FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2045338741> ?p ?o ?g. }

• W2045338741 endingPage "494" @default.
• W2045338741 startingPage "488" @default.
• W2045338741 abstract "•Autophagy deficiency in mouse hematopoietic system causes impaired platelet production and activation•The failure in platelet production and activation in autophagy-defective mice results primarily from impaired megakaryopoiesis and thrombopoiesis•Impaired megakaryopoiesis and thrombopoiesis are caused by mitochondrial and cell-cycle dysfunction due to autophagy defect During hematopoiesis, megakaryopoiesis, megakaryocyte differentiation, and thrombopoiesis are regulated at multiple stages, which involve successive lineage commitment steps and proceed with polyploidization, maturation, and organized fragmentation of the cytoplasm, leading to the release of platelets in circulation. However, the cellular mechanisms by which megakaryocytes derive from their progenitors and differentiate into platelets have not fully been understood. Using an Atg7 hematopoietic conditional knockout mouse model, we found that loss of autophagy, a metabolic process essential in homeostasis and cellular remodeling, caused mitochondrial and cell cycle dysfunction, impeding megakaryopoiesis and megakaryocyte differentiation, as well as thrombopoiesis and subsequently produced abnormal platelets, larger in size and fewer in number, ultimately leading to severely impaired platelet production and failed hemostasis. During hematopoiesis, megakaryopoiesis, megakaryocyte differentiation, and thrombopoiesis are regulated at multiple stages, which involve successive lineage commitment steps and proceed with polyploidization, maturation, and organized fragmentation of the cytoplasm, leading to the release of platelets in circulation. However, the cellular mechanisms by which megakaryocytes derive from their progenitors and differentiate into platelets have not fully been understood. Using an Atg7 hematopoietic conditional knockout mouse model, we found that loss of autophagy, a metabolic process essential in homeostasis and cellular remodeling, caused mitochondrial and cell cycle dysfunction, impeding megakaryopoiesis and megakaryocyte differentiation, as well as thrombopoiesis and subsequently produced abnormal platelets, larger in size and fewer in number, ultimately leading to severely impaired platelet production and failed hemostasis. During hematopoiesis, hematopoietic stem cells (HSCs) give rise to two lineages, a common lymphoid progenitor, capable of producing lymphocytes, and a common myeloid progenitor with developmental potential restricted to granulocytes/monocytes, basophils, eosinophils, erythroid, and megakaryocytes [1Kondo M. Wagers A.J. Manz M.G. et al.Biology of hematopoietic stem cells and progenitors: Implications for clinical application.Annu Rev Immunol. 2003; 21: 759-806Crossref PubMed Scopus (768) Google Scholar]. Megakaryocytes have a unique maturation process that includes polyploidization, development of an extensive internal demarcation membrane system, formation of proplatelet processes, and finally release into sinusoidal blood vessels, which undergo repeated abscissions to yield circulating platelets [2Bluteau D. Lordier L. Di Stefano A. et al.Regulation of megakaryocyte maturation and platelet formation.J Thromb Haemost. 2009; 7: 227-234Crossref PubMed Scopus (82) Google Scholar, 3Machlus K.R. Italiano Jr., J.E. The incredible journey: From megakaryocyte development to platelet formation.J Cell Biol. 2013; 201: 785-796Crossref PubMed Scopus (410) Google Scholar]. Megakaryocyte differentiation is regulated both positively and negatively by cytokines and transcription factors. For instance, granulocyte-macrophage colony–stimulating factor, interleukin (IL) 3, IL-6, IL-11, IL-12, and erythropoietin can stimulate megakaryocytic progenitor proliferation, whereas IL-1α and leukemia inhibitory factor can modulate megakaryocyte maturation and platelet release [4Machlus K.R. Thon J.N. Italiano Jr., J.E. Interpreting the developmental dance of the megakaryocyte: A review of the cellular and molecular processes mediating platelet formation.Br J Haematol. 2014; 165: 227-236Crossref PubMed Scopus (144) Google Scholar]. The number of megakaryocytes and platelets in mice lacking thrombopoietin (TPO) decreases by approximately 85%. Although suffering severe thrombocytopenia, mice retain ∼15% of their peripheral platelet count, indicating that TPO is central to but dispensable for megakaryocytopoiesis [5Murone M. Carpenter D.A. de Sauvage F.J. Hematopoietic deficiencies in c-mpl and TPO knockout mice.Stem Cells. 1998; 16: 1-6Crossref PubMed Scopus (83) Google Scholar, 6Ng A.P. Hauppi M. Metcalf D. et al.Mpl expression on megakaryocytes and platelets is dispensable for thrombosis but essential to prevent myeloproliferation.Proc Natl Acad Sci U S A. 2014; 111: 5884-5889Crossref PubMed Scopus (94) Google Scholar]. Multiple transcription factors, including runt-related transcription factor 1 (RUNX1), GATA binding protein 1 (GATA1), Friend leukemia virus integration 1 (Fli1), and transcriptional activator Myb (c-Myb), regulate megakaryocyte differentiation. GATA-1, the master regulator of hematopoiesis, plays a critical role in megakaryocyte differentiation by functioning either as an activator or repressor, depending on the protein complex [7Martin F. Prandini M.H. Thevenon D. Marguerie G. Uzan G. The transcription factor GATA-1 regulates the promoter activity of the platelet glycoprotein IIb gene.J Biol Chem. 1993; 268: 21606-21612Abstract Full Text PDF PubMed Google Scholar]. A recent study demonstrates that GATA-1 directly activates transcription of genes encoding the essential autophagy component microtubule-associated protein 1 light chain 3B (LC3B) and its homologues [8Kang Y.A. Sanalkumar R. O'Geen H. et al.Autophagy driven by a master regulator of hematopoiesis.Mol Cell Biol. 2012; 32: 226-239Crossref PubMed Scopus (94) Google Scholar]. Autophagy is an evolutionary conserved metabolic and remodeling process that is executed by a series of autophagy related genes (ATGs) [9Levine B. Klionsky D.J. Development by self-digestion: molecular mechanisms and biological functions of autophagy.Dev Cell. 2004; 6: 463-477Abstract Full Text Full Text PDF PubMed Scopus (3101) Google Scholar, 10Mortensen M. Ferguson D.J.P. Edelmann M. et al.Loss of autophagy in erythroid cells leads to defective removal of mitochondria and severe anemia in vivo.Proc Natl Acad Sci U S A. 2009; 107: 832-837Crossref PubMed Scopus (280) Google Scholar]. Deletion of Atg7 in hematopoietic stem cells results in failure to maintain an HSC pool and in the development of myeloid malignancies [11Mortensen M. Soilleux E.J. The autophagy protein Atg7 is essential for hematopoietic stem cell maintenance.J Exp Med. 2011; 208: 455-467Crossref PubMed Scopus (438) Google Scholar]. Mice lacking Atg7 in the hematopoietic system develop severe anemia. Atg7−/− erythrocytes accumulate damaged mitochondria with altered membrane potential, leading to cell death. Deficiency of Atg7 also led to severe lymphopenia as a result of mitochondrial damage, followed by apoptosis in mature T lymphocytes [10Mortensen M. Ferguson D.J.P. Edelmann M. et al.Loss of autophagy in erythroid cells leads to defective removal of mitochondria and severe anemia in vivo.Proc Natl Acad Sci U S A. 2009; 107: 832-837Crossref PubMed Scopus (280) Google Scholar]. A recent study showed that human platelets express Atg5, Atg7, and LC3. Similar to nucleated mammalian cells, autophagy in human platelets was stimulated by cell starvation or rapamycin in a phosphatidylinositol 3-kinase–dependent manner. Disruption of autophagic flux led to impairment of platelet aggregation and adhesion. Furthermore, monoallelic deletion of Becn1 in mice displayed a prolonged bleeding time and reduced platelet aggregation. These results suggest that platelets may require a Becn1-dependent autophagy [12Feng W. Chang C. Luo D. et al.Dissection of autophagy in human platelets.Autophagy. 2014; 10: 642-651Crossref PubMed Scopus (57) Google Scholar]. Hemostasis depends on functional platelets, which are produced by megakaryocytes requiring normal megakaryopoiesis, megakaryocyte differentiation, and thrombopoiesis. In this study, we examine the role of autophagy during in vivo megakaryopoiesis, megakaryocyte differentiation, and thrombopoiesis using hematopoietic system conditional knockout mice. The Atg7-deficient mice displayed aberrant megakaryogenesis, megakaryocyte differentiation, and thrombopoiesis from hematopoietic progenitors and ultimately failed platelet production and hemostasis. Suppliers were: phycoerythrin (PE)-labeled JON/A antibody supplied by Emfret (Eibelstadt, Germany); PE-conjugated anti-P-selectin antibody, anti-CD41-FITC, and anti-CD61-PE supplied by eBioscience (San Diego, CA); MitoTracker Green and MitoSox Red supplied by Invitrogen (Carlsbad, CA). Atg7Flox/Flox mice (from RIKEN BioResource Center, Ibaraki, Japan) were crossed to Vav-Cre mice (Jackson Laboratory, Sacramento, CA) to obtain Atg7f/f;Vav-Cre. Genotyping was performed on tail genomic DNA as described previously [13Komatsu M. Waguri S. Ueno T. et al.Impairment of starvation-induced and constitutive autophagy in Atg7-deficient mice.J Cell Biol. 2005; 169: 425-434Crossref PubMed Scopus (1852) Google Scholar, 14De Boer J. Williams A. Skavdis G. et al.Transgenic mice with hematopoietic and lymphoid specific expression of Cre.Eur J Immunol. 2003; 33: 314-325Crossref PubMed Scopus (509) Google Scholar]. Male and female mice were used equally in all experiments. Each group contained at least six mice. All experiments with animals complied with the institutional protocols on animal welfare and were approved by the Ethics Committee of Soochow University, China. The final polymerase chain reaction (PCR) volume was 20 μL, and PCR was performed as follows: 1 cycle of 94°C for 5 min, 35 cycles of 94°C for 30 sec, 60°C or 64°C for 30 sec, 72°C for 40 sec or 2 min, and 1 cycle of 72°C for 5 min. After gel electrophoresis, the wild-type (WT) band of Atg7f/f was detected at 653 bp, and the mutant band was detected at 426 bp; the WT band of Atg7 knockout band was detected at 1,641 bp, and the knockout (KO) band was detected at 600 bp. The positive band of Vav-Cre was detected at 236 bp. The following primers were used: Atg7-F: CATCTTGTAGCACCTGCTGACCTGG; Atg7-R: CCACTGGCCCATCAGTGAGCATG; LoxP-R: GCGGATCCTCGTATAATGTATGCTATACGAAGTTAT; Atg7-F2: TGGCTGCTACTTCTGCAATGATGT; Atg7-R2: AAGCCAAAGGAAACCAAGGGAGTG; Vav-F: AGATGCCAGGACATCAGGAACCTG; and Vav-R: ATCAGCCACACCAGACACAGAGATC. Isolated bone marrow lineage-negative (Lin−) cells were solubilized in 1× lysis buffer (Cell Signaling, Beverly, MA) containing protease inhibitor (Roche, Basel, Swiss). Cell debris was removed by centrifugation. Thirty micrograms of protein was separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred to a polyvinylidene fluoride (PVDF) membrane (Millipore, Billerica, MA). The membrane was incubated with anti-Atg7, anti–glyceraldehyde 3-phosphate dehydrogenase and anti-LC3 monoclonal antibodies, detected with the enhanced chemiluminescent (ECL) system (Pierce, Waltham, MA). We added 20 μL mouse peripheral blood into 500 μL CPK-303A solution (37°C), and then routine blood examination was performed using Sysmex KX-21N (Kobe, Japan). Mice were anesthetized by intraperitoneal injection of 2, 2, 2-trichloroethan-1, 1-diol (0.1 mL/10 g of body weight), and the distal 3-mm segment of the tail was removed with a scalpel. Time until complete cessation of bleeding was measured. Bleeding was stopped after 20 min if the tail was still bleeding. Flow cytometry studies on mouse platelets were performed using platelet-rich plasma prepared from blood obtained into acid-citrate dextrose solution through the inferior vena cava and diluted into Tyrode's buffer as previously described [15Wu Y. Ahmad S.S. Zhou J. Wang L. Cully M.P. Essex D.W. The disulfide isomerase ERp57 mediates platelet aggregation, hemostasis, and thrombosis.Blood. 2012; 119: 1737-1746Crossref PubMed Scopus (74) Google Scholar]. Bone marrow or Lin− cells were stained with indicated antibodies or dyes and analyzed by BD Calibur cytometer (BD Bioscience, San Diego, CA). Aggregation studies were performed using washed platelets prepared as described previously [16Wu Y. Suzuki-Inoue K. Satoh K. et al.Role of Fc receptor gamma-chain in platelet glycoprotein Ib-mediated signaling.Blood. 2001; 97: 3836-3845Crossref PubMed Scopus (104) Google Scholar]. Acetylcholinesterase (AChE) activity was measured by the microplate method [17Matsumura-Takeda K. Sogo S. Isakari Y. et al.CD41/CD45 cells without acetylcholinesterase activity are immature and a major megakaryocytic population in murine bone marrow.Stem Cells. 2007; 25: 862-870Crossref PubMed Google Scholar]. Briefly, cells (1 × 103 cells) and platelets (1 × 105) were suspended with 200 μL of phosphate-buffered saline containing 0.5% of Bovine Serum Albumin (BSA) and seeded in a 96-well plate. We added 50 μL of 0.265 mmol/L 5,5′-dithiobis-2-nitrobenzoic acid (Sigma-Aldrich, St. Louis, MO) containing 1 mol/L Tris (pH 8.0) and 1% Triton X-100 (Sigma-Aldrich); then, the optical density (OD) was measured at 405 nm using automatic colorimeter (OD405[A]). We then added 15 μL of 10 mmol/L acetylthiocholine iodide (Sigma-Aldrich). Optical density was again measured at 405 nm after 30 min (OD405[B]). Specific AChE activity (ΔOD405) was calculated by OD405[B]-OD405[A]. Bone marrow Lin- cells were cultured with TPO and stem cell factor (SCF) for 4 days and then harvested. After centrifugation, cells were fixed in 70% ice-cold ethanol at 4°C overnight and then incubated with propidium iodide staining solution containing 50 μg/mL propidium iodide and 20 μg/mL RNase at room temperature for 30 min before analysis by flow cytometry. Bone marrow cells were stained with biotin antibodies specific for the following lineage markers: CD5, CD45R (B220), CD11b, Anti-Gr-1(Ly-6G/C), and Ter119. To obtain Lin− cells, Lin+ cells were depleted using anti-biotin microbeads (Miltenyi Biotec, Bergisch Gladbach, Germany). Mature megakaryocytes from BM cells were defined using the standard method [18Mazharian A. Watson S.P. Severin S. Critical role for ERK1/2 in bone marrow and fetal liver-derived primary megakaryocyte differentiation, motility, and proplatelet formation.Exp Hematol. 2009; 37: 1238-1249Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar] with some modifications. Briefly, BM cells were obtained from femora and tibiae of C57BL6 mice by flushing, and lineage positive cells were depleted using immunomagnetic beads (Miltenyi Biotec). The remaining population was cultured in 2.6% serum-supplemented Roswell Park Memorial Institute 1640 medium with 2 mmol/L L-glutamine, penicillin/streptomycin, and 20 ng/mL murine SCF at 37°C under 5% CO2 for 2 days. Cells were then cultured for an additional 4 days in the presence of 20 ng/mL murine SCF and 100 ng/mL murine TPO [19Dumon S. Heath V.L. Tomlinson M.G. Gottgens B. Frampton J. Differentiation of murine committed megakaryocytic progenitors isolated by a novel strategy reveals the complexity of GATA and Ets factor involvement in megakaryocytopoiesis and an unexpected potential role for GATA-6.Exp Hematol. 2006; 34: 654-663Abstract Full Text Full Text PDF PubMed Scopus (19) Google Scholar, 20Dhanjal T.S. Pendaries C. Ross E.A. et al.A novel role for PECAM-1 in megakaryocytokinesis and recovery of platelet counts in thrombocytopenic mice.Blood. 2007; 109: 4237-4244Crossref PubMed Scopus (68) Google Scholar]. Morphology of megakaryocytes was evaluated by Wright-Giemsa staining. Briefly, cytospin preparations were incubated sequentially in solution A for 1 min and solution B for 7 min and washed with water, air-dried, and then examined under an Olympus Microscope (Tokyo, Japan). Statistical analyses were performed with a two-tailed unpaired t test. We considered p < 0.05 to indicate statistical significance. To investigate the physiologic roles of autophagy in mammalian hematopoietic system, we generated a hematopoietic conditional Atg7 knockout mouse model (Atg7f/f;Vav-Cre, hereafter referred to as Atg7−/−) by breeding the Atg7f/f mice with Vav-Cre transgenic mice that the expression of Cre recombinase restricted to hematopoietic cells [21Ogilvy S. Metcalf D. Gibson L. Bath M.L. Harris A.W. Adams J.M. Promoter elements of vav drive transgene expression in vivo throughout the hematopoietic compartment.Blood. 1999; 94: 1855-1863PubMed Google Scholar, 22Cao Y. Zhang A. Cai J. et al.Autophagy regulates the cell cycle of mouse HSPCs in a nutrient-dependent manner.Exp Hematol. 2015; 43: 229-242Abstract Full Text Full Text PDF PubMed Scopus (24) Google Scholar]. Homozygous Atg7−/− mice were viable but infertile and were born at Mendelian frequency from intercrosses of heterozygous parents (Atg7f/+;Vav-Cre, hereafter referred to as Atg7+/−). The results of PCR genotyping are shown in Figure 1A. The lack of Atg7 protein in the Atg7−/− cells was also confirmed by Western blot analysis (Fig. 1B). We also tested autophagy activity by examining the two forms of LC3 in the BM Lin− cells. Unlike in WT and Atg7+/− Lin− cells, LC3-II is no longer formed in Atg7−/− Lin− cells due to Atg7 deletion–caused disruption of LC3 lipidation, demonstrating a successful loss of autophagy in hematopoietic cells. The blood count revealed that the number of platelets in the peripheral blood of Atg7−/− mice was significantly decreased compared with WT mice (Fig. 1C). The platelet size (mean platelet volume) was increased, and the large platelet (platelet-large cell ratio, P-LCR) was only observed in Atg7−/− peripheral blood (Fig. 1D). These data suggest a critical role of autophagy in normal platelet production. To assess whether the observed platelet changes in peripheral blood of Atg7−/− mice result in functional aberrations of platelet biology, we assessed the bleeding time and platelet aggregation in Atg7−/− mice. The bleeding time was significantly longer, and thrombin-induced platelet aggregation was severely decreased in Atg7−/− compared with WT mice and Atg7+/− heterozygous mice, although the Atg7+/− heterozygous mice displayed a longer bleeding time than the WT mice (Fig. 1E and 1F). The P-selectin (CD62P) level and activation of integrin αIIbβ3 (JON/A), two markers for platelet activation and aggregation, were also decreased in both Atg7−/− and Atg7+/− mice as compared with WT mice (CD62P: WT 14.5 ± 0.09, Atg7+/− 11.17 ± 0.06, Atg7−/− 3.2 ± 0.03, p < 0.01; αIIbβ3: WT 48.1 ± 0.1, Atg7+/− 13.5 ± 0.1, Atg7−/− 5.9 ± 0.2, p < 0.01; Fig. 1G and 1H). These results indicate the important role of Atg7 in platelet activation and hemostasis. To determine whether the dysfunction of platelets was a consequence of the impairment in their upstream event, i.e., abnormal differentiation of megakaryocytes, we defined the bone marrow megakaryocytes in WT, Atg7+/−, and Atg7−/− mice by CD41+CD61+ cell population and AChE activity, a marker of murine megakaryocytic cells. The percentage of CD41+CD61+ cells was decreased in Atg7−/− bone marrow cells (Fig. 2A), which was associated with increased apoptosis and necrosis, shown by flow cytometric data measured with Annexin-V (Fig. 2B). Histopathologic examination of the bone marrow and spleen from WT, Atg7+/−, and Atg7−/− mice by hematoxylin-eosin (H&E) staining showed that the number of autophagy-defective megakaryocytes from bone marrow, but not spleen, was greatly decreased (Fig. 2C), supporting the above cytometric data. In megakaryopoiesis, HSCs differentiate into megakaryocytes through their committed progenitors. To obtain megakaryocytic progenitor cells, Lin+ bone marrow cells from mice were depleted by immunomagnetic beads, and the Lin− bone marrow cells were cultured in the medium supplied with murine SCF for 2 days, then cultured for an additional 4 days in the presence of murine SCF and murine TPO. In mice lacking hematopoietic autophagy, both the Lin− cells stimulated by TPO and the platelets collected through the inferior vena cava had significantly lower AChE activity compared with WT mice (Fig. 2D). In the presence of murine TPO, many enlarged megakaryocytic cells were observed on day 3 in WT compared with few in Atg7−/− group. Microscopic examination of cytospin samples revealed that megakaryocytes in Atg7−/− mice had aberrant nongrained cytoplasm characterized by numerous vacuoles (Fig. 2E). To evaluate megakaryocyte differentiation from common myeloid progenitors, we used CD41/forward-scatter (FSC) dot plot to identify megakaryocyte population. CD41 is the lineage marker to identify megakaryocytes, and FSC properties distinguish cells on the basis of size. After differentiation, CD41+ with a high level of FSC was observed in WT cells, whereas only a low level of CD41+FSChigh cells were seen in the Atg7−/− mice (Fig. 2F). Failure to remove mitochondria and loss of control of reactive oxygen species contribute to differentiation failure in erythroid maturation [10Mortensen M. Ferguson D.J.P. Edelmann M. et al.Loss of autophagy in erythroid cells leads to defective removal of mitochondria and severe anemia in vivo.Proc Natl Acad Sci U S A. 2009; 107: 832-837Crossref PubMed Scopus (280) Google Scholar]. Lin− cells were therefore stained with MitoTracker Green or MitoTracker Deep Red or measured for mitochondrial genome abundance by quantitative PCR, all indicators of mitochondrial mass (Fig. 3A–3C), and also stained with MitoSOX, a mitochondrial superoxide indicator (Fig. 3D). Indeed, Atg7−/− bone marrow Lin− cells showed accumulated mitochondria mass and displayed increased mitochondrial superoxide production as compared with WT Lin− cells (Fig. 3A–3D). Cell cycle analysis showed that Atg7 deficiency caused apoptosis and fewer progenitor cells in diploidy and polyploidy (Fig. 3E). Megakaryocytes residing in the bone marrow are the source of platelets. Platelet production depends on successful megakaryopoiesis and megakaryocyte differentiation, which are identified by development of common myeloid progenitors with potential to commit to megakaryocytes as well as megakaryocyte polyploidization and maturation. In the final stage of megakaryocyte differentiation, megakaryocytes in bone marrow extend and release long, branched proplatelets into sinusoidal blood vessels, which undergo repeated abscissions to yield circulating platelets [23Junt T. Schulze H. Chen Z. et al.Dynamic visualization of thrombopoiesis within bone marrow.Science. 2007; 317: 1767-1770Crossref PubMed Scopus (481) Google Scholar]. Fragmentation of proplatelets occurs exclusively in the blood circulation; otherwise, platelets would remain trapped in the marrow [23Junt T. Schulze H. Chen Z. et al.Dynamic visualization of thrombopoiesis within bone marrow.Science. 2007; 317: 1767-1770Crossref PubMed Scopus (481) Google Scholar]. Ex vivo pharmacologic inhibition of autophagy in human platelets impairs platelet function, and monoallelic nontissue specific deletion of Becn1 of mice demonstrates a role of Becn1-dependent autophagy in platelet function [12Feng W. Chang C. Luo D. et al.Dissection of autophagy in human platelets.Autophagy. 2014; 10: 642-651Crossref PubMed Scopus (57) Google Scholar]. However, platelet impairment may also be attributable to other causes, since absence of nonconditional Becn1 may lead to other adverse effects on cell function. Using a conditional mouse model in which autophagy-essential gene Atg7 is exclusively deleted in the hematopoietic system, we found a severe loss of platelets in peripheral blood (Fig. 1C); meanwhile, the platelet size in the Atg7-deficient mice was significantly increased compared with that of littermate controls, indicating that Atg7 deficiency in the hematopoietic system alters platelets both in number and size (Fig. 1D). In term of irregular platelet size, loss of Atg7 may cause a failure in abscission, leading to the accumulation of premature or large platelets. As platelet number and size are inversely proportional, our data suggest that platelet reduction in number in Atg7−/− mice may be caused at least in part by formation of macrothrombocytopenias, which represent a failure in the intermediate stages of platelet production [24Thon J.N. Italiano Jr., J.E. Does size matter in platelet production?.Blood. 2012; 120: 1552-1561Crossref PubMed Scopus (66) Google Scholar]. A low count and larger size for platelets are associated with platelet dysfunction. In this study, we found that deficiency of Atg7 in the hematopoietic system prolongs the tail bleeding times and platelet aggregation induced by reduced thrombin (Fig. 1E and 1F). Moreover, the expression of platelet activation marker CD62P and activated αIIbβ3 induced by thrombin was lower in autophagy-defective platelets than in WT and Atg7+/− ones (Fig. 1G and 1H). Taken together, our data indicate that autophagy is important for platelet production and hemostasis. Our data further demonstrate that autophagy-defective hematopoietic progenitors accumulate aberrant mitochondria and generate increased levels of reactive oxygen species. These cellular disorders of autophagy defect could impair erythropoiesis [10Mortensen M. Ferguson D.J.P. Edelmann M. et al.Loss of autophagy in erythroid cells leads to defective removal of mitochondria and severe anemia in vivo.Proc Natl Acad Sci U S A. 2009; 107: 832-837Crossref PubMed Scopus (280) Google Scholar]. Thus, the reduction in the platelet count and the enlargement in platelet size may be caused by aberrant megakaryocyte lineage differentiation. Our notion was confirmed by a decreased number of megakaryocytes in Atg7−/− bone marrow using CD41 and CD61 markers or H&E staining (Fig. 2A–2C). Additionally, a previous study demonstrated that AChE activity, which exists among the membrane systems such as the Golgi complex, increases gradually during megakaryocyte maturation in the red bone marrow of mouse, rat, and cat [25Rata S. Wesemann W. McDonald T.P. Isolation of mouse megakaryocytes. I. Separation of two fractions enriched in different maturational stages.Eur J Cell Biol. 1985; 37: 111-116PubMed Google Scholar]. We found that the AChE activity clearly dropped in the platelets and megakaryocyte progenitors lacking autophagy, indicating differentiation blockage in Atg7−/− megakaryocyte progenitors (Fig. 2D). Because of the limit imposed by the infrequency of mature megakaryocytes in the bone marrow, we enriched megakaryocytes using hematopoietic progenitor cells (HPCs) obtained from the bone marrow of Atg7−/− and WT mice. Significantly fewer numbers of mature megakaryocytes were observed in Atg7−/− cultures (Fig. 2E). Autophagy is a solely cellular mechanism capable of cleaning damaged mitochondria, which is often caused by overproduction of reactive oxygen species [26Moore M.N. Autophagy as a second level protective process in conferring resistance to environmentally-induced oxidative stress.Autophagy. 2008; 4: 254-256Crossref PubMed Scopus (123) Google Scholar]. Megakaryocytes undergo progressive differentiation while becoming polyploid through endomitosis, and megakaryocyte polyploidy is positively associated with platelet production [27Geddis A.E. Megakaryopoiesis.Semin Hematol. 2010; 47: 212-219Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar]. How the polyploid cell avoids apoptotic triggers and continues to cycle remains unknown. Our data indicate that autophagy deficiency caused accumulation of mitochondria and mitochondrial superoxide (Fig. 3A–3D) and significant apoptosis (Fig. 3E) in bone marrow Lin− cells, suggesting that autophagy prevents apoptosis, secures cell cycle, and confers progenitors to differentiate to megakaryocytes. It should be noted that Atg7 deletion in the present mouse model occurs in hematopoietic stem cells, leading to autophagy defect in the entire hematopoietic system. Thus, a lineage-specific deletion of the Atg gene in megakaryocytes and platelets is needed to better assess intrinsic effects on thrombopoiesis and platelet function. In summary, in the present study, we show that autophagy is essential for megakaryopoiesis, megakaryocyte differentiation, thrombopoiesis, and platelet production. Therefore, autophagy may serve as a suitable target for megakaryocyte/platelet disorders in clinical conditions. This work was supported by grants from the National Natural Science Foundation of China (nos. 31071258 , 81272336 , and 31201073 ), the National Basic Research Program from The Ministry of Science and Technology of China (no. 2011CB512101 ), the Department of Science and Technology of Jiangsu Province of China (no BK20130333 ), and a project funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions . Conflict of interest disclosure: No financial interest/relationships with financial interest relating to the topic of this article have been declared." @default.
• W2045338741 created "2016-06-24" @default.
• W2045338741 creator A5005679100 @default.
• W2045338741 creator A5019344762 @default.
• W2045338741 creator A5022526821 @default.
• W2045338741 creator A5029394685 @default.
• W2045338741 creator A5030981796 @default.
• W2045338741 creator A5039339633 @default.
• W2045338741 creator A5042018211 @default.
• W2045338741 creator A5045752884 @default.
• W2045338741 creator A5067955864 @default.
• W2045338741 creator A5086271283 @default.
• W2045338741 creator A5088366112 @default.
• W2045338741 creator A5089893814 @default.
• W2045338741 date "2015-06-01" @default.
• W2045338741 modified "2023-10-14" @default.
• W2045338741 title "Loss of autophagy leads to failure in megakaryopoiesis, megakaryocyte differentiation, and thrombopoiesis in mice" @default.
• W2045338741 cites W1574742039 @default.
• W2045338741 cites W1625545766 @default.
• W2045338741 cites W1967467568 @default.
• W2045338741 cites W1967664376 @default.
• W2045338741 cites W1968381020 @default.
• W2045338741 cites W1976088956 @default.
• W2045338741 cites W1976360960 @default.
• W2045338741 cites W2002817805 @default.
• W2045338741 cites W2010232230 @default.
• W2045338741 cites W2017558718 @default.
• W2045338741 cites W2033085746 @default.
• W2045338741 cites W2034819850 @default.
• W2045338741 cites W2035487622 @default.
• W2045338741 cites W2036859524 @default.
• W2045338741 cites W2064973712 @default.
• W2045338741 cites W2067692987 @default.
• W2045338741 cites W2085393172 @default.
• W2045338741 cites W2088234703 @default.
• W2045338741 cites W2103054294 @default.
• W2045338741 cites W2103398208 @default.
• W2045338741 cites W2121337426 @default.
• W2045338741 cites W2134536161 @default.
• W2045338741 cites W2136331786 @default.
• W2045338741 cites W2146887271 @default.
• W2045338741 cites W2166611136 @default.
• W2045338741 cites W4229977181 @default.
• W2045338741 doi "https://doi.org/10.1016/j.exphem.2015.01.001" @default.
• W2045338741 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/25591498" @default.
• W2045338741 hasPublicationYear "2015" @default.
• W2045338741 type Work @default.
• W2045338741 sameAs 2045338741 @default.
• W2045338741 citedByCount "59" @default.
• W2045338741 countsByYear W20453387412015 @default.
• W2045338741 countsByYear W20453387412016 @default.
• W2045338741 countsByYear W20453387412017 @default.
• W2045338741 countsByYear W20453387412018 @default.
• W2045338741 countsByYear W20453387412019 @default.
• W2045338741 countsByYear W20453387412020 @default.
• W2045338741 countsByYear W20453387412021 @default.
• W2045338741 countsByYear W20453387412022 @default.
• W2045338741 countsByYear W20453387412023 @default.
• W2045338741 crossrefType "journal-article" @default.
• W2045338741 hasAuthorship W2045338741A5005679100 @default.
• W2045338741 hasAuthorship W2045338741A5019344762 @default.
• W2045338741 hasAuthorship W2045338741A5022526821 @default.
• W2045338741 hasAuthorship W2045338741A5029394685 @default.
• W2045338741 hasAuthorship W2045338741A5030981796 @default.
• W2045338741 hasAuthorship W2045338741A5039339633 @default.
• W2045338741 hasAuthorship W2045338741A5042018211 @default.
• W2045338741 hasAuthorship W2045338741A5045752884 @default.
• W2045338741 hasAuthorship W2045338741A5067955864 @default.
• W2045338741 hasAuthorship W2045338741A5086271283 @default.
• W2045338741 hasAuthorship W2045338741A5088366112 @default.
• W2045338741 hasAuthorship W2045338741A5089893814 @default.
• W2045338741 hasBestOaLocation W20453387411 @default.
• W2045338741 hasConcept C109159458 @default.
• W2045338741 hasConcept C190283241 @default.
• W2045338741 hasConcept C203522944 @default.
• W2045338741 hasConcept C2776958478 @default.
• W2045338741 hasConcept C2779705218 @default.
• W2045338741 hasConcept C28328180 @default.
• W2045338741 hasConcept C54355233 @default.
• W2045338741 hasConcept C86803240 @default.
• W2045338741 hasConcept C95444343 @default.
• W2045338741 hasConceptScore W2045338741C109159458 @default.
• W2045338741 hasConceptScore W2045338741C190283241 @default.
• W2045338741 hasConceptScore W2045338741C203522944 @default.
• W2045338741 hasConceptScore W2045338741C2776958478 @default.
• W2045338741 hasConceptScore W2045338741C2779705218 @default.
• W2045338741 hasConceptScore W2045338741C28328180 @default.
• W2045338741 hasConceptScore W2045338741C54355233 @default.
• W2045338741 hasConceptScore W2045338741C86803240 @default.
• W2045338741 hasConceptScore W2045338741C95444343 @default.
• W2045338741 hasFunder F4320321001 @default.
• W2045338741 hasFunder F4320327518 @default.
• W2045338741 hasIssue "6" @default.
• W2045338741 hasLocation W20453387411 @default.
• W2045338741 hasLocation W20453387412 @default.
• W2045338741 hasOpenAccess W2045338741 @default.
• W2045338741 hasPrimaryLocation W20453387411 @default.
• W2045338741 hasRelatedWork W2006016016 @default.

• next