747 @default.
• W2045088907 cites W2072564711 @default.
• W2045088907 cites W2085319475 @default.
• W2045088907 cites W2095017787 @default.
• W2045088907 cites W2095029652 @default.
• W2045088907 cites W2102169469 @default.
• W2045088907 cites W2125016438 @default.
• W2045088907 cites W2127372563 @default.
• W2045088907 cites W2141623271 @default.
• W2045088907 cites W2148525353 @default.
• W2045088907 cites W2154936481 @default.
• W2045088907 cites W2163326745 @default.
• W2045088907 cites W2167420567 @default.
• W2045088907 doi "https://doi.org/10.1074/jbc.m008832200" @default.
• W2045088907 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11071896" @default.
• W2045088907 hasPublicationYear "2001" @default.
• W2045088907 type Work @default.
• W2045088907 sameAs 2045088907 @default.
• W2045088907 citedByCount "128" @default.
• W2045088907 countsByYear W20450889072012 @default.
• W2045088907 countsByYear W20450889072013 @default.
• W2045088907 countsByYear W20450889072014 @default.
• W2045088907 countsByYear W20450889072015 @default.
• W2045088907 countsByYear W20450889072016 @default.
• W2045088907 countsByYear W20450889072017 @default.
• W2045088907 countsByYear W20450889072018 @default.
• W2045088907 countsByYear W20450889072019 @default.
• W2045088907 countsByYear W20450889072020 @default.
• W2045088907 countsByYear W20450889072021 @default.
• W2045088907 countsByYear W20450889072022 @default.
• W2045088907 countsByYear W20450889072023 @default.
• W2045088907 crossrefType "journal-article" @default.
• W2045088907 hasAuthorship W2045088907A5034199051 @default.
• W2045088907 hasAuthorship W2045088907A5054967126 @default.
• W2045088907 hasAuthorship W2045088907A5069661431 @default.
• W2045088907 hasAuthorship W2045088907A5071614848 @default.
• W2045088907 hasBestOaLocation W20450889071 @default.
• W2045088907 hasConcept C104317684 @default.
• W2045088907 hasConcept C153911025 @default.
• W2045088907 hasConcept C185592680 @default.
• W2045088907 hasConcept C2908821069 @default.
• W2045088907 hasConcept C44667518 @default.
• W2045088907 hasConcept C54355233 @default.
• W2045088907 hasConcept C547475151 @default.
• W2045088907 hasConcept C86803240 @default.
• W2045088907 hasConcept C89423630 @default.
• W2045088907 hasConcept C98108389 @default.
• W2045088907 hasConceptScore W2045088907C104317684 @default.
• W2045088907 hasConceptScore W2045088907C153911025 @default.
• W2045088907 hasConceptScore W2045088907C185592680 @default.
• W2045088907 hasConceptScore W2045088907C2908821069 @default.
• W2045088907 hasConceptScore W2045088907C44667518 @default.
• W2045088907 hasConceptScore W2045088907C54355233 @default.
• W2045088907 hasConceptScore W2045088907C547475151 @default.
• W2045088907 hasConceptScore W2045088907C86803240 @default.
• W2045088907 hasConceptScore W2045088907C89423630 @default.
• W2045088907 hasConceptScore W2045088907C98108389 @default.
• W2045088907 hasIssue "8" @default.
• W2045088907 hasLocation W20450889071 @default.
• W2045088907 hasOpenAccess W2045088907 @default.
• W2045088907 hasPrimaryLocation W20450889071 @default.
• W2045088907 hasRelatedWork W174748315 @default.
• W2045088907 hasRelatedWork W1813812403 @default.
• W2045088907 hasRelatedWork W2022891666 @default.
• W2045088907 hasRelatedWork W2052094308 @default.
• W2045088907 hasRelatedWork W2097060692 @default.
• W2045088907 hasRelatedWork W2135850184 @default.
• W2045088907 hasRelatedWork W2252376317 @default.
• W2045088907 hasRelatedWork W2469250300 @default.
• W2045088907 hasRelatedWork W2727878429 @default.
• W2045088907 hasRelatedWork W3208158820 @default.
• W2045088907 hasVolume "276" @default.
• W2045088907 isParatext "false" @default.

• next